SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Disclosure statement
  8. Acknowledgment
  9. References

Yersinia pestis is a facultative bacterium that can survive and proliferate inside host macrophages and cause bubonic, pneumonic and systemic infection. Apart from humoral response, cell-mediated protection plays a major role in combating the disease. Fraction 1 capsular antigen (F1-Ag) of Y. pestis has long been exploited as a vaccine candidate. In this study, F1-multiple antigenic peptide (F1-MAP or MAP)-specific cell-mediated and cytokine responses were studied in murine model. MAP consisting of three B and one T cell epitopes of F1-antigen with one palmitoyl residue was synthesized using Fmoc chemistry. Mice were immunized with different formulations of MAP in poly DL-lactide-co-glycolide (PLGA) microspheres. F1-MAP with CpG oligodeoxynucleotide (CpG-ODN) as an adjuvant showed enhanced in vitro T cell proliferation and Th1 (IL-2, IFN-γ and TNF-α) and Th17 (IL-17A) cytokine secretion. Similar formulation also showed significantly higher numbers of cytokine (IL-2, IFN-γ)-secreting cells. Moreover, F1-MAP with CpG formulation showed significantly high (< 0.001) percentage of CD4+ IFN-γ+ cells as compared to CD8+ IFN-γ+ cells, and also more (CD4- IFN-γ)+ cells secrete perforin and granzyme as compared to (CD8- IFN-γ)+ showing Th1 response. Thus, the study highlights the importance of Th1 cytokine and existence of CD4+ and CD8+ immune response. This study proposes a new perspective for the development of vaccination strategies for Y. pestis that trigger T cell immune response.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Disclosure statement
  8. Acknowledgment
  9. References

Pneumonic plague, caused by Yersinia pestis, is one of the most deadly infections caused millions of deaths in recorded history [1]. Currently, vaccine formulations based on recombinant F1–V fusion protein demonstrated protection against both bubonic and pneumonic plague [2, 3]. Recombinant F1–V antigen-based formulation protects mouse and cynomolgus macaques against pneumonic plague [4, 5]. Recently, DNA vaccine that expressed both F1 and YscF (Yersinia secretory component F) antigens had shown to be protective [6]. The protective antigen of Bacillus anthracis and the fraction 1 capsular antigen (F1 antigen) and V antigen of Y. pestis have been demonstrated to be potential candidate vaccine against anthrax and plague, respectively [7].

Cell-mediated immunity (CMI) to Y. pestis is important for vaccine-mediated protection against plague. Adoptively transferring Y. pestis-stimulated T cells provided protection against the disease in a fully antibody independent model, suggesting that vaccine-stimulated T cells are directly responsible for observed protection [8]. Vaccine primed cytokine production by T cells could help in protection via direct lysis of the infected cells [9]. Parenteral administration of IFN-γ and TNF-α has shown to protect mice against lethal Y. pestis challenge, and it appeared that Y. pestis virulence factors actively suppress the production of IFN-γ and TNF-α [10, 11]. Neutralization of TNF-α and IFN-γ interfered with protective efficacy of F1- or LcrV-specific antibodies against the fully virulent pgm-positive Y. pestis strain CO92 [12]. Recently, the role of IL-17 has been identified in host defence that enhances protection against pulmonary Y. pestis challenge [13]. In addition, CD4+ T cells can exert cytolytic activity on MHC class II bearing targets [14]. Involvement of CD8+ T cell–mediated immune responses in LcrV DNA vaccine has been evaluated in protection against lethal Y. pestis challenge [15]. Depleting both CD4+ and CD8+ T cells has shown to reduce protection to a greater extent than could be achieved by depleting only CD4+ or CD8+ T cells. These findings suggested that both CD4+ and CD8+ T cells contribute to protection against pulmonary Y. pestis infection.

Multiple antigenic peptide (MAP) consisting of B and T cell epitopic sequences had elicited strong and protective immune response in HIV, malaria and plague infections [16-18]. For complete protection, both antibody and T cell–mediated immunity are desirable. Therefore, an effective immunogen should contain both B and T cell epitope to generate diverse immune response for effective elimination of pathogen from body. In addition, CpG-ODN (CpG oligodeoxynucleotide) 1826 was defined as a Th1 response adjuvant, which had shown to induce protective cytokines in immunized mice [19, 20]. Our previous findings showed that conjugates of B and T cell epitopes and multiple antigen peptide–based immunogen of F1 and V antigen of Y. pestis could be alternate vaccine candidate with poly DL-lactide-co-glycolide (PLGA) micropatricle via intranasal route immunization [21-25]. In the present study, attempts were made to study cell-mediated immunity and cytokine profile of F1-MAP (MAP) with CpG-ODN as an adjuvant in PLGA delivery in different strains of mice. For further analysis of cell-mediated immunity, the involvement of CD4 and CD8 T cells in secretion of IFN-γ, perforin and granzyme in stimulated (in vitro) lymphocytes was also evaluated using flow cytometry analysis.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Disclosure statement
  8. Acknowledgment
  9. References

F1-Multiple Antigen Peptide (F1-MAP) and adjuvant

Three B (B1, B2 and B3) and one T (T1) cell epitopes of F1-Ag were used to synthesize F1-MAP on Fmoc–Gly–HMP–Tantagel (AnaSpec, Fremont, CA, USA) resin using Fmoc chemistry [22, 26]. Fmoc-Lys (ivDde)-OH (AnaSpec) was incorporated at the beginning of the synthesis for each branch to serve as the branching point. First sequence was added at the N-terminal end and blocked each branch by t-Boc protected amino acid to prevent further chain elongation. On ε-amino group of first lysine, another lysine (ivDde) was added. Next sequence was added on α-amino group of second lysine and subsequently completed the desired sequence before final deprotection. Finally, palmitate was attached at the amino terminus. The MAP was cleaved from resin, and crude MAP was purified by HPLC, lyophilized and stored.

image_n/sji12042-gra-0001.png

CpG-ODN 1826 (TCCATGACGTTCCTGACGTT) (CpG 1) (Invitrogen, San Diego, CA, USA) was used as a mucosal adjuvant. Recombinant F1-antigen (F1-Ag) was kindly provided by Dr. A. Friedlander, USA.

Mice

Six- to eight-week-old female C57BL/6J (H–2b) and BALB/c (H–2d) mice were procured from National Institute of Nutrition, Hyderabad, India. Similar numbers of outbred mice (albino) were obtained from Central Animal Facility, All India Institute of Medical Sciences (AIIMS), New Delhi. Six mice were taken per group. All the animals were provided food and water ad libitum, and experiments were conducted as per the guidelines of CPSEA (for the care and use of laboratory animals), Government of India, and adopted by the Ethics Committee on Animal Experimentation by AIIMS, New Delhi.

Microsphere preparation and immunization

Microspheres were prepared using poly (DL-lactide-co-glycolide; 50:50) (PLGA) (Sigma-Aldrich, INC, St Louis, MO, USA) by double solvent evaporation method (w/o/w) [21]. 200 mg of PLGA (Sigma-Aldrich) was dissolved in 5 ml of DCM (dichloromethane) (S D Fine Chemicals Ltd., Mumbai, India) and 15 gm of polyvinyl alcohol (PVA) (Sigma-Aldrich) was separately dissolved in 10 ml of ice-cold distilled water. 1 mg/ml solution of MAP was added to PLGA and stirrer for 5 min to get water in oil (w/o) emulsion. Now, this emulsion was added to PVA and stirrer again to get homogeneous water in oil in water (w/o/w) emulsion containing microspheres. The emulsion was washed thrice and resuspended in distilled water. Finally, microspheres were lyophilized to get dry powder for further use. Entrapment efficiency and size for microspheres were found in the range of 65–75% and 2–5 μm, respectively. Mice were immunized intranasally on day 0 with different formulations of MAP. Formulations are as follows: a) MAP (40 μg entrapped in microsphere), b) MAP + CpG (40 μg of microsphere-entrapped MAP + 5 μg of CpG), c) F1-Ag + CpG (40 μg of microsphere-entrapped F1-Ag + 5 μg of CpG) and d) empty microsphere + CpG (MS + CpG). Mice were anaesthetized with isoflurane, and saline suspension of each formulation was introduced into nostrils with a micropipette. Booster was given on day 10 with half of the primary dose. Empty microspheres + CpG were used as negative control.

T cell proliferation assay

Immunized mice were sacrificed on day 20, and the cells of spleen (SP), Peyer's patches (PP) and lamina propria (LP) were isolated and cultured in RPMI 1640 media (Sigma-Aldrich). Single-cell suspension (devoid of B cells by panning with anti-mouse immunoglobulin) was prepared, and 2 × 105 cells/well were cultured in 96-well plates in RPMI 1640 (Sigma-Aldrich) media supplemented with FCS (fetal calf serum) (HiMedia, Mumbai, India) as previously described [22]. The SP, PP and LP cells from all the immunized mice were cultured and in vitro stimulated with F1-MAP (5, 10 and 20 μg/well), F1-Ag (5, 10 and 20 μg/well) and panel of individual peptides (10, 20 and 40 μg/well) and empty microsphere + CpG + MSP (MS + CpG + MSP). Merozoite surface protein peptide (MSP) was taken as a control. Concanavalin A (2 μg/well) (Sigma-Aldrich) was used as positive control. The cultures were pulsed with (3H) thymidine (0.5 μci/well, procured from BARC, Mumbai, India) and then harvested onto glass fibre discs. Radioactive thymidine incorporation was measured by a liquid scintillation counter and expressed in terms of Stimulation Index (SI). The data were presented as a mean SI ± SD of three independent experiments.

Stimulation Index (SI) = counts per minute (cpm) in the presence of antigen or peptide/cpm in the absence of antigen or peptide.

Cytokine estimation in culture supernatant

Culture supernatants from MAP + CpG-immunized group, showing highest proliferation (10 μg/well for native F1 antigen and 10 μg/well for F1-MAP), were assayed for cytokine estimation by sandwich ELISA (eBioscience, San Diego, CA, USA) as per manufacturer's instructions.

ELISPOT assay for IFN-γ, IL-2 and IL-4

To estimate the number of cells producing IFN-γ, IL-2 and IL-4, cells of SP, PP and LP were isolated from mice immunized with different formulations as per reported protocol [22]. Nitrocellulose-lined microtitre plates (Millipore, Billerica, MA, USA) were coated with respective capture antibody overnight at 4 °C. After blocking and washing, cells were stimulated with F1-MAP, F1 antigen and individual peptides. After 48 h for (IL-2) and 72 h for (IFN-γ, IL-4), biotinylated anti-mouse antibody and streptavidin–alkaline phosphatase conjugate (eBioscience) were added. Finally, spots were developed with BCIP/NBT reagents (eBioscience). The numbers of spots present in triplicate wells, with or without stimulation, were counted with ELISPOT reader (Cellular technology Ltd. CTL, Shaker Heights, OH, USA). Results are expressed as the number of spot-forming unit (SFU)/well.

Flow cytometry analysis for IFN-γ/perforin/granzyme producing CD4+ and CD8+ T cells

Flow cytometry analysis was performed to evaluate the percentage of CD4+ and CD8+ cells producing IFN-γ, perforin and granzyme. Briefly, cultured cells were pretreated with brefeldin A to accumulate intracellular cytokine and surface stained with monoclonal anti-mouse CD4 PE-Cy7 (eBioscience) (eBioscience clone GK1.5) and anti-mouse CD8 APC/Cy7 antibodies (BioLegend, San Diego, CA, USA) (BioLegend clone 53–6.7) for 2 h in dark at 4 °C. Stained cells were centrifuged and washed twice with 2% PBS–BSA and suspended in 2% paraformaldehyde. Cells were permeabilized for intracellular cytokine staining, and anti-mouse IFN-γ–PerCP–Cy5.5 (eBioscience) (eBioscience clone XMG1.2), anti-mouse perforin–FITC (eBioscience) (eBioscience clone eBioOMAK-D) and anti-mouse granzyme B PE (eBioscience) (eBioscience clone 16G6) were added for 2 h in dark at 4 °C and finally suspended in 2% paraformaldehyde. Suitable isotype controls were used. The cells were acquired on flow cytometer (BD FACSCanto, San Jose, CA, USA ) and analysed using FACSDiva software.

Statistical analysis

The data on T cell proliferation assay and cytokine levels were analysed using nonparametric Kruskal–Wallis one-way analysis of variance by ranks. Mean value and standard deviation were calculated using Student's two-tailed t-test. FACS statistical analysis was performed using SPSS version 12.0.1 for Windows. Analysis of data was performed using a Student's t-test or one-way anova. Results are considered statistically significant if ≤ 0.05.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Disclosure statement
  8. Acknowledgment
  9. References

F1-MAP showed higher in vitro T cell proliferative response

Mice primed with MAP + CpG showed significantly higher lymphoproliferation as compared to other formulations. Cells from MAP + CpG-immunized mice when stimulated with MAP showed maximal SI value ranging from 35 ± 1.5 to 45 ± 3.5 in SP-, PP- and LP-derived cells (Fig. 1A–C). Cells of LP (45 ± 3.5) showed highest SI, which was significantly (< 0.005) higher as compared to F1-Ag-stimulated mice (Fig. 1B). SI value in splenocytes and PP cells was 40 ± 2.8 and 35 ± 2.6, respectively, in H-2d mice. Individual peptides also showed moderate SI value. Among peptides, T1 peptide showed highest SI, which was in the range of 10.4 ± 1.5 to 12.2 ± 2.2 in SP-, PP- and LP-derived cell of H-2d mice (Fig. 1D). SI value was found insignificantly higher in H-2d mice as compared to outbred and H-2b mice (data not shown). Similar results were obtained when F1-Ag-immunized mice were stimulated with F1-MAP and F1-Ag (Fig. 1A–C). The lymphoproliferative response seen was in the following order: LP> SP> PP in all strains. Negligible strain variations were observed in T cell proliferative response.

image

Figure 1. 3H-thymidine incorporation showing Stimulation Index (SI). Mice were immunized with MS + CpG, MAP, MAP + CpG and F1-Ag + CpG entrapped in microspheres, and cells derived from (A) spleen, (B) lamina propria, (C) Peyer's patches were in vitro cultured in 96-well plates and stimulated with MS + CpG + MSP (unrelated peptide), MAP and F1-Ag. (D) Cells from MAP + CpG-immunized mice were in vitro stimulated with individual peptides of MAP Radioactivity was measured with β-scintillation counter. Empty microsphere + CpG +  unrelated peptide (MS + CpG + MSP)-stimulated cells were taken as negative control. Results of three independent experiments were expressed as mean SI value ± SD (= 6 mice each group) (**< 0.005, *** < 0.001). MS + CpG: empty microsphere + CpG, MAP: MAP in microsphere, MCpG: MAP in microsphere + CpG, F1-Ag: F1 antigen.

Download figure to PowerPoint

F1-MAP with CpG-ODN enhanced Th1 cytokine secretion in vitro

Because MAP with CpG-ODN showed significantly higher T cell proliferation as compared to other formulations, we measured cytokine levels only with that formulation. Cytokine levels were found higher in culture supernatant of cells from mice immunized with F1-MAP + CpG and in vitro stimulated with F1-MAP. The range of levels of IL-2 (629 ± 28–689 ± 31), IFN-γ (872 ± 26–919 ± 36), IL-1β (1116 ± 19–1189 ± 23) and IL-12 (659 ± 16–718 ± 14) pg/ml was found in SP, LP and PP cells of all three strains. The range of IL-2 (544 ± 30–584 ± 31), IFN-γ (715 ± 26–799 ± 26), IL-1β (940 ± 29–1080 ± 13) and IL-12 (497 ± 39–597 ± 13) pg/ml was found in the cells of MAP-primed and F1-antigen-stimulated cells (Fig. 2). The levels of TNF-α (1259 ± 22–1372 ± 42) and IL-17A (1218 ± 27–1299 ± 37) pg/ml were found in SP, LP PP cells of all three strains. Lower levels of IL-4 and IL-10 were observed with similar formulation (Fig. 3). Maximum levels of Th1 type of cytokines were observed with MAP + CpG-immunized and MAP-stimulated animals as compared to other formulations.

image

Figure 2. Measurement of cytokine levels (IL-2, IFN-γ, IL-12 and IL-1β) (pg/ml) in culture supernatants of SP, PP and LP cells of H-2d mice immunized with MAP + CpG and in vitro stimulated with MS + CpG + MSP (unrelated peptide), MAP and F1-Ag. Culture supernatants were collected after 48 h for IL-2 and 72 h for rest of the cytokines and assayed for cytokine levels by sandwich ELISA. Empty microsphere + CpG + unrelated peptide (MS + CpG + MSP)-stimulated cells were taken as a negative control. Results of three independent experiments were expressed as mean ± SD (= 6 mice each group) (*< 0.02, *** < 0.001). MAP: MAP in microsphere, MAP + CpG: MAP in microsphere + CpG, F1-Ag: F1 antigen, SP (spleen), LP (lamina propria) and (PP) Peyer's patches.

Download figure to PowerPoint

image

Figure 3. Measurement of cytokine levels (TNF-α, IL-17A, IL-10 and IL-4) (pg/ml) in culture supernatants of SP, PP and LP cells of H-2d mice immunized with MAP + CpG and in vitro stimulated with MS + CpG + MSP, MAP and F1-Ag. Culture supernatants were collected after 48 h for TNF-α and 72 h for rest of the cytokines and assayed for cytokine levels by sandwich ELISA. Empty microsphere + CpG +  unrelated peptide (MS + CpG + MSP) stimulated cells were taken as a negative control. Results of three independent experiments were expressed as mean ± SD (= 6 mice each group). MS + CpG: empty microsphere + CpG, MAP: MAP in microsphere, MAP + CpG: MAP in microsphere + CpG, F1-Ag: F1 antigen. SP (spleen), LP (lamina propria) and (PP) Peyer's patches.

Download figure to PowerPoint

Also, F1-Ag-immunized mice showed high levels of cytokines when stimulated with MAP (Table 1). Similarly, cells obtained from mice on 60 days post-immunization and stimulated in vitro showed similar levels of cytokines as that of day 21 (data not shown). There was negligible variation in cytokine levels in H-2b and outbred mice (data not shown). Overall, the levels of IL-4 were comparatively less when compared to other cytokines (Table 1).When cells were stimulated with individual peptide, peptide T1 showed higher Th1 cytokine levels as compared to B1, B2 and B5 peptides (data not shown).

Table 1. Cytokine level (pg/ml) in culture supernatant
MiceH-2d
In vivo In vitro CytokinesSPLPPP
F1-AgF1-AgIL-2524 ± 22554 ± 31514 ± 32
IFN-γ629 ± 26715 ± 37615 ± 30
TNF-α1018 ± 421028 ± 321012 ± 32
IL-17A1014 ± 371054 ± 251014 ± 21
IL-1β1010 ± 391050 ± 131010 ± 21
IL-12527 ± 11557 ± 13517 ± 21
IL-10111 ± 14151 ± 12151 ± 12
IL-4211 ± 22211 ± 16251 ± 12
MAPIL-2665 ± 22684 ± 31652 ± 23
IFN-γ894 ± 25915 ± 35883 ± 42
TNF-α1343 ± 311373 ± 411311 ± 43
IL-17A1264 ± 321294 ± 331252 ± 32
IL-1β1173 ± 421183 ± 221131 ± 22
IL-12711 ± 24684 ± 21642 ± 21
IL-10163 ± 15162 ± 11112 ± 11
IL-4282 ± 21261 ± 11213 ± 11

F1-MAP–CpG-ODN enhanced cytokine-producing cells

Mice immunized with MAP + CpG formulation and cells in vitro stimulated with MAP showed higher number of cytokine-secreting cells by ELISPOT. Number of cells secreting IFN-γ, IL-2 and IL-4 was in the range of 536 ± 23–698 ± 22, 578 ± 12–476 ± 15 and 110 ± 11–166 ± 14, respectively, with SP, LP and PP cells derived from H-2d (Table 2), H-2b and outbred mice (data not shown). Moreover, cells of MAP-immunized mice when stimulated with F1-Ag, the number of cytokine-secreting cells was found slightly lower in the range 316 ± 29–534 ± 25 (IFN-γ), 316 ± 23–426± 28 (IL-2) and 100 ± 14–136 ± 17 (IL-4), respectively, in cells derived from SP, LP and PP compartments (Table 2). Among individual peptides, T1 peptide showed higher numbers of IFN-γ- and IL-2-secreting cells in all strains (data not shown). Number of cytokine-secreting cells was found significantly higher (> 0.005) as compared to MS + CpG + MSP-stimulated cells. LP cells showed slightly higher number of cytokine-secreting cells as compared to SP and PP compartments. There was insignificant difference observed in outbred, H-2b and H-2d mice.

Table 2. Enumeration of cytokine-secreting cells by ELISPOT assay (spot-forming unit (sfu)/105cells)
MiceH-2d
In vivo In vitro CytokinesSPLPPP
MS + CpGMS + CpG

IFN-γ

IL-2

IL-4

7 ± 3

8 ± 2

7 ± 2

4 ± 2

5 ± 3

4 ± 2

5 ± 4

4 ± 2

5 ± 4

MAP + CpGMS + CpG + MSP

IFN-γ

IL-2

IL-4

9 ± 3

8 ± 1

9 ± 3

13 ± 2

14 ± 3

16 ± 3

14 ± 2

16 ± 2

17 ± 3

MAP

IFN-γ

IL-2

IL-4

599 ± 33

479 ± 13

141 ± 15

698 ± 22

498 ± 12

166 ± 14

576 ± 35

456 ± 25

140 ± 13

F1-Ag

IFN-γ

IL-2

IL-4

429 ± 23

329 ± 13

121 ± 13

518 ± 12

348 ± 13

136 ± 17

416 ± 31

336 ± 15

100 ± 14

F1-Ag + CpGMAP

IFN-γ

IL-2

IL-4

539 ± 33

429 ± 13

111 ± 15

618 ± 22

408 ± 12

116 ± 14

516 ± 35

416 ± 25

110 ± 13

F1-Ag

IFN-γ

IL-2

IL-4

419 ± 23

319 ± 13

101 ± 13

408 ± 12

318 ± 13

146 ± 17

416 ± 31

416 ± 15

130 ± 14

Similarly, when cells from F1-Ag-immunized mice were in vitro stimulated with F1-Ag and MAP, significantly higher number of IFN-γ- and IL-2-secreting cells was observed as compared to MS + CpG + MSP-stimulated cells (Table 2). Again, MAP-stimulated cells showed higher number of cell secreting IFN-γ and IL-2 cells as compared to F1-Ag (Table 2).

Secretion of IFN-γ, perforin and granzyme

Flow cytometry analysis showed that both CD4 and CD8 T cells are involved in secretion of IFN-γ, perforin and granzyme. Mice immunized with MAP and cells stimulated with MAP and F1-Ag showed 11 ± 1.5% (SP), 12 ± 2% (LP), 18 ± 1.6% (PP) and 9 ± 1.1% (SP), 10 ± 1.3% (LP), 8 ± 1.2% (PP) per cent of CD4 cells secreting IFN-γ in H-2d mice. Percentage of CD4- IFN-γ+-secreting perforin+granzyme+ (double positive) cells were in the range of 55 ± 4.4 (SP), 59 ± 3.3 (LP) and 47 ± 3.2 (PP) with MAP immunized and in vitro stimulated cells (Fig. 4). The percentage cells were found to be significantly higher as compared to F1-Ag-immunized and F1-Ag-stimulated cells (< 0.005) (Fig. 4). Among individual peptides, peptide T1 showed significantly higher number of CD4+ IFN-γ+- and (CD4- IFN-γ)+ perforin+granzyme+-secreting cells as compared to other peptides (Table 3).

Table 3. Intracellular cytokine staining showing CD4+ ifn-γ+ and (CD4 FN-γ)  + perforin + granzyme + secreting cells (% cells taking 10,000 events)
H-2d MiceCD4+ IFN-γ+(CD4 FN-γ) + Perforin + Granzyme
In vivo In vitro SPLPPPSPLPPP
MS + CpGMS + CpG1.8 ± 0.21.8 ± 0.11.1 ± 0.33.0 ± 0.62.0 ± 0.32.0 ± 0.7
MAP + CpGMS + CpG + MSP1.3 ± 0.21.4 ± 0.31.2 ± 0.34.0 ± 0.63.0 ± 0.34.0 ± 0.7
MAP13.0 ± 1.214.0 ± 2.28.0 ± 1.659.0 ± 6.769.0 ± 4.745.0 ± 5.4
F1-Ag11.0 ± 1.111.0 ± 2.48.1 ± 1.548.0 ± 5.549.0 ± 5.742.0 ± 4.2
B12.9 ± 0.62.4 ± 0.82.1 ± 0.118.0 ± 6.419.7 ± 4.712.8 ± 2.3
B22.9 ± 0.92.7 ± 0.41.3 ± 0.219.1 ± 4.318.8 ± 2.611.8 ± 2.1
B51.3 ± 0.11.87 ± 0.21.15 ± 0.318.1 ± 3.519.7 ± 5.711.8 ± 1.5
T14.8 ± 0.65.87 ± 0.53.2 ± 0.522.1 ± 4.326.7 ± 4.522.8 ± 2.4
F1-AgMAP8.0 ± 1.88.8 ± 1.15.1 ± 1.938.0 ± 5.148.0 ± 4.621.0 ± 3.6
F1-Ag7.0 ± 1.35.6 ± 1.55.2 ± 1.329.0 ± 5.538.0 ± 3.722.0 ± 2.6
image

Figure 4. Flow cytometry profile of intracellular cytokine staining of IFN-γ-secreting CD4+ cells derived from mice immunized with MAP + CpG and in vitro stimulated with (A) MS + CpG + MSP (B) MAP (C) F1-Ag. CD4+cells derived from mice immunized with F1-Ag  + CpG and in vitro stimulated with (D) MAP and (E) F1-Ag. (CD4 IFN-γ)  +  cells showing perforin + granzyme + secretion from mice immunized with MAP + CpG and in vitro stimulated with (F) MS + CpG + MSP (G) MAP (H) F1-Ag. Immunized with F1-Ag + CpG and in vitro stimulated with (I) MAP and (J) F1-Ag. Graph showing relative percentage of CD4+-secreting (K) IFN-γ (L) perforin + granzyme cells in all combinations. Empty microsphere + CpG + unrelated peptide (MS + CpG + MSP) stimulated cells were taken as negative control. Data of three independent experiments were expressed as mean percentage ± SD (= 6 mice each group) (*< 0.005, *** < 0.001). MAP: MAP in microsphere, MAP + CpG: MAP in microsphere + CpG, F1-Ag: F1 antigen, SP (spleen), LP (lamina propria) and (PP) Peyer's patches.

Download figure to PowerPoint

Also, the percentage of IFN-γ-secreting CD8 cells obtained from mice immunized with MAP and stimulated with MAP and F1-Ag were 5 ± 1.2 (SP), 6 ± 0.93 (LP), 3 ± 1.1 (PP) and 4 ± 0.93 (SP), 5 ± 0.83 (LP) and 3 ± 1.1 (PP), respectively (Fig. 5). The percentage of CD8- IFN-γ+-secreting perforin+granzyme+ (double positive) cells were found in the range of 28 ± 2.4 (SP), 35 ± 2.3 (LP) and 25 ± 4.2 (PP) with MAP-stimulated cells (Fig. 5). The percentage cells were found to be significantly higher as compared to F1-Ag-immunized and F1-Ag-stimulated cells (< 0.02) (Fig. 5). Among individual peptides, peptide T1 showed significantly higher number of CD8+ IFN-γ+ and (CD8- IFN-γ)+ perforin+granzyme+-secreting cells as compared to other peptides (Table 4). There was insignificant difference observed among different strains (data not shown).

Table 4. Intracellular cytokine staining showing CD8+ IFN-γ+ and perforin + granzyme secreting cells (% cells taking 10,000 events) by flow cytometry
H-2d miceCD8+ IFN-y+(CD8 IFN-y)+ Perforin + Granzyme
In vivo In vitro SPLPPPSPLPPP
MS + CpGMS + CpG1.4 ± 0.31.6 ± 0.11.2 ± 0.31.2 ± 0.21.9 ± 0.31.1 ± 0.2
MAP + CpGMS + CpG + MSP1.3 ± 0.21.4 ± 0.31.2 ± 0.31.2 ± 0.22.9 ± 0.32.1 ± 0.2
MAP5.3 ± 0.36.6 ± 0.23.3 ± 0.129.0 ± 3.236.0 ± 4.223.0 ± 5.0
F1-Ag4.6 ± 0.15.8 ± 0.23.4 ± 0.227.0 ± 1.338.0 ± 5.222.0 ± 5.0
B12.5 ± 0.11.9 ± 0.11.5 ± 0.15.0 ± 1.17.0 ± 2.45.0 ± 0.3
B22.2 ± 0.22.9 ± 0.41.9 ± 0.26.0 ± 1.36.0 ± 0.55.0 ± 2.4
B52.3 ± 0.33.8 ± 0.21.7 ± 0.35.0 ± 1.27.0 ± 0.65.0 ± 1.5
T13.4 ± 0.23.9 ± 0.32.9 ± 0.28.0 ± 1.19.0 ± 0.77.0 ± 1.3
F1-AgMAP3.3 ± 0.35.0 ± 0.22.4 ± 0.218.0 ± 3.524.0 ± 3.614.0 ± 3.2
F1-Ag3.4 ± 0.44.0 ± 0.23.5 ± 0.311.0 ± 2.117.0 ± 2.18.0 ± 2.0
image

Figure 5. Flow cytometry profile of intracellular cytokine staining of IFN-γ-secreting CD8+ cells derived from mice immunized with MAP + CpG and in vitro stimulated with (A) MS + CpG + MSP (B) MAP (C) F1-Ag. CD8+cells derived from mice immunized with F1-Ag  + CpG and in vitro stimulated with (D) MAP and (E) F1-Ag. (CD8 IFN-γ) + cells showing perforin + granzyme + secretion in cells from mice immunized with MAP + CpG and in vitro stimulated with (F) MS + CpG + MSP (G) MAP (H) F1-Ag. Immunized with F1-Ag + CpG and in vitro stimulated with (I) MAP and (J) F1-Ag. Graph showing relative percentage of CD8+-secreting (K) IFN-γ (L) perforin granzyme cells in all combinations. Empty microsphere + CpG + unrelated peptide (MS + CpG + MSP) stimulated cells were taken as negative control. Data of three independent experiments were expressed as mean percentage ± SD (= 6 mice each group). MAP: MAP in microsphere, MAP + CpG: MAP in microsphere + CpG, F1-Ag: F1 antigen. SP (spleen), LP (lamina propria) and (PP) Peyer's patches. (*< 0.005, ** < 0.001).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Disclosure statement
  8. Acknowledgment
  9. References

Development of fully effective vaccine against Y. pestis is still a challenge. Both humoral (Th2) and cellular immune (Th1) arm of immune system are needed for full protection [27]. Development of Th1 type immune response against intracellular bacteria often relies upon the expansion of pathogen-specific T cells that secrete pleiotropic cytokine such as IL-2, IFN-γ and TNF-α, which in turn combat intracellular bacteria by different effector mechanisms [28, 29]. Y. pestis have evolved highly efficient machinery to deplete NK cells thereby decreasing the secretion of IFN-γ, resulting in a reduced production of reactive nitrogen intermediates by macrophages. The suppression of the production of pro-inflammatory factors not only reduces the activation of NK cells and phagocytes, but also destroys inflammatory environment for the adaptive immunity [30].

Synthetic peptide-based immunogen has been studied in number of infectious diseases. Collinearly synthesized B and T cell epitopes have been shown to be effective against Y. pestis challenge [21-24]. In this study, multiple antigen peptide approach containing three B cell and one T cell epitopes of F1 antigen showed enhanced cellular response as compared to F1 antigen in murine model. CpG-ODN contained bacterial DNA, induced immune response via TLR9 and activates innate immune system. Similarly, synthetic CpG-ODNs can stimulate B cells, monocytes, macrophages and dendritic cells (DCs), inducing the secretion of pro-inflammatory and type 1 cytokines, resulting in the generation of a type 1–biased immune response [31-33]. CpG-ODNs have shown to enhance antibody response in mice for P.Vivax-, HIV-, anthrax- and Y. pestis-derived epitopic sequences in mice model [20, 32, 34]. In our study, splenocytes, LP and PP cells obtained from F1 MAP with CpG-ODN-immunized mice and stimulated with F1-MAP showed enhanced T cell proliferation in vitro in different strains of mice. In vitro T cell proliferation data indicated that F1-MAP activates T cell to acquire optimal lymphocyte proliferation. The PP are enriched with lymphocytes, macrophages, plasma cells and M cells, which transport effectively live and non-replicating antigens from the gut lumen into the organized lymphoid tissues [35]. Antigen-stimulated B and T cells in PP leave via efferent lymphatics and reach to effector sites such as the LP of the respiratory, gastrointestinal and reproductive tracts [36]. We have observed slightly higher value of SI in LP cells. High SI value in LP cells for F1-MAP could be because of the presence of large lymphocyte population as compared to other two compartments, and also unlike Peyer's patch, the LP is an effector site that has a major role in mediating CD4+ and CD8+ response in various mucosal compartments.

IFN-γ contributes to antimicrobial defence via a number of distinct mechanisms [29], including upregulation of NOS2 expression by macrophages, a process that results in the production of nitric oxide and subsequent killing of intracellular organisms. In the presence of IFN-γ, TNF-α further upregulates macrophage NOS2 expression [37]. TNF-α and IFN-γ also contribute to T cell–mediated protection in B cell–deficient μMT mice challenged with attenuated Y. pestis. Moreover, parenteral administration of IFN-γ and TNF-α protects mice against lethal Y. pestis infection [8, 38, 39]. We observed high levels of IFN-γ and TNF-α in the cells obtained from mice immunized with MAP + CpG and stimulated with MAP. High levels of IL-2 were observed with same formulation. Furthermore, numbers of cytokine-secreting cells were also correlated with cell proliferation on one side and levels of secreted cytokines on the other side with all formulations. MAP with CpG-ODN showed high levels of Th1 cytokines in SP, LP and PP cells of outbred, H-2b and H-2d mice. Th1 cytokines also induce IgG2a and IgG2b subclass production and activate complement system more effectively. The predominance of the IFN-γ response in ELISPOT assay with MAP highlights the importance of MAP construct as subunit vaccine. We have observed high-titre antibodies, amnestic response and antibody isotype in sera of mice immunized with F1 MAP with CpG through intranasal route in microsphere delivery [20, 25].

Th17 cells also produce pro-inflammatory cytokine IL-17A, IFN-γ, TNF-α, IL-6 and GM-CSF under certain circumstances [41, 40, 42]. Vaccinating B cell–deficient mice with D27-pLpxL, a live attenuated Y. pestis strain, increases numbers of pulmonary IL-17-producing CD4 T cells without significantly impacting bacterial burden in mice. Neutralizing IL-17 reverses the improved survival associated with prime/boost vaccination [13]. These observations strongly suggest that IL-17 is an important cytokine in vaccine-mediated protection through recruitment of neutrophils. High levels of IL-17 in SP, LP and PP cells of MAP + CpG-ODN-immunized and MAP-stimulated cells further authenticate profound immune activation with this formulation.

Furthermore, we studied the role of T cell subpopulations secreting IFN-γ, perforin and granzyme. Both CD4 and CD8 T cells can confer significant protection against Y. pestis infection. CD4+ T cells also play critical roles in the development and maintenance of memory CD8+ T cell responses [14, 36]. In the present study, we observed that MAP + CpG showed higher percentage of CD4+ IFN-γ+ as well as (CD4 IFN-γ)+ perforin+granzyme+ (double positive) cells as compared to CD8+ IFN-γ+ cells. This suggests that F1-MAP with CpG had activated both CD4 and CD8 cells that mediate the bactericidal capacities of phagocytes and/or protecting phagocytes from the debilitating effects of Y. pestis virulence factors.

Our study demonstrated that F1-MAP alone and with CpG in microsphere delivery activated CD4+ and CD8+ T cells in vitro and showed enhanced secretion of perforin and granzyme. This may enhance specific priming of CD4+ and CD8+ T cells and antibacterial activity as an improved vaccine. MAP + CpG are able to induce intense cytokine-mediated immune response following intranasal immunization and able to provide suitable protection from the deadly challenges of Y. pestis, thus providing a broad perspective for development of effective plague vaccine.

Acknowledgment

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Disclosure statement
  8. Acknowledgment
  9. References

The authors are grateful to Department of Biotechnology (DBT), New Delhi, for providing financial assistance to carry out the study and Council for Scientific and Industrial Research (CSIR) to provide fellowship to Mr. Riyasat Ali.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Disclosure statement
  8. Acknowledgment
  9. References