Interferon Regulation Factor-3 is a Critical Regulator of the Mature of Dendritic Cells from Mice

Authors


Correspondence to: Z. Liu, Department of Hematology, Shengjing Hospital of China Medical University, Shenyang, China. E-mail: liuzg@sj-hospital.org

Abstract

Interferon regulatory factor-3 (IRF-3) plays an important role in virus and double-stranded RNA-mediated induction of type I interferon and RANTES (regulated on activation normal T cell expressed and secreted), DNA damage signalling, tumour suppression and virus-induced apoptosis. IRF-3 had recently been shown to contribute to T-cell activation in response to pathogens, which implicated an extensive immunological role for IRF-3. Dendritic cells (DCs) played critical roles as professional APCs in the development of immune responses. However, it was unclear whether IRF-3 had any effect on phenotype or function of DCs. In this study, it was shown that IRF-3 acted as a promoter of DC maturation. The level of IRF-3 expression was transiently upregulated and accumulated in the nucleus in TNF-α-induced immune maturation of mice DC cells. Knockdown of IRF-3 by small interfering RNA in DC cells resulted in both phenotypic and functional immaturation, even without TNF-α treatment. Overall, our data demonstrated for the first time that IRF-3 was a critical regulator of mice DC maturation.

Introduction

A major challenge in immunization for the treatment of cancer or persistent infectious disease is to overcome an immune system that has been downregulated after prolonged antigen exposure [1]. This will require the development of immunization reagents that are more potent immune stimulators [2]. On the other hand, in autoimmune or allergic disease, or in the delivery of potentially immunogenic transgenes for gene therapy, it will be helpful to have a mechanism to downregulate an antigen-specific immune response [3]. Much research has targeted dendritic cells (DCs) for the induction of specific immunity or antigen-specific tolerance, because DCs regulate innate and adaptive immune responses [4-6]. DCs are widely distributed in peripheral tissues as immature DCs, exhibiting high phagocytic capacity but poor antigen presentation capacity. Antigen presentation by immature DCs results in T-cell anergy or tolerance. After encountering pathogens, DCs undergo a maturation programme resulting in upregulation of major histocompatibility complex (MHC) molecules and costimulatory molecules such as cluster of differentiation CD80, CD86, CD40 and intercellular adhesion molecule I (ICAM-I) [7]. Activated DCs also secrete cytokines such as interleukin-12 (IL-12), critical for the generation of a Th1 response, or IL-10, which are critical for a Th2 response and migrating to secondary lymphoid organs where they present antigens to T cells [8].

Interferon regulatory factors (IRFs), a family of transcription mediators, have been shown to play crucial roles in the transcriptional regulation of type I IFN genes, IFN-stimulated genes (ISG) and other cytokines and chemokines [9]. So far, nine IRF members, IRF-1 to IRF-9, have been found and identified on different human chromosomes. IRF-3, an important member of the IRF family, plays an essential role in virus and double-stranded RNA-mediated induction of type I IFN genes [10]. IRF-3 is a ubiquitously expressed phosphoprotein of 427 amino acids. Under normal conditions, IRF-3 is constitutively present as a monomer in the cell cytoplasm [11]. Viral infection can trigger the phosphorylation of IRF-3, mediated by cellular TBK-1 and IKKε, which leads to its conformational change and activation [12]. The activated IRF-3 translocates to the nucleus and form homodimerization and heterodimerization and further associates with the co-activator CBP/p300, which leads to the transcriptional activation of IFN-β and other IFN-stimulated genes [13].

Despite many known biological functions of IRF3, little is known about the regulation of expression of IRF3 under normal or pathological conditions. Most cells constitutively express IRF3 in vitro, but whether the amount is sufficient to trigger effective antiviral or immunoregulatory function is not known. In this study, we observed that the expression level of IRF-3 was transiently upregulated during TNF-α induced the maturation of mice bone marrow-derived dendritic cells. Using BMDC (bone marrow dendritic cells) and DC2.4 (an immature DC cell line in mice) as models, we showed that depletion of IRF-3 by siRNA resulted in DC immaturation, even in TNF-α stimulation. We generated tolerogenic DCs by silencing IRF-3 genes in BMDC and DC2.4. We demonstrated that IRF-3-silenced DC displayed an immature phenotype; these imDC, in turn, inhibited T-cell responses in an Ag-specific manner. Thus, our data demonstrated a potent promoter role for IRF-3 in DC maturation, which was uniquely different from the known functions of IRF-3 in the viral infection and inflammatory response.

Materials and methods

Preparation of DC in culture

Female C57BL/6 mice were sacrificed and bone marrow was extracted from femurs and tibias by flushing the shaft with PBS. Blood cells were lysed using red blood lysing buffer (Sigma-Aldrich, St. Louis, MO, USA), and the remaining cells were seeded into non-tissue culture plates at a density of 4 × 106 cells per plate in medium (RPMI 1640, 10% FCS, 5 × 10−5 M 2-ME, penicillin/streptomycin) containing 10% of supernatant derived from B16 cell cultures secreting GM-CSF. The medium was replenished every 3 days, and the loosely adherent DC were collected after 8–10 days and used for further studies. To induce DC maturation, day-8 cultures were treated with LPS (1 μg/ml) for 24 h. The BMDC were characterized for their surface marker expression profile by FACS. More than 90% of the cells had high expression of CD11c. The LPS-stimulated cells had upregulation of CD86, CD40 and MHC class II (data not shown).

Incubation of bone marrow–derived DC 2.4

DC2.4 cells were C57BL/6 mice' immature dendritic cells, which were purchased from ATCC and cultivated at 37 °C with 5% CO2 in RPMI 1640 media (Life Technologies, Gaithersburg, MD, USA) supplemented with 10% foetal bovine serum (FBS; Life Technologies) and 5 ng/ml of mouse granulocyte–monocyte colony stimulating factor (R&D Systems, Minneapolis, MN, USA), 50 μm 2-mercaptoethanol, and antibiotics (penicillin/streptomycin/fungizone (PSF); Life Technologies). All cultures were incubated at 37 °C in 5% humidified CO2. Non-adherent granulocytes were removed after 48 h of culture, and fresh medium was added. DC2.4 cells were cultured for 6 days (immature DC2.4 cells [imDC2.4)] or for 8 days after being activated with TNF-α (15 ng/ml) for 48 h (mature DC2.4 cells [mDC2.4)].

Transmission and scanning electron microscopy

Bone marrow dendritic cells and DC2.4 cells were fixed for 1 h in 2% gluteraldehyde in 0.1 m phosphate buffer (pH 7.2) and post-fixed in 1% aqueous osmium tetroxide. Samples were then dehydrated through a graded series of ethanol and embedded in TAAB resin. Sections 70 nm thick were cut using a LKB IV Ultrathin sections of machine (LKB, Bromma, Sweden) and stained with 1.5% uranyl-acetate in 50% ethanol and 0.15% lead citrate before viewing on a JEM-1200EX electron microscope (JEOL, Tokyo, Japan). Images were captured using a Gratan Digital Camera and ‘Digital Micrograph 3.4’ Software (Gatan, Abington Oxon, UK).

The specimens were placed in 2% buffered formaldehyde solution, washed in Ringer's solution, post-fixed in cold 1% osmic acid and dehydrated in graded alcohols. The ossicles were submitted to increasing concentrations of ethyl alcohol and amyl acetate. They were critically point dried, secured to aluminium stubs by Dag 154 colloidal graphite and coated with gold approximately 150 A thick on a rotating stage in a vacuum evaporator. The specimens were studied with JEOL JSM 5300 type scanning electron microscope (JEOL). Images were captured using a Gratan Digital Camera and ‘Digital Micrograph 3.4’ Software (Gatan, Abington Oxon, UK).

RNA silencing

Double-stranded siRNA oligomers were transfected into BMDC and BMDC and DC2.4 cells using Qiagen Attractene Transfection Reagent according to the manufacturer's instructions. Briefly, cells were seeded into 24-well plates at a density of 2 × 106 cells per well and grown for 12 h prior to transfection with mice IRF-3 siRNA (5′-GGAGGAUUUC- GGAAUCUUCTT-3′) for 24 or 48 h. The negative siRNA control was purchased from Santa Cruz, China.

Real-time RT-PCR

Total RNA was extracted from BMDC and DC2.4 cells using Trizol (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Total RNA was subjected to cDNA synthesis using the AMV transcriptase and random primers (Takara, Tokyo, Japan). Oligonucleotide primers for PCR were sense: 5′ CGAAGCCGCAACAGACGA 3′ and antisense: 5′ CTCAGGAGGGCAAGAACG 3′ for IRF-1 (399 bp, 935–1292, NM_008390.2); sense: 5′ CTACGCAGAAAGCGAAAC 3′ and antisense: 5′ AATCCCAACAACCACCAG 3′ for IRF-2 (396 bp, 885–1280, NM_008391.4); sense: 5′ GGGATTTCTTGACTTTATTTCG 3′ and antisense: 5′ TAGGCACCACTGGCTTCT 3′ for IRF-3 (399 bp, 62–460, NM_016849.4), and sense: 5′ TCTCCTGCGACTTCAACA 3′ and antisense: 5′ TGGTCCAGGGTTTCTTACT 3′ for GAPDH (178 bp, 889–1066, NM_008084.2). Real-time PCR was performed according to the protocol of SYBR Premix Ex TaqTM II kit. Quantitative analysis of data was performed by using the ΔΔCt method. Values were normalized to GAPDH and were expressed as relative expression levels.

Western blot

Denatured protein was separated on an SDS-polyacrylamide gel and transferred to Hybond membrane (Amersham PA, USA), which was then blocked overnight in 5% skim milk in TBST. For immunoblotting, the membrane was incubated for overnight at 4 °C with the rabbit antibody against mice IRF-1 (1:1000; Santa Cruz, CA, USA) or rabbit antibody against mice IRF-2 (1:1000; Santa Cruz, CA, USA) or rabbit antibody against mice IRF-3 (1:1000; CST, MA, USA) or rabbit antibody against mice GAPDH (1:1000; Santa Cruz, CA, USA) as an internal control. Then, it was rinsed by TBST and incubated with IgG conjugated to horseradish peroxidase (1:1000; Invitrogen, CA, USA) for 2 h. Bands were visualized by ECL-Plus detection reagents (Amersham, PA, USA). The EC3 Imaging System (UVP Inc., CA, USA) was used to catch up the specific bands, and the optical density of each band was measured using image j software. The ratio between the optical density of interest proteins and GAPDH of the same sample was calculated as relative content and expressed graphically.

Immunofluorescence

Cells were grown on the coverslips in 6-well plates and then cultured with IRF-3 siRNA and/or TNF-α as mentioned earlier. The coverslips were rinsed twice with 0.01 m PBS and fixed with 4% paraformaldehyde at 4 °C for 30 min. The cells were next incubated in 0.3% Triton X-100 for 5 min at room temperature. Non-specific interactions were blocked with 5% BSA at 37 °C for 30 min. After rinsing three times with 0.01 m PBS, cells were incubated with rabbit antibody against mice phospho-IRF-3 (1:200; CST, MA, USA) overnight at 4 °C, and then with secondary TRITC-labelled goat anti-rabbit IgG for 1 h at 37 °C in the dark. DAPI was applied to all cells for nuclear counterstaining. Samples were analysed by inverted fluorescence microscope using an IX71 inverted fluorescence microscope (Olympus, Tokyo, Japan).

Flow cytometry

Bone marrow dendritic cells and DC2.4 cells were washed twice in FACS medium phosphate-buffered PBS containing 1% FCS and 0.1% NaN3. Then, the cells were incubated for 30 min at 4 °C with APC-labelled MHC-II, CD80 and CD86 antibody according to the standard procedure. An isotype control (IgG2a) was used for each antibody. Fluorescence was measured by using a FACScan flow cytometry (Becton Dickinson San Diego, CA, USA), and data were analysed by using the CellQuest Software (Becton Dickinson).

Allogeneic mixed lymphocyte reaction (MLR in vitro)

Functional activities of BMDC and DC2.4 cells were reflected in the primary allogeneic MLR assay. T cells as responder cells were obtained from an allogeneic mouse spleen. MLR assays were carried out in 96-well round-bottom plates (200μl/well) to ensure efficient BMDC and DC2.4/T-cell contact. T cells were implanted with BMDC or DC2.4 cells at 3 × 105/well (BMDC or DC2.4: T cell = 1:5, 1:10, 1:30, and 1:100) for 3 days in CO2 incubator. Then, cell proliferation was assayed by using a Cell counting kit-8 (CCK-8; Dojindo, Japan) according to the manufacturer's instructions. Each group was designed three parallel wells.

Statistical analysis

Results were expressed as mean ± SD. Statistical significance was assessed by one way analysis of variance (anova) and the anova post Bonferronites by the software graphpad prism 5.0. Differences between groups were considered significant when P < 0.05.

Results

Silencing IRF-3 in DCs

To validate gene silencing in dendritic cells, we transfected IRF-3 siRNA into BMDC and DC2.4 cells. To compare mRNA and protein levels of IRF-3 between imDCs and mDCs, we determined IRF-3 expression in BMDC and DC2.4 cells using real-time PCR and Western blot. Although low levels of IRF-3 was expressed in 6-day cultured imBMDC and imDC2.4 cells, an elevated expression was observed in 8-day cultured mBMDC and mDC2.4 cells that had been activated with TNF-α. Silencing IRF-3 using siRNA inhibited the upregulation of IRF-3 that was otherwise observed in mBMDC and mDC2.4 cells (Figs. 1 and 2). Gene silencing produced an obvious decrease in IRF-3 expression, but the expression of IRF-1 and IRF-2 did not significantly change with IRF-3 siRNA in DC2.4 cells (Figs. 3 and 4). Both in real-time PCR and in Western blot GAPDH, which was a housekeeping gene, was used as a reference gene. Collectively, these results suggested that there were more IRF-3 expression in mDCs and gene silencing could effectively block IRF-3 expression during DCs maturation.

Figure 1.

Expression of IRF-3 by real-time RT-PCR in bone marrow dendritic cells (BMDC) and DC2.4 cells with or without the treatment. The relative mRNA expression level of IRF-3/GAPDH was calculated and expressed graphically. Significant differences of IRF-3 expression in every group were analysed statistically. The data were representative of three individual experiments.

Figure 2.

Expression of IRF-3 by Western blot in bone marrow dendritic cells (BMDC) and DC2.4 cells with or without the treatment. Band intensities indicated the protein expression level of IRF-3 in every group. GAPDH was used as a loading control to assure equal amounts of protein in all lanes. The data were representative of three individual experiments.

Figure 3.

Expression of IRF-1 and IRF-2 by real-time RT-PCR in DC2.4 cells with or without the treatment. The relative mRNA expression levels of IRF-1/GAPDH and IRF-2/GAPDH were calculated and expressed graphically. The data were representative of three individual experiments.

Figure 4.

Expression of IRF-1 and IRF-2 by Western blot in DC2.4 cells with or without the treatment. Band intensities indicated the protein expression levels of IRF-1 and IRF-2 in every group. GAPDH was used as a loading control to assure equal amounts of protein in all lanes. The data were representative of three individual experiments.

IRF-3-silenced BMDC and DC2.4 cells were immature

Bone marrow–derived BMDC and DC2.4 were matured by activation of TNF-α via signalling IRF-3. A mature phenotype, expressing high levels of MHC-II, CD80 and CD86, was confirmed. Gene silencing of IRF-3 resulted in arrest of maturation, even in the presence of maturation stimuli. After gene silencing, BMDC and DC2.4 demonstrated decreasing levels of MHC-II, CD80 and CD86 (Table 1, Fig. 5A, B).

Table 1. The expressions of cytokine, MHC-II, CD80, CD86 in DC2.4 and bone marrow dendritic cells (BMDC) with or without treatment
  BlankTNF-αScramble siRNATNF-α+Scramble siRNAIRF-3 siRNATNF-α+IRF-3 siRNA
  1. a

    There were significant differences (P < 0.05) in Blank group compared with in TNF-α group, and in scramble siRNA group compared with in TNF-α+Scramble siRNA group.

DC2.4MHC-II15.4 ± 1.870.4 ± 6.8a13.8 ± 1.380.2 ± 7.7a10.5 ± 1.116.9 ± 1.9
CD8011.3 ± 2.088.2 ± 8.1a15.4 ± 1.785.1 ± 7.9a9.6 ± 1.413.8 ± 1.5
CD8620.7 ± 2.486.1 ± 8.6a17.9 ± 1.489.2 ± 9.2a8.8 ± 0.814.4 ± 1.8
BMDCMHC-II22.3 ± 5.482.7 ± 7.9a21.7 ± 8.176.5 ± 8.0a20.6 ± 5.819.3 ± 6.2
CD8019.8 ± 7.082.5 ± 10.4a25.6 ± 8.388.2 ± 10.1a14.8 ± 5.318.7 ± 5.1
CD8617.3 ± 7.179.4 ± 9.3a20.4 ± 6.883.1 ± 10.7a14.6 ± 4.718.8 ± 6.9
Figure 5.

Phenotypic analysis of bone marrow dendritic cells (BMDC) (A) and DC2.4 (B) cells after IRF-3 silencing, as determined by flow cytometry. Values shown represent mean ± SD of the mean per cent positive cells for each of these phenotypic markers (MHC-II, CD80 and CD86) derived from these experiments. Results were obtained from three independent experiments.

To determine the maturation status of BMDC and DC2.4 cells with or without the treatment of IRF-3 siRNA, we examined the maturing BMDC and DC2.4 cells on days 8, using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). On day 8, BMDC and DC2.4 cells stimulated with TNF-α or treated with TNF-α and scramble siRNA showed a fully mature phenotype with dense cytoplasmic veils, a complete absence of dendritic processes and more endosomal vesicles (Fig. 6A, B, D, E). However, on day 8, BMDC and DC2.4 cells treated with TNF-α and IRF-3 siRNA seemed to have in the majority of the cells a immature phenotype, showing long, thin dendritic processes and fewer endosomal vesicles(Fig. 6C, F).

Figure 6.

Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used to observe the phenotype with cytoplasmic veils, dendritic processes and more endosomal vesicles of DC2.4 cells with or without the treatment. (A) DC2.4 cells with TNF-α by SEM; (B) DC2.4 cells with TNF-α+scramble siRNA by SEM; (C) DC2.4 cells with TNF-α+IRF-3 siRNA by SEM; (D) DC2.4 cells with TNF-α by TEM; (E) DC2.4 cells with TNF-α+scramble siRNA by TEM; (F) DC2.4 cells with TNF-α+IRF-3 siRNA by TEM. Images were taken under SEM or TEM at 4000× magnification.

Knockdown of IRF-3 reduced functional maturation of BMDC and DC2.4 cells

Maturation of DCs was accompanied by the acquisition of enhanced capacity to present Ag(s) and migration. To determine the effect of IRF-3 knockdown in BMDC and DC2.4 cells on their Ag-presenting capacity, we compared the capacity of BMDC and DC2.4/IRF-3-KD cells with BMDC and DC2.4/Scramble cells to stimulate the proliferation of T cells in an allogeneic MLR assay. Splenocytes from BALB/c mice were used as responder T cells because of the C57BL/6 origin of BMDC and DC2.4 cells. As showed in Fig. 7, BMDC and DC2.4/Scramble cells had a high stimulatory capacity. Moreover, BMDC and DC2.4/Scramble treated with TNF-α, as expected, had the higher capacity to stimulate the proliferation of allogeneic T cells. BMDC and DC2.4/IRF-3-siRNA cells exhibited a remarkable lower capacity to stimulate the proliferation of allogeneic T cells as compared with BMDC and DC2.4/Scramble cells, indicating that knockdown of IRF-3 greatly reduced the Ag-presenting capacity of BMDC and DC2.4. Of note, TNF-α treatment to BMDC and DC2.4/IRF-3-KD cells did not enhance their capacity to stimulate the proliferation of allogeneic T cells, suggesting that knockdown of IRF-3 destructed of the function of TNF-α promoting DCs maturation. Therefore, knockdown of IRF-3 broke in both phenotypic and functional maturation of DC cells.

Figure 7.

IRF-3 siRNA decreased DC-induced allogeneic lymphocyte proliferation. Bone marrow dendritic cells (BMDC) and DC2.4 cells were transfected and matured as indicated in Materials. Allogeneic lymphocytes isolated from spleens were incubated with these cells at the indicated ratio of DC/lymphocyte for 3 days. Proliferation was determined by using the CCK8 assay kit. Data were shown as mean ± SD from three independent experiments.

During DCs maturation IRF-3 translocated to nucleus

Recent studies suggested that phosphorylation and activation of IRF-3 was not restricted to viral infection, because LPS, DNA-damaging and stress-inducing agents all stimulated nuclear accumulation, DNA binding activity and transactivation of IRF-3 [14]. In the experiment, it found that with the treatment of TNF-α IRF-3 phosphorylation was examined with nuclear accumulation in DC2.4 cells (Fig. 8B). However, without the treatment of TNF-α phosphorylated IRF-3 located in the cytoplasm (Fig. 8A). With the treatment of TNF-α+IRF-3 siRNA, there was weak IRF-3 expression in the cytoplasm (Fig. 8C). It demonstrated that TNF-α-stimulating IRF-3 phosphorylation led to cytoplasmic to nuclear translocation.

Figure 8.

Nuclear translocation of phosphorylated IRF-3 with the treatment of TNF-α. (A) DC2.4 cells without treatment; (B) DC2.4 cells with the treatment of TNF-α; (C) DC2.4 cells with the treatment of TNF-α+IRF-3 siRNA; Red presented phosphorylated IRF-3 stained by TRICT; blue presented nucleus stained by DAPI. Images were taken under a microscope at 400× magnification.

Discussion

Experimental manipulation of DC to induce tolerogenic function has been achieved by inhibiting molecules involved in DC maturation and activation [15]. Several approaches have been attempted to generate tolerogenic DC in vitro. For example, imDCs have been generated by modifying culture conditions, by blocking transcription factors such as NF-κB and by pharmacologically preventing DC maturation [16]. Tolerogenic DC has been generated by blocking costimulatory molecules through the use of Abs, fusion proteins and antisense oligonucleotide [17]. JNK inhibitor, SP600125 could inhibitor IRF-3 activity to regulating innate immunity [18]. Current research indicated that traditionally used immunosuppressants, such as tacrolimus and cyclosporin A, might indirectly result in immune suppression by stimulating production of tolerogenic DC [19].

Despite advances in studies on DC maturation, the identity of the transcription factors that play critical roles in the course of DC maturation is still not fully understood. Previous studies had shown that several transcription factors, including NF-kB, AP-1, activating transcription factor-2 and CREB, are involved in the course of DC maturation [20-23]. Our present study demonstrated that IRF-3 was another transcription factor that could control DC maturation. In the course of TNF-α-induced maturation of BMDC and DC2.4, the level of IRF-3 underwent a transient upregulation in maturing DCs at both the mRNA and protein levels (Figs. 1 and 2).

RNAi has been used to inhibit IRF-3 expression, which appears to be more attractive due to several distinct advantages with extremely efficient and specific characters [24]. Moreover, this technique is not difficult to perform and its effect can be confirmed within days using simple detection systems, such as real-time RT-PCR and Western blot. To date, RNAi technology has generated much insight into the development, activation and function of cells comprising the innate and adaptive immune systems [25]. In addition, RNAi has contributed significantly to the understanding of immune responses to pathogenesis [26]. As depicted in our study, IRF-3 expression in IRF-3 siRNA-treated BMDC and DC2.4 cells was significantly inhibited at both gene and protein levels, which were estimated by the real-time RT-PCR and Western blot technique, respectively (Figs. 1 and 2).

To determine the maturation status of DCs with or without the treatment of IRF-3 siRNA, we examined the maturing DCs on days 8, using scanning electron microscopy (SEM). Immature DCs traditionally display long, thin dendritic processes which they use to capture antigens in tissues. During maturation, DCs undergo many morphological and phenotypical changes. The surface of mature dendritic cells no longer contains the long, thin dendritic processes associated with immature cells, instead adopting a highly veiled phenotype [27]. Our data revealed that on day 8 BMDC and DC2.4 cells stimulated with TNF-α or treated with TNF-α and scramble siRNA showed a fully mature phenotype with dense cytoplasmic veils and a complete absence of dendritic processes. However, on day 8, BMDC and DC2.4 cells treated with TNF-α and IRF-3 siRNA seemed to have in the majority of the cells a immature phenotype, showing long, thin dendritic processes (Fig. 6A–C).

In addition to surface topographical analyses using scanning electron microscopy, we examined the ultrastructure of these developing DCs with or without the treatment of IRF-3 siRNA using TEM. As the primary function of DCs is antigen uptake and processing, we examined the number of dendritic processes and endosomal vesicles on mature and immature DCs. On day 8, DC2.4 cells stimulated with TNF-α or treated with TNF-α and scramble siRNA were the absence of dendritic processes and more endosomal vesicles. On day 8, DC2.4 cells treated with TNF-α and IRF-3 siRNA showed generally more dendritic processes and fewer endosomal vesicles (Fig. 6D–F).

Next, we examined TNF-α-induced upregulation of surface molecules and cytokine production in BMDC and DC2.4 cells. Untransfected BMDC and DC2.4 cells and scrambled siRNA-transfected BMDC and DC2.4 cells showed enhanced surface expression of MHC-II, CD11c, CD80 and CD86 when stimulated with TNF-α. IRF-3 siRNA-treated BMDC and DC2.4 cells did not show any enhanced expression of the surface molecules in response to TNF-α (Fig. 5A, B). Furthermore, IRF-3 siRNA-treated BMDC and DC2.4 cells obviously decreased lymphocyte proliferation, when BMDC and DC2.4 cells were cocultured with allogeneic lymphocytes (Fig. 7).

Recent studies also suggested that phosphorylation and activation of IRF-3 was not restricted to viral infection, because LPS, DNA-damaging and stress-inducing agents all stimulated nuclear accumulation of IRF-3, DNA-binding activity and transactivation [28]. In the study, we also found that TNF-α-stimulating IRF-3 phosphorylation led to cytoplasmic to nuclear translocation. It might be that TNF-α treatment of DCs induced IRF-3 nuclear translocation and regulated the DCs mature process.

In summary, our results indicated that the expressions of IRF-3 gene in mature BMDC and DC2.4 cells which were stimulated by TNF-α were higher level than those in immature BMDC and DC2.4 cells and TNF-αpromoted phosphorylated IRF-3 nuclear accumulation in DC2.4 cells. Furthermore, IRF-3 siRNA-transfected DCs could not been induced into mature state by TNF-α. Silencing IRF-3 gene in DCs might offer a potential approach in modulating the immune system to bolster immune responses, control inflammation or treat autoimmune disorders.

Acknowledgment

This manuscript was supported by 2010 Scientific Research Foundation of Shengjing Hospital of China Medical University Project, China.

Ancillary