Expression of Interleukin-22 in Myasthenia Gravis

Authors


Correspondence to: Y. Zhang, Department of Neurology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu, China. E-mail: zy20037416@163.com

Abstract

IL-17 and IL-22 are implicated in the pathogenesis of autoimmune diseases. The roles of IL-22 in the pathophysiology of myasthenia gravis (MG) remain unsettled. The aim of this study was to investigate the possible relationship between serum IL-22, IL-17 levels, anti-acetylcholine receptor antibody (anti-AChR Ab) titres and clinical parameters in patients with MG. The serum IL-22, IL-17 levels and anti-AChR Ab titres were tested by enzyme-linked immunosorbent assay (ELISA), while the expression of IL-22 and IL-17 mRNAs in peripheral blood mononuclear cells (PBMC) from healthy and MG subjects were detected by quantitative real-time PCR (qRT-PCR). Furthermore, PBMC from 12 patients with generalized MG were purified and treated with recombinant human IL-22 (rhIL-22), the IL-17 levels of supernatant were detected by ELISA. We found that the IL-17 levels were significantly increased, but IL-22 levels were significantly decreased in the serum of patients with MG compared with healthy controls. Consistantly, a significant decrease in IL-22 mRNA levels and an increase in IL-17 mRNA levels were detected in PBMC collected from patients with MG, compared with healthy controls. A negative correlation between IL-22 mRNA in PBMC, serum IL-22 and serum anti-AChR Ab levels was found in patients with MG. Moreover, in cultured MG PBMC treated with recombinant human IL-22 (rhIL-22), the IL-17 levels were decreased in a dose-dependent manner. Our findings indicated a possible role of IL-22 as a protective factor in MG.

Introduction

The human autoimmune disease myasthenia gravis (MG) is a T-cell-dependent, antibody-mediated, organ-specific autoimmune disease, in which the nicotinic acetylcholine receptor (AChR) at neuromuscular junctions is the major autoantigen [1]. Patients with MG can be categorized into two subgroups: (1) patients with purely ocular muscle weakness (ocular MG); and (2) patients with generalized muscle weakness, including bulbar and limb muscles (generalized MG) [2]. Approximately, 80–85% of patients with generalized MG and 50% of patients with ocular MG have demonstrable antibodies against AChR. There is a relationship between the antibody titres and disease in an individual patient [3, 4].

Although antibodies to AChR are directly responsible for the destruction of the muscle endplate resulting in both MG and EAMG, the autoantibody response is T cell dependent, with CD4+ T cells providing help for B cells to produce anti-AChR antibodies [5, 6].Activated T cells can be classified into subsets based on their cytokine production profiles, that is, T-helper 1 (Th1), Th2 and T-regulatory (Treg) cells. Recently, a new T-helper subset, Th17, has been identified and found to have a role in several autoimmune diseases, such as multiple sclerosis and systemic lupus erythematosus. These cells secrete a variety of cytokines, including IL-17, IL-21 and IL-22, with proinflammatory function [4]. Bai et al. [7] have reported that IL-17 was a key to autoantibody responses in an experimental murine autoimmune myasthenia gravis model. The authors noted that IL-17 elicited higher antibody responses to the autoantigen AChR. Roche JC et al. [8] have recently reported that IL-17 concentrations were higher in generalized MG compared with controls and correlated with anti-acetylcholinesterase receptor antibody titres.

Interleukin (IL)-22, a member of IL-10 family of cytokines, is produced by special immune cell populations, including CD4+ T cells (Th1, Th17 and Th22 cells), NK cells, NKT cells and lymphoid tissue–inducer cells [9]. Previous studies have indicated the importance of IL-22 in host defence against Gram-negative bacterial organisms (in gut and lung). Recently, there is emerging evidence that IL-22 is involved in the development and pathogenesis of several autoimmune diseases, such as systemic lupus erythematosus (SLE) [10-14], rheumatoid arthritis (RA) [15-19], multiple sclerosis (MS) [20-22], Sjögren's syndrome (SS) [23, 24] and psoriasis [25, 26]. Therapeutics targeting IL-22 therefore may have promise for treating various autoimmune diseases. At present, no clinical data are available on the expression of IL-22 in patients with MG; therefore, we measured the serum concentration of IL-22 and the expression of IL-22 mRNA in PBMCs in the patients of this disease to determine whether the concentration of this cytokine is linked to clinical parameters and MG severity.

Materials and methods

Study population

Thirty patients with MG were recruited prospectively from January 2011 to May 2012 (14 males and 16 females; mean 41.93 ± 13.48 years, median 39.5 years, range 21–66 years) from the Department of Neurology at the Affiliated Hospital of Xuzhou Medical College. The diagnosis of MG was made based on the following criteria: typical history and signs of fluctuating weakness of voluntary muscles, presence of serum anti-acetylcholine receptor antibodies (AChR Ab), definite clinical improvement on injection of the cholinesterase inhibitor, edrophonium, and decremental pattern on repetitive nerve stimulation [27]. The patients were ranked according to the classification of MG (Osserman) [28]. The clinical characteristics of the patients are summarized in Table 1. All patients were classified into one of two groups: ocular MG (18 patients) or generalized MG (12 patients) [2]. All patients were seropositive for anti-AChR antibodies. Thymic abnormalities were found in six patients (five had a thymoma and had undergone a thymectomy, and the other had a hyperplastic thymus that was diagnosed by computed tomography). The patients did not have other autoimmune diseases, ongoing infection and malignancies. None of the patients had received any immunomodulatory drugs within the past 3 months. The control group consisted of 30 healthy subjects with no inflammatory diseases (14 male and 16 female; 38.33 ± 13.09 years of age, range 21–65 years). Our study received prior approval by local ethic committee and informed consent was obtained from each subject.

Table 1. General information of study subjects
InformationMG patientsOcular MGGeneralized MG (II a and II b)HCs
  1. MG, myasthenia gravis; HCs, healthy controls.

Number of cases30181230
Age (Years)41.93 ± 13.4841 ± 14.6943.3 ± 11.8938.33 ± 13.09
Female/Male16/1410/86/616/14
Disease course6 days–20 years (Mean 34.2 months)6 days–20 years (Mean 3 9. 5 months)7 weeks–9 years (Mean 29.2 months)
Thymus abnormalities/Thymectomy6/53/33/2

Serum samples acquisition

Blood samples were obtained by venipuncture and immediately centrifuged for 15 min at 1610 g. Serum samples were stored at −80 °C until assay. All samples were measured in duplicate and analysed simultaneously.

RNA extraction

Total RNA was extracted from PBMCs using Trizol reagent (Invitrogen, USA) according to the manufacturer's instructions. PBMCs were separated by lymphocytes separation medium (Beijing Solarbio Science & Technology Co., Ltd.) density gradient centrifugation from heparinized venous peripheral blood. The aqueous phase was transferred to a fresh tube, and equal volume of isopropanol was added. After precipitation, samples were centrifuged at 12,000 × g for 15 min at 4 °C. The RNA was washed once with 75% ethanol at 4 °C followed by recentrifugation. The RNA pellet was air-dried, resuspended in nuclease-free water at 500 ng/ul concentration and stored at −80 °C.

Cytokine measurement by enzyme-linked immunosorbent assay (ELISA)

For the quantification of IL-22 and IL-17 in human serum samples, Human IL-22 and IL-17 Quantikine Elisa Kit (R&D Systems, Minneapolis, MN) were used following manufacturer's guidelines.

Detection of Anti-AChR antibody production by ELISA

Anti-AChR-IgG responses were measured by indirect ELISA as described [29, 30]. 96-well flat-bottomed polystyrene plates were coated with purified AChR (0.5 μg/ml in 100 μl) overnight at 4 °C, washed with PBS-T (PBS 0.05% Tween 20) the following day and blocked with 10% fetal calf serum at room temperature (RT) for 30 min. Then, washed the plate again with the same step. Serum (1:100) was incubated at RT for 1.5 h in a volume of 100 μl. Sera from healthy persons were used for background control. Each sample was duplicated. After four washes, HRP-conjugated goat-anti-human IgG (1:1000) was added and incubated at 37 °C for 1.5 h. Chromogenic reagent A solution and B solution were added each 70 ul after four washes, with the seal plate film sealed the reaction hole. The reaction allowed to develop at 37 °C in the dark for 10 min. Finally, 50 ul termination solution was joined in every reaction hole to terminate the chromogenic reaction. Plates were read at an OD 490 nm (OD, optical density) and results expressed as OD values ± standard deviation (SD).

Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

In accordance with the manufacturer's instructions, total RNA from PBMCs was extracted using Trizol reagent (Invitrogen, USA), according to the method described above, dissolved in ddH2O processed by DEPC. Total RNA was reverse-transcribed to cDNA using MMLV reverse transcriptase (Promega) and looped antisense primer mix. The synthesized cDNA was amplified by PCR using the following primers and conditions: Homo IL-22, sense 5′- CCCTGGCACCCAGCAC-3′, antisense 5′-GCCGATCCACACGGAGTAC-3′; IL-17, sense 5′-TGTCACTGCTACTGCTGCTG-3′, antisense 5′- GTGAGGTGGATCGGTTGTAG -3′; β-actin, sense 5′- GCTGCCTCCTTCTCTTGG -3′, antisense 5′- GTGCGGTTGGTGATATAGG -3′. A total 20 ul of real-time PCR system consists of 2xReal-time PCR Master Mix 10 ul, RNase-free water 7.6 ul, 0.2 ul forward/reverse primer, 2 ul cDNA template and 0.4 ul Taq DNA Polymerase. Amplification and detection were performed as follows: 95 °C, 3 min degeneration, 95 °C, 30 s, 62 °C, 40 s, a total of 40 cycles. A calibration curve was performed with purified PCR products of target genes. Melting curve analysis, obtained by increasing temperature from 60 °C to 95 °C with a heating rate of 0.1 °C per second and a continuous fluorescence measurement, revealed a single narrow peak of suspected fusion temperature. cDNA was amplified by SYBR Green Universal PCR Master mix (Biorad, Hercules, CA, USA) in triplicate. All the procedures were strictly performed as per the instructions of the corresponding kits. To analyse the expression levels of IL-22 mRNA, we used the comparative threshold cycle (ΔΔCt) method of relative quantification with ABI StepOne Plus Detection System. The results were automatically analysed by the ABI StepOne Plus instrument and method of 2−ΔΔCt (ΔCt represents the difference of threshold cycle value between the target gene and the inner control; ΔΔCt represents the difference of ΔCt between different group) was used to analyse the mRNA expression.

Cell isolation and culture

PBMC were prepared from heparinized blood by Ficoll–Hypaque density gradient centrifugation. Cell cultures were performed as described previously [31]. In brief, cells were washed twice with PBS to completely remove the serum. Then, they were suspended in RPMI 1640 supplemented with 5% calf bovine serum (CBS, Life Technologies, Inc.) and 1% penicillin–streptomycin (Life Technologies, Inc.). The cell suspension was adjusted to a concentration of 2 × 105 cells/ml, and cultured in a 24-well plastic culture plate in a final volume of 1 ml at 37 °C in 5% CO 2/95% air. Subsequently, MG and controls PBMC was cultured with recombinant human IL-22 (rhIL-22, R&D Systems) (0, 1, 5 or 10 ng/ml) for 96 h in combination with anti-CD3 (10 μg/ml) and anti-CD28 (1 μg/ml) (BD Biosciences, San Diego, CA, USA). The culture supernatant was collected and kept frozen until IL-17 level were measured.

Statistical analysis

Data are expressed as mean ± SD. Group t test was applied to compare serum level of two groups. Messenger RNA and anti-AChR Ab levels were correlated by parametric Pearson correlation analysis. With a = 0.05 for significant level, P-values less than 0.05 were considered statistically significant.

Results

Serum IL-17, IL-22 and anti-AChR Ab levels from patients with MG and healthy controls

We compared serum concentrations of IL-17, IL-22 and anti-AChR Ab between patients with MG and the normal control group. The level of IL-17 and anti-AChR Ab was significantly higher in patients with MG than healthy controls (Fig. 1A, Fig. 1E, P < 0.001), while the level of serum IL-22 was significantly lower in patients with MG (Fig. 1C, P < 0.001); Furthermore, in two types of patients with MG, the expression level of the three indexes was also different. There is a significant increase in serum IL-17 and anti-AChR Ab levels from patients with generalized MG compared with patients with ocular MG (Fig. 1B, Fig. 1F, P < 0.01). Higher serum levels of IL-22 was observed in patients with generalized MG compared with patients with ocular MG (Fig. 1D, P < 0.001).

Figure 1.

IL-17, IL-22 serum levels and anti-AChR Ab titres in myasthenia gravis patients and healthy persons (middle horizontal bars, mean; each dot, single donor). (A, E) The levels of IL-17 and anti-AChR Ab were significantly higher in patients with myasthenia gravis (MG) than normal persons (19.31 ± 5.11 pg/ml versus 8.87 ± 2.45 pg/ml; 0.63 ± 0.08 versus 0.15 ± 0.07); (B, F) The levels of IL-17 and anti-AChR Ab were significantly higher in generalized MG patients than ocular MG patients (24.11 ± 3.78 pg/ml versus 16.11 ± 2.84 pg/ml; 0.67 ± 0.07 versus 0.61 ± 0.08); (C) The levels of IL-22 were significantly lower in patients with MG than normal persons (19.63 ± 4.59 pg/ml versus 41.95 ± 6.50 pg/ml). (D) The levels of IL-22 were significantly lower in patients with generalized MG than patients with ocular MG (15.15 ± 2.04 pg/ml versus 22.08 ± 3.59 pg/ml) (**P < 0.01,***P < 0.001).

Measurements of IL-22 and IL-17 mRNA levels in PBMC from patients with MG and healthy controls

We quantified IL-17 mRNA and IL-22 mRNA levels in normal control persons and patients with MG by qRT-PCR. Consistent with the serum level, IL-17 mRNA level was significantly higher in MG patients than normal persons (Fig. 2A, P < 0.001), with lower expression in ocular patients than in generalized ones (Fig. 2B, P < 0.01). Conversely, as shown in Fig. 2C, patients with MG showed significantly lower median relative expression of IL-22 mRNA when compared with healthy subjects (Fig. 2C, P < 0.001). Furthermore, IL-22 mRNA levels were significantly decreased in patients with generalized MG with respect to those with ocular MG (Fig. 2D, P < 0.001).

Figure 2.

Detection of IL-17 mRNA and IL-22 mRNA in PBMCs from patients with myasthenia gravis and healthy persons by qRT-PCR. (A, B) IL-17 mRNA levels were significantly higher in patients with myasthenia gravis (MG) than normal persons, with higher expression in generalized patients than in ocular ones. (C, D) Conversely, the expression level of IL-22 mRNA decreased obviously in patients with MG compared with normal control group, with lower expression in generalized patients than in ocular ones (**P < 0.01, ***P < 0.001).

Correlation between IL-17 mRNA, IL-22 mRNA level in PBMCs and serum anti-AChR Ab titres

Moreover, a significative correlation between IL-22 mRNA, IL-17 mRNA levels and anti-AChR Ab titres was found. In all of the 30 patients with MG, IL-17 mRNA level presents a significantly positive correlation with the expression level of anti-AChR Ab in either all the MG subjects or the different types of patients with MG (Fig. 3A–C); On the contrary, IL-22 mRNA level presents a significantly negative correlation with the expression level of anti-AChR Ab in all the patients with MG (Fig. 3D). Moreover, the IL-22 mRNA and anti-AChR Ab also present negative correlation in the different types of patients with MG (Fig. 3E, F).

Figure 3.

Correlation between IL-17,IL-22 mRNA expression and anti-AChR Ab titres. (A, B, C) IL-17 mRNA level presents a significantly positive correlation with the expression level of anti-AChR-IgG in either all the myasthenia gravis (MG) subjects or the different types of patients with MG, the correlation coefficient is 0.536 (P < 0.01), 0.551 (ocular MG, P < 0.05) and 0.619 (generalized MG, P < 0.05) respectively; (D) IL-22 mRNA level presents a significantly negative correlation with the expression level of anti-AChR Ab in all the patients with MG, the correlation coefficient is −0.566 (P < 0.01). (E, F) The IL-22 mRNA and anti-AChR Ab also exist negative correlation in the different types of patients with MG,and the correlation coefficient is −0.549(ocular MG, P < 0.05) and −0.583 (generalized MG, P < 0.05) separately.

Correlation between serum IL-17, IL-22 levels and anti-AChR Ab titres

Meantime, a significative correlation between IL-22, IL-17 levels in serum and anti-AChR Ab titres was found. In the 30 patients with MG, IL-17 serum level presents a significantly positive correlation with the expression level of anti-AChR Ab in either all the MG subjects or the different types of patients with MG (Fig. 4A–C); On the contrary, IL-22 serum level presents a significantly negative correlation with the expression level of anti-AChR Ab in all the patients with MG (Fig. 4D). Moreover, the IL-22 serum level and anti-AChR Ab also exist negative correlation in the different types of patients with MG (Fig. 4E, F).

Figure 4.

Correlation between serum IL-17 and anti-AChR Ab titres (A, B, C), serum IL22 and anti-AChR Ab titres (D, E, F), serum IL-17 level presents an positive correlation with the expression level of anti-AChR-IgG in either all the myasthenia gravis (MG) subjects or the different types of patients with MG, the correlation coefficient is 0.538 (Fig. 4A, P < 0.01), 0.510 (Fig. 4B, ocular MG, P < 0.05) and 0.589 (Fig. 4C, generalized MG,< 0.05) respectively. Serum IL-22 level presents a significantly negative correlation with the expression level of anti-AChR Ab in all the patients with MG, the correlation coefficient is −0.572 (Fig. 4D, P < 0.001) Moreover, the IL-22 serum level and anti-AChR Ab also exist negative correlation in the different types of patients with MG, and the correlation coefficient is −0.582 (Fig. 4E, ocular MG P < 0.05) and −0.629 (Fig. 4F, generalized MG P < 0.05) respectively.

Correlation analysis between IL-17 and IL-22 level in patients with MG

A significantly negative correlation between IL-22 and IL-17 levels in either PBMCs or serum of MG subjects was found. In all of the 30 patients with MG, IL-17 mRNA level presents a significantly negative correlation with the expression level of IL-22 mRNA in either all the MG subjects or the different types of patients with MG (Fig. 5A–C); Similarly, the expression level of IL-17 in the serum of patients with MG presents a significantly negative correlation with the expression level of IL-22, as well as in the different types of patients with MG (Fig. 5D–F).

Figure 5.

Correlation between IL-17 and IL-22 expression either in PBMCs or in the serum of patients with myasthenia gravis (MG). (A, B, C) In the PBMCs, IL-17 mRNA presents a significantly negative correlation with the expression level of IL-22 mRNA in either all the MG subjects or the different types of patients with MG, the correlation coefficient is −0.884 (P < 0.001), −0.668 (ocular MG, P = 0.002) and −0.613 (generalized MG, P < 0.05) respectively; (D, E, F) In the serum, IL-17 level also exists a significantly negative correlation with the expression level of IL-22 in all the patients with MG, as well as in the different types of patients with MG, the correlation coefficient is −0.805 (P < 0.001), −0.499 (ocular MG, P < 0.05) and −0.720 (generalized MG, P < 0.01) separately.

Downregulated expression of IL-17 in PBMC by stimulation with rhIL-22

We investigated the effect of different concentrations of rhIL-22 on IL-17 production from MG and control PBMC. After stimulation of PBMC with rhIL-22, the IL-17 expression in culture supernatant was determined by ELISA. As shown in Figure 6A,when PBMC from patients with MG were treated with rhIL-22, the levels of IL-17 decreased in a dose-dependent manner. A significant decrease of IL-17 in patient with MG was detected in 1 ng/ml rhIL-22 treatment group. When PBMC from healthy controls were treated with rhIL-22, modest decrease of IL-17 in culture supernatant was observed in 10 ng/ml rhIL-22 treatment group. Cytotoxic effects on PBMC by rhIL-22 at experimental concentrations were not observed (Fig. 6C, D).

Figure 6.

Effect of recombinant human IL-22 (rhIL-22) on interleukin (IL)-17 release by anti-CD3 and anti-CD28-stimulated PBMC from patients with generalized myasthenia gravis and healthy controls. PBMC were cultured at a concentration of 2 × 105 cells per well with medium, anti-CD3, anti-CD28 and rhIL-22 under the conditions described in the Materials and methods section. After 96 h of treatment, IL-17 expression in culture supernatant was measured by ELISA (A, B). Cell viability was assessed by the trypan blue dye exclusion method and expressed as a percentage with the formula 100 × (number of viable cells/number of both viable and dead cells (C, D). (*< 0.05,**P < 0.01, ***P < 0.001).

Discussion

In our study, we found that the expression of IL-17 mRNA in PBMC and serum IL-17 levels was higher in patients with MG than in controls, with the results consistent with previous study [8]. We also found that IL-17 mRNA and protein level in patients with generalized MG was higher than that of patients with ocular MG. Moreover, we analysed the relationships of IL-17 and anti-AChR Ab levels. We have arrived at the conclusion that IL-17 expression was positively correlated with anti-AChR Ab titres. Integrated above all the evidence, we can conclude an important role for IL-17 in the pathogenesis of patients with MG.

About IL-22, on the one hand, our results showed that IL-22 mRNA in PBMC and IL-22 levels in serum were significantly decreased in patients with MG compared with normal controls; on the other hand, significant difference was also found between ocular MG and generalized MG. Moreover, correlation analysis between IL-22 mRNA levels and anti-AChR Ab titres showed negative association. The decreased serum IL-22 level in MG indicated that IL-22 might be protective for MG.

Unregulated T-cell responses or overwhelming cytokines secreted by T cells and other cell sources are associated with many autoimmune diseases such as SLE, RA, MS, SS and psoriasis. IL-22 and other Th17 cytokines have been most commonly described as a pro-inflammatory cytokine due to its expression in lesions of patients with chronic inflammatory diseases and its induction of pro-inflammatory cytokines such as IL-6, IL-8 and TNF [32]. However, other data suggest that IL-22 has a less direct inflammatory role and instead induces expression of genes associated with antimicrobial defence and cellular differentiation [26]. Moreover, a protective role of IL-22 has been described in inflammatory bowel disease [33, 34], experimental hepatitis [32] and experimental autoimmune myocarditis [35]. These discrepancies may be explained by the dual role of IL-22 in inflammation, for example, IL-22 plays a pro-inflammatory role in the onset of ovalbumin-induced model of allergic asthma in mice; in contrast, IL-22 plays a regulatory role in established asthma and participates to the resolution of inflammation [36]. In addition, the role of IL-22 in inflammation differs depending on the specific tissue [34]. IL-22 contributes to the regulation of hepatitis [37], whereas dermal inflammation is mediated by this cytokine [26]. Studies found that serum IL-22 is upregulated in several autoimmune diseases such as RA [17], MS [22], SS [24] and psoriasis [25], but decreased serum and plasma IL-22 levels were observed in SLE patients by Pan et al. and Cheng et al., respectively [10, 11].The reason for this phenomenon is not known. Ziesche et al. [12] have previously demonstrated that glucocorticoid dexamethasone (DEX) can suppress IL-22 production of plasma and PBMCs in the context of acute bacterial infections, this result may partially explain the decreased levels of serum IL-22 in SLE patients. However, McKinley et al. [9] reported that IL-22 production was not sensitive to DEX treatment at any doses tested. Our study found that plasma IL-22 level was downregulated in patients with MG. However, our patients had received no DEX within the past 3 months, which suggesting that downregulated IL-22 in patients with MG have little relation to DEX. AS far as we know, both SLE and MG are antibody-mediated autoimmune diseases, they might share similar underlying mechanism required for disease progression. Therefore, further studies are needed to explore the potential mechanisms of IL-22 in MG and other autoimmune diseases.

Previous studies had already shown a cross-talk between IL-17A and IL-22 production [38, 39]. Sonnenberg and co-workers [40] showed in vitro that IL-17A could suppress IL-22 expression from Th17 cells in a dose-dependent manner. In vivo, they found an increase of IL-22 in the lung of mice deficient in IL-17A after bleomycin injury. Ke et al. [41] showed that IL-22 treatment in experimental autoimmune uveitis changed the function of Ag-primed CD11b+ APCs, which then bestowed autoreactive pathogenic Th17 cells with regulatory activities. Similarly, Besnard et al. [36] showed that IL-17A production is abolished in the lung by exogenous IL-22 treatment during antigen challenge, which protects mice from lung inflammation. Collectively, these observations suggest a reciprocal regulation of IL-17A and IL-22. However, the underlying molecular mechanisms are unknown. In our study, we found a negative correlation between IL-17 and IL-22 expression in patients with MG, suggesting that this two cytokines play opposite role in this disease. Moreover, in agreement with previous studies [36, 41], we found that IL-17 production by activated MG PBMC is inhibited in the presence of rhIL-22, but IL-17 production produced by controls' PBMC had a slight decline in the presence of high-dose rhIL-22. This result suggested that PBMC cells from patient with MG are more sensitive to rhIL-22 treatment in comparison with PBMC cells from healthy control.

In summary, the decreased serum IL-22 level and IL-22 mRNA in PBMC from persons suffering of MG indicated that IL-22 might be protective for MG. Given that IL-22 is a potent anti-inflammatory cytokine in MG, an important question is whether IL-22 can be a therapeutic target. In MG, a variety of cytokines, including IFN-γ, IL-1 and IL-17, are thought to play a pathogenic role. The relative contribution of these inflammatory cytokines to MG can differ. In this context, the possibility that supplementing IL-22 impedes the progression of MG should be explored in animal models of MG. For example, development of recombinant IL-22 engineered to last long in vivo, discovery of small chemical compounds that mimic IL-22 signalling for immunosuppression will contribute to the development of novel therapeutic approaches to manage MG. Further studies are necessary to establish the pathophysiologic role of IL-22 in MG. As the decreased IL-22 mRNA levels were found in patients with generalized MG with respect to those with ocular MG, IL-22 could be considered a potential marker of the severity of disease. Moreover, we did found association of IL-22 mRNA levels with anti-AChR Ab, this is a noteworthy finding, although this may be explained by the small sample size of this study. Therefore, prospective cohort studies with large sample size are needed.

Acknowledgment

We would like to thank all patients and normal control persons for their collaboration. This work was supported by National Nature Science Foundation of China (81072465), Natural Science Fund of the Educational Committee of Jiangsu Province (10KJD320003), Special foundation of president of the Xuzhou Medical College (2010KJZ01), Key medical talents fund of Jiangsu Province (H201130), Jiangsu Province ordinary university postgraduate research innovation fund (CXLX11_0734).

Disclosures

The authors have no financial conflict of interest.

Ancillary