SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References

Vitamin D, an immunomodulator of macrophage function, can activate human antimycobacterial activity. Vitamin D deficiency (VDD) is associated with an impaired mycobacterial immunity and susceptibility to tuberculosis. It has been found that vitamin D and its receptor may be essential for immune function. In this study, we examined the serum 25(OH) vitamin D levels and its receptor (VDR) polymorphisms with susceptibility to tuberculosis in patients, household contacts and healthy controls. Serum 25(OH) vitamin D levels were measured in 75 cases (25 patients, 25 household contacts and 25 healthy controls), and polymorphisms (BsmI and FokI) were carried out in 335 cases (110 patients, 110 household contacts and 115 healthy controls). The proportion of serum 25(OH) vitamin D deficiency and insufficiency was high in patients (44, 58%) and household contacts (40, 48%) compared to controls (48%). The BB and Bb genotypes of BsmI were significantly associated in patients (P < 0.014; OR: 0.509; CI: 0.265–0.876) (P < 0.001; OR: 2.351; CI: 1.368–4.041) and household contacts (P < 0.04; OR: 0.575; CI: 0.336–0.985); (P < 0.002; OR: −2.267; CI: 1.32–3.895) when compared to healthy controls. The diplotype and MDR analysis showed the high-risk genotypes of BsmI and FokI polymorphisms. Vitamin D deficiency and its association with VDR gene polymorphisms may be useful to identify the high-risk group individuals.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References

Tuberculosis (TB) is a disease caused by Mycobacterium tuberculosis (Mtb) and is one of the leading causes of morbidity and mortality [1]. One-third of world's population is infected with TB, while 10% of those infected develop the disease and 1.2–1.5 million deaths occur every year [2]. According to WHO, most of the TB deaths in the developing world are affecting young adults in their productive years [3]. A high rate of transmission was reported within households of smear-positive TB patients [4]. The household contacts of a patient with TB are at high risk of becoming infected and developing tuberculosis particularly if their immune defences are impaired [5]. In a study reported by Lutong et al. in 2000, prevalence of tuberculosis infection among household contacts was found to be 41–49% [6, 7]. Identification of such high-risk individuals in recently exposed or infected is of great importance for controlling the disease, thereby reducing the burden to the community [8]. Household contacts can be viewed as equilibrium between the host and the bacillus, which results in the formation of a granulomatous lesion that restrains the infection and prevents active disease. In addition to bacterial infection, environmental factors, lifestyle and host genetic risk factors also contribute to the disease [9-11].

Vitamin D (VitD) modulates monocyte and macrophage activity in the body and plays a role in human innate immunity to certain infectious agents, including M. tuberculosis [12]. Vitamin D exerts its actions through vitamin D receptor (VDR), a nuclear hormone receptor. Polymorphisms in the VDR gene may influence VDR activity and subsequent downstream vitamin D-mediated effect [13]. The low serum vitamin D levels were found to be associated with TB in Indonesian, Indian, Kenya populations, etc. [14-16], which have shown that vitamin D deficiency (VDD) is one of the important factors in the susceptibility to TB. The VDR polymorphisms located in coding region and 3′ untranslated region are FokI, TaqI, ApaI and BsmI. Studies from Guajarati Asians and Iranian population have found that the f/f genotype for FokI and Bb genotype for BsmI were more frequent in patients with TB [17, 18]. VDD and VDR polymorphism play an important role in association with TB in different ethnic groups. Therefore, the present study is aimed to determine the serum 25[OH] vitamin D levels and the VDR polymorphisms susceptible to tuberculosis in active pulmonary tuberculosis patients, household contacts and healthy controls.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References
Subjects

The study was conducted at free chest clinic, PPM-DOTS, Mahavir Hospital and Research Centre between years 2009 and 2012. A total of 335 cases were studied, which includes 110 active pulmonary-positive tuberculosis patients (APTB) between the age group of 15–25 years, 110 household contacts (HHC) and 115 age-matched healthy controls (HC). The HHC were either parents or siblings and were asymptomatic. The subjects included in the study were of same ethnic group. All patients had positive acid fast bacilli (AFB) smear microscopy. The bacterial sputum gradation was based on the number of acid fast bacilli (AFB) observed on the slide under microscope as per the Revised National Tuberculosis Control Program (RNTCP) guidelines.

Tuberculin skin test (TST) positivity was assessed in both patients and household contacts by administering five tuberculin units intradermally. An induration of ≥10 mm within 48–72 h was considered positive (TST+). In healthy controls, TST was not performed. Body mass index (BMI) was calculated in all the subjects. The study was approved by institutional ethical committee, and informed consent was obtained from all the subjects included in the study. Human immunodeficiency virus (HIV), renal transplant, diabetic, hypertensive, malignant and cardiac patients were excluded from the study.

Sampling

5 ml of blood was drawn from each subject, and serum was separated and stored in EDTA tubes. Serum was used for the VitD level estimation, and DNA was isolated and stored at −20°C for further analysis.

Methodology

Elisa: Total circulating serum 25[OH] vitamin D was measured with ELISA by using the IDS 25-hydroxyvitamin D EIA kit (Demeditec diagnostics, Kiel, Germany). The protocol was followed according to the manufacturer's instructions. Each test was run in duplicate, with mean absorbance computed from the average for two wells normalized to a zero calibrator well. The absorbance was read at a dual wavelength of 570- and 650-nm reference filter. Levels of vitamin D were expressed as nm, and all R2 values were >95%. The normal ranges followed were sufficiency (VDS), 75–250; insufficiency (VDI), 25–75; and deficiency (VDD), <25 nm.

DNA Isolation: Genomic DNA was extracted using the Qiagen kit (Flexi gene DNA isolation kit, Qiagen, Hilden, Germany). DNA was estimated using Nano drop in ng/μl.

VDR polymorphism: VDR gene polymorphisms were studied using PCR and RFLP. For FokI polymorphisms, the following primers were used to amplify a 267-bp product from the region flanking exon 2 of VDR gene: 5′ ATGGAAACACCTTGCTTCTTCT 3′ and 5′ AGCTGGCCCTGGCACTGACTCT 3′. For BsmI polymorphisms, the following primers were used to amplify a 358-bp product: 5′ GGGAGACGTAGCAAAAGG 3′ and 5 ‘AGAGGTCAAGGGTCACTG 3′. Cycling conditions for all reactions involved 30 cycles of denaturation at 94 °C for 1 min, annealing at 60 °C for 1 min and extension at 72 °C for 1 min.

PCR-RFLP of VDR: PCR products were digested in an excess of restriction enzyme for 3 h at 65 °C with BsmI and at 37 °C with FokI. The presence of a restriction site was assigned a lowercase letter, and its absence an uppercase letter. PCR products were run on 1.5% gel stained with ethidium bromide, and the bands were visualized under UV light (Figs. 1 and 2).

image

Figure 1. Gel picture showing RFLP-PCR BsmI-digested products of VDR polymorphisms. Lanes 1, 3, 5, 67, 10, 12, 13 – BB genotype; Lanes 2, 4 – Bb genotype; Lane 11 – bb genotype. Lane 9 – 50-bp ladder.

Download figure to PowerPoint

image

Figure 2. Gel picture showing RFLP-PCR FokI-digested products of VDR polymorphisms. Lane 1 – FF genotype; Lanes 2, 4, 5 – Ff genotype; Lanes 3, 6 – ff genotype. Lane 7 – 50-bp ladder.

Download figure to PowerPoint

Statistical analysis

Statistical analysis was performed using unpaired t-test to evaluate the association of 25[OH] vitamin D levels and to assess the differences in means between the groups. The distribution of VDR polymorphisms between patients with TB, HHC and HC was compared by Open Epi: Open Source Epidemiologic Statistics for Public Health (version 2.2.1, Emory University & Rollins School of Public Health, GA, USA). Chi-square was used for comparing genotype frequencies. A 2*3, 2*2 cross-tabulation method was used to determine the odds ratio (OR) with 95% confidence interval. Hardy–Weinberg disequilibrium was analysed using SNP stats online software (Institut CatalÁ d'Oncologia). mdr (multifactor dimensionality reduction) analysis was also carried out to assess the interaction between SNPs using mdr software. A two-tailed P < 0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References

The study included 110 APTB (42 males and 68 females), 110 HHC (54 males and 56 females) and 115 HC (85 males and 30 females). There was no significant difference in age between APTB, HHC and HC. The BMI was significantly low in APTB and HHC compared to HC at (P < 0.000 and P < 0.000). In APTB, 86% of males and females were tuberculin skin test positive, whereas in HHC 46% of males and 34% of females were TST positive, but in the HC the TST was not performed. There was no significant difference in APTB and HHC for TST positivity (Table 1).

Table 1. Demographic features of APTB, HHC and HC
Demographic featuresAPTB (N = 110)HHC (110)HC (N = 115)P-value
MaleFemaleMaleFemaleMaleFemaleAPTB versus HCHHC versus HC
  1. APTB, active pulmonary tuberculosis patients; HHC, household contacts; HC, healthy controls; BMI, body mass index; TST, tuberculin skin test; NS, not significant.

  2. P < 0.05 statistically significant.

  3. a

    Chi-square analysis.

  4. b

    t- test.

Sex N (%)42 (38%)68 (62%)54 (49%)56 (51%)85 (77%)30 (23%)<0.000a<0.000a
Age (Mean ± SD)25 ± 4.2722 ± 7.8521 ± 8.7222.5 ± 3.9121.57 ± 2.5622.52 ± 4.35NSNS
BMI (Mean ± SD)16.1 ± 2.5916.2 ± 2.5921.2 ± 4.3120.63 ± 3.8423.14 ± 4.5720.68 ± 4.120.001b0.001b
TST +ve N (%)22 (86%)21 (86%)17 (67%)15 (61%)NSNS
TST −ve N (%)3 (14%)4 (14%)8 (33%)10 (39%)NSNS

Vitamin D levels

A total of 75 subjects (25 APTB, 25 HHC and 25 HC) were studied for the analysis of 25[OH] vitamin D levels. Vitamin D deficiency was observed in 44% of APTB and 40% of HHC, and there was no deficiency observed in the HC. 48% of APTB, 52% HHC and 48% HC had insufficient levels; 8% of APTB, 8% of HHC and 52% of HC had sufficient levels of 25[OH] vitamin D (Table 2). The total mean 25[OH] vitamin D levels were found to be significant in APTB and HHC (P < 0.002, P < 0.007) compared to controls (Fig. 3).

Table 2. Vitamin D levels estimation in APTB, HHC and HC
 APTBHHCHCP-value
N = 25(%)N = 25(%)N = 25(%)APTB versus HCHHC versus HC
  1. APTB, active pulmonary tuberculosis patients; HHC, household contacts; HC, healthy controls; NS, not significant.

Sufficient (75–250 nm)2 (8%)2 (8%)13 (52%)NSNS
Insufficient (25–74 nm)12 (48%)13 (52%)12 (48%)NSNS
Deficient (<25 nm)11 (44%)10 (40%)NilNSNS
image

Figure 3. Serum Vitamin-D levels in APTB, HHC and HC. APTB – active pulmonary tuberculosis patients; HHC – household contacts; HC – healthy controls. *P < 0.05 considered significant.

Download figure to PowerPoint

The result of anova suggests that there was a significant difference at P < 0.05 in the vitamin D levels between the subjects (F2,66 = 14.899, P = 0.000). Post hoc comparisons using the Tukey HSD and Bonferroni test indicated that there was a significant difference in mean vitamin D levels between APTB, HHC and HC.

When multiple regression analysis was performed with VitD and other variables, there was a significant relationship between vitamin D levels and BMI in patients and contacts (R2: 28 and 25%; P < 0.007 and P < 0.05), whereas age and sex showed no significance. However, in controls, there was no significant relationship with any of the variables.

Genotype & Allele distribution of VDR polymorphism

The genotype and allele distributions of BsmI and FokI polymorphisms were carried out in a total of 335 subjects (110 APTB, 110 HHC and 115 HC). A 2*3 chi-square analysis for genotypes and 2*2 chi-square analysis for alleles were performed.

Association of BsmI polymorphism

The frequency of Bb genotype of BsmI polymorphism was high in APTB (53%) and HHC (52%) compared to HC (32%), whereas in HC the frequency of BB genotype is high (48%). A significant difference was noticed in the BB and Bb genotypes in APTB (P < 0.014 and P < 0.001) and HHC (P < 0.04 and P < 0.002) when compared to HC group. The frequency of bb genotype is also high in HC compared to APTB and HHC. The frequency of B allele (58, 60 and 64%) was high in the three groups compared to b allele (42, 40 and 36%), and there was no significance in alleles between APTB, HHC and HC (Table 3). The distribution of all genotypes in the healthy controls followed Hardy–Weinberg equilibrium (> 0.05).

Table 3. Genotype distribution of BsmI polymorphism of APTB, HHC and HC
APTB versus HC
BsmIAPTB n = 110 (%)HC n = 115 (%)ORCIP-value
Genotypes
BB35 (31.82)55 (47.83)0.5090.295–0.8760.014a
Bb58 (52.73)37 (32.17)2.3511.368–4.0410.001a
bb17 (15.45)23 (20.00)0.7310.366–1.4580.38
Alleles
B128 (58.18)147 (63.91)0.7850.537–1.1480.21
b92 (41.82)83 (36.09)1.2730.870–1.8610.21
HHC versus HC
BsmIHHC n = 110 (%)HC n = 115%ORCIP-value
  1. APTB, active pulmonary tuberculosis patients; HHC, household contacts; HC, healthy controls; OR, odds ratio; CI, confidence interval.

  2. Values are represented as number and percentage.

  3. a

    P < 0.05 considered significant.

Genotypes
BB38 (34.54)55 (47.83)0.5750.336–0.9850.044a
Bb57 (51.81)37 (32.17)2.2671.32–3.8950.002a
bb15 (13.63)23 (20.00)0.66360.310–1.2860.21
Alleles
B133 (60.45)147 (63.91)0.8630.589–1.2640.45
b87 (39.54)83 (36.09)1.1590.791–1.6960.45

Association of FokI polymorphism

The frequency of FF genotype was high in APTB, HHC and HC (46, 50 and 54%) compared to the other genotypes (Ff: 42, 40, 36%; ff: 12, 10, 30%). The genotype frequencies between the study groups were similar, and there was no significant difference in any of the genotypes of APTB, HHC and HC. The frequency of F allele (67, 70 and 73%) was higher in the three groups compared to f (33, 27 and 30%), and no significant differences were observed between FokI alleles (Table 4). The distribution of all genotypes of FokI in the APTB and HHC followed Hardy–Weinberg equilibrium (> 0.05).

Table 4. Genotype distribution of FokI polymorphism of APTB, HHC and HC
APTB versus HC
FokIAPTB n = 110 (%)HC n = 115 (%)ORCIP-value
Genotypes
FF51 (46.36)63 (54.78)0.7130.42–1.200.21
Ff46 (41.82)41 (35.65)1.2970.757–2.2210.34
ff13 (11.82)11 (9.57)1.2670.542–2.9620.59
Alleles
F148 (67.27)167 (72.61)0.7750.517–1.1620.219
f72 (32.73)63 (27.39)1.290.860–1.9320.219
HHC versus HC
FokIHHC n = 110 (%)HC n = 115 (%)ORCIP-value
  1. APTB, active pulmonary tuberculosis patients; HHC, household contacts; HC, healthy controls; OR, odds ratio CI, class intervals.

  2. Values are represented as number and percentage.

  3. P < 0.05 considered significant.

Genotypes
FF55 (50)63 (54.78)0.8250.488–1.3940.46
Ff44 (40)41 (35.65)1.2030.701–2.0640.5
ff11 (10)11 (9.57)1.0510.435–2.5320.91
Alleles
F154 (70)167 (72.61)0.880.58–1.3250.54
f66 (30)63 (27.39)1.1360.754–1.710.54

Haplotype & Diplotype analysis

For two VDR polymorphisms, four haplotypes (fB, fb, FB and Fb) and nine diplotypes were identified. The frequency of FB haplotype was high in APTB compared to other groups, but no statistically significant difference was noted (data not shown). The diplotype analysis showed that the frequency of FfBb diplotype was high in APTB (22.73%) and HHC (24.55%) than in HC (11%) with a significant association at P < 0.01 and P < 0.02 (Table 5).

Table 5. Diplotype analysis of BsmI and FokI polymorphism of APTB, HHC and HC
DiplotypesAPTB (%)HHC (%)HC (%)P-value
APTB versus HHCHHC versus HC
  1. APTB, active pulmonary tuberculosis patients; HHC, household contacts; HC, healthy controls.

  2. Values are represented as number and percentage.

  3. a

    P < 0.05 considered significant.

FFBB18 (16.36)21 (19.09)25 (21.74)NSNS
FFBb25 (22.73)25 (22.73)21 (18.26)NSNS
FFbb8 (7.27)10 (9.09)16 (13.91)NSNS
ffBB3 (2.73)5 (4.55)7 (6.09)NSNS
ffBb9 (8.18)6 (5.45)3 (2.61)NSNS
Ffbb1 (0.91)0 (0.00)1 (0.87)NSNS
FfBB14 (12.73)12 (10.91)22 (19.13)NSNS
FfBb25 (22.73)27 (24.55)13 (11.30)0.01a0.02a
Ffbb7 (6.36)4 (3.64)7 (6.09)NSNS

Interaction between BsmI and FokI genes (MDR analysis)

Multifactor dimensionality reduction analysis of the interaction between BsmI and FokI polymorphisms has shown a significant difference indicating high-risk and low-risk group individuals based on genotypes. In APTB versus HC, the BB and bb genotypes in combination with all the three genotypes of FokI (FF, Ff and ff) are under high risk, and in HHC versus HC, the BB genotypes with the three FokI genotypes and FFbb genotype are under high-risk group (Fig. 4).

image

Figure 4. Interaction between BsmI and FokI genotypes in pulmonary tuberculosis patients, household contacts and healthy controls. (A) APTB versus HC, (B) HHC versus HC. Horizontal row 0-BB, 1-Bb, 2-BB; vertical – 0-FF, 1-Ff, 2-ff. Bars represent hypothetical combination of cases (left) and controls (right); dark-shaded cells represent high-risk combination, while light-shaded cells represent low-risk combination.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References

Vitamin D is known to have numerous functions in response to infection, involving the innate and acquired immune systems. All of these functions are involved in the antimicrobial response to TB. Vitamin D insufficiency/deficiency is a worldwide, public health problem in both developed and developing countries [19].

Since the early 19th century, both environmental and dietary sources of VitD have been identified as treatment for TB until the advent of modern chemotherapy [20].

A recent research has indicated that the immune response gets triggered with insufficient levels of VitD and immune response gets activated when adequate amount of VitD was added. IFN-γ, which plays a central role in providing immune response against the TB bacteria, also requires sufficient levels of VitD to be effective [21].

Several studies have indicated the role of VitD in the prevalence of Mtb infection and predicting disease development in high-risk populations. In our study, we propose that the disease development may be partly explained based on the ethnicity, environmental factors, overcrowding, malnutrition, demographic features, VitD levels and their association.

The population of our study is from low socio-economic status and is malnourished. This may be one of the reasons for low BMI and insufficient 25[OH] vitamin D levels in APTB and HHC. The insufficient levels in some of the HCs may be due to age and nutritional values. The serum vitamin D levels are also dependent on the nutritional status and even exposure to the sunlight, which is also one of the reasons of deficiency or insufficiency in our subjects.

A study by Mario Fabri suggests that increasing VitD levels through supplementation may improve the immune response to TB. It has been noted that most of them with TB are asymptomatic, perhaps due to successful immunological control and sufficient VitD to keep the infection from developing into active disease, and stated that VitD may help in both innate and adaptive immunity [21].

In our study though, the HHC are asymptomatic and showed VDD similar to the patients, which might indicate the latent TB infection, and they may be prone to develop the disease.

Similar to our study, several studies in Indians, Pakistani, Gujarati Indian [17] and African residents in London [22] and African immigrants living in Australia [23] reported lower levels of 25(OH) D and higher prevalence of VitD deficiency compared with non-TB individuals. A study from Spain indicated that a high proportion of contacts of patients with TB had low serum 25(OH) D levels and suggested that sufficient 25(OH) D levels protect against TST conversion [24]. In the present study, we observed a 2.3-fold risk of developing disease in the household contacts. A similar observation was also reported in Pakistan study indicating risk in contacts [25]; contrary to our study, no significant difference was observed in 25(OH) D levels between patients with TB and controls in Indonesia [14] and Hong Kong population [26].

Vitamin D receptor (VDR) gene variants have a wide role in innate immunity and TB [10, 17, 27-29]. The molecular and functional consequences of the VDR polymorphisms are crucial to fully appreciate their significance and to understand their potential clinical implications. The BB and Bb genotypes of BsmI polymorphism showed a significant association in APTB and HHC. These results indicate that BsmI polymorphism may be a contributing factor towards the disease.

Selveraj et al. [30] reported a significant increase in Bb genotype of BsmI polymorphism of VDR gene in patients with PTB and contacts, which was similar to our study. A study from Istanbul showed a decreased frequency of BsmI B/B genotype and increased frequency of b/b genotype in healthy subjects compared to patients [31]. The Iranian study also showed the association of BsmI polymorphisms (Bb + bb) with tuberculosis.

The FokI genotypes behaved similar in APTB, HHC and HC in our study; a similar study was reported by Roth et al. [32] in Peruvian population which shows no difference in the genotypes between patients and controls. Similar to our study, the frequency of FF genotype of VDR FokI was higher than its corresponding mutant in patients and controls in Iranian study. In native Paraguayans, there was an association of FokI gene with TB [33], which was contrary to our study.

Several studies investigating the variations in VDR gene related to susceptibility to TB showed controversial results. Bornman et al. [28] from the Gambia, Guinea and Guinea-Bissau showed no significant association of these genes with TB in a case–control study, whereas Bellamy et al. [34] showed the association between TB and VDR gene polymorphism.

The results based on diplotype and MDR analysis indicate that the genotypes of BsmI and FokI in combination are involved in association with tuberculosis. The MDR analysis showed that majority of the genotype expression of both the polymorphisms indicates significantly high-risk groups.

Our findings are broadly in consistent with those of most previous studies indicating the positive or negative association with TB. To best of our knowledge, this is the first report on MDR analysis showing VitD levels and their receptor polymorphisms in household contacts. In conclusion, we demonstrate that there is a need to evaluate the status of vitamin D and identification of disease/biomarkers in large sample size to understand the association for disease pathogenesis in high-risk group.

Acknowledgment

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References

We thank staff of the free chest clinic, Mahavir PPMDOTS, Tuberculosis Unit (T.U.), Bhagwan Mahavir Trust. Financial support was provided by DBT-RGYI (Sanction no: 102/IFD/PR/2029/2007-2008 dated 18/01/2008) and COE (Sanction No: BT/01/COE/07/02, dated 30/12/08).

Conflict of interest

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References

None of the authors of this paper have any conflict of interests.

Authorship

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References

Late Dr. K.J.R Murthy involved in the conception of the study. GSL and VVL designed the study. LJ and MP analysed and interpreted the data. GSL, VVL and PN critically revised the manuscript for important intellectual content. GSL involved in final approval of the version to be submitted.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. Authorship
  10. References
  • 1
    Rahman S, Gudetta B, Fink J et al. Compartmentalization of immune responses in human tuberculosis: few CD8+ effector T cells but elevated levels of FoxP3+ regulatory t cells in the granulomatous lesions. Am J Pathol 2009;174:221124.
  • 2
    World Health Organization. The World Health Report 2011—Hanging History. Geneva: World Health Organization, 2011.
  • 3
    World Health Organization. The World Health Report 2011/2012—Tuberculosis Global Facts. World Health Organization, 2011/2012.
  • 4
    Beyer N, Gie RP, Schaaf HS et al. A prospective evaluation of children under the age of 5 years living in the same household as adults with recently diagnosed pulmonary tuberculosis. Int J Tuberc Lung Dis 1997;1:3843.
  • 5
    Zellweger JP. Tuberculosis in households of index patients: is there another way to control tuberculosis. Int J Tuberc Lung Dis 2002;6:1812.
  • 6
    Lutong L, Bei Z. Association of prevalence of tuberculin reactions with closeness of contact among household contacts of new smear-positive pulmonary tuberculosis patients. Int J Tuberc Lung Dis 2000;4:275.
  • 7
    Marks SM, Taylor Z, Qualls NL, Shrestha-Kuwahara RJ, Wilcema MA, Nguyen CH. Outcomes of contact investigations of infectious tuberculosis patients. Am J Respir Crit Care Med 2000;162:20338.
  • 8
    Ansari A, Talat N, Jamil B et al. Cytokine gene polymorphisms across tuberculosis clinical spectrum in Pakistan patients. PLoS One 2009;4:e4778.
  • 9
    Nava-Aguilera E, Andersson N, Harris E et al. Risk factors associated with recent transmission of tuberculosis: systematic review and meta-analysis. Int J Tuberc Lung Dis 2009;13:1726.
  • 10
    Lewis SJ, Baker I, Davey Smith G. Meta-analysis of vitamin D receptor polymorphisms and pulmonary tuberculosis risk. Int J Tuberc Lung Dis 2005;9:11747.
  • 11
    Yang BF, Han CL. [Meta-analysis of relationship of vitamin D receptor polymorphism and tuberculosis]. China Trop Med 2006;6:13479. [Chinese].
  • 12
    Haussler MR, Whitfield GK, Hausler CA et al. The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res 1998;13:32449.
  • 13
    Valdivielso JM, Fernandez E. Vitamin D receptor polymorphisms and diseases. Clin Chim Acta 2006;371:112.
  • 14
    Grange JM, Davies PD, Brown RC, Woodhead JS, Kardjito T. A study of vitamin D levels in Indonesian patients with untreated pulmonary tuberculosis. Tubercle 1985;66:18791.
  • 15
    Sasidharan PK, Rajeev E, Vijayakumari V. Tuberculosis and vitamin D deficiency. J Assoc Physicians India 2002;50:5548.
  • 16
    Davies PD, Church HA, Brown RC, Woodhead JS. Raised serum calcium in tuberculosis patients in Africa. Eur J Respir Dis 1987;71:3414.
  • 17
    Wilkinson RJ, Llewelyn M, Toossi Z et al. Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in west London: a case–control study. Lancet 2000;355:618.
  • 18
    Varahram M, Farnia P, Anoosheh S et al. The VDR and TNF-α gene polymorphisms in Iranian tuberculosis patients: the study on host susceptibility. Iran J Clin Infect Dis 2009;4:20713.
  • 19
    Gombart AF. The vitamin D–antimicrobial peptide pathway and its role in protection against infection. Future Microbiol 2009;4:1151.
  • 20
    Martineau AR, Wilkinson KA, Newton SM et al. IFN-γ- and TNF-independent vitamin D-inducible human suppression of mycobacteria: the role of cathelicidin LL-37. J Immunol 2007;178:71908.
  • 21
    Fabri M, Stenger S, Shin D-M et al. Vitamin D is required for IFN-γ–mediated antimicrobial activity of human macrophages. Sci Transl Med 2011;3:104ra102.
  • 22
    Ustianowski A, Shaffer R, Collin S, Wilkinson RJ, Davidson RN. Prevalence and associations of vitamin D deficiency in foreign-born persons with tuberculosis in London. J Infect 2005;50:4327.
  • 23
    Gibney KB, MacGregor L, Leder K et al. Vitamin D deficiency is associated with tuberculosis and latent tuberculosis infection in immigrants from sub-Saharan Africa. Clin Infect Dis 2008;46:4436.
  • 24
    Mata-Granados JM, Luque de Castro MD, Quesada-Gomez JM. Inappropriate serum levels of retinol, alpha-tocopherol, 25 hydroxyvitamin D3 and 24,25 dihydroxyvitamin D3 levels in healthy Spanish adults: simultaneous assessment by HPLC. Clin Biochem 2008;41:67680.
  • 25
    Talat N, Perry S, Parsonnet J, Dawood G, Hussddain R. Vitamin D deficiency and tuberculosis progression. Emerg Infect Dis 2010;15:8535.
  • 26
    Chan TY. Differences in vitamin D status and calcium intake: possible explanations for the regional variations in the prevalence of hypercalcemia in tuberculosis. Calcif Tissue Int 1997;60:913.
  • 27
    Selvaraj P, Narayanan PR, Reetha AM. Association of vitamin D receptor genotypes with the susceptibility to pulmonary tuberculosis in female patients and resistance in female contacts. Indian J Med Res 2000;111:1729.
  • 28
    Bornman L, Campbell SJ, Fielding K et al. Vitamin D receptor polymorphisms and susceptibility to tuberculosis in west Africa: a case-control and family study. J Infect Dis 2004;190:163141.
  • 29
    Fitness J, Floyd S, Warndorff DK et al. Large-scale candidate gene study of tuberculosis susceptibility in the Karonga district of northern Malawi. Am J Trop Med Hyg 2004;71:3419.
  • 30
    Selvaraj P, Chandra G, Kurian SM, Reetha AM, Narayanan PR. Association of vitamin D receptor gene variants of BsmI, ApaI and FokI polymorphisms with susceptibility or resistance to pulmonary tuberculosis. Curr Sci 2003;84:15648.
  • 31
    Ates O, Dolek B, Dalyan L, Musellim B, Ongen G, Topal-Sarikaya A. The association between BsmI variant of vitamin D receptor gene and susceptibility to tuberculosis. Mol Biol Rep 2011;38:26336.
  • 32
    Roth DE, Soto G, Arenas F et al. Association between vitamin D receptor gene polymorphisms and response to treatment of pulmonary tuberculosis. J Infect Dis 2004;190:9207.
  • 33
    Wilbura AK, Kubatkob LS, Hurtado AM, Hill KR, Stone AC. Vitamin D receptor gene polymorphisms and susceptibility M. tuberculosis in Native Paraguayans. Tuberculosis (Edinb) 2007;87:32937.
  • 34
    Bellamy R, Ruwende C, Corrah T. Tuberculosis and chronic hepatitis B virus infection in Africans and variation in the vitamin D receptor. J Infect Dis 1999;179:7214.