SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. References

Chronic periodontitis (CP) and atherosclerotic and aortic aneurysmal vascular diseases (VD) are inflammatory conditions that share a number of predisposing factors. They have a complex genetic heritability and may share genetic risk factors, but a well-defined relationship is still not determined. In addition, distinct genetic patterns of predisposition have been associated with these diseases. Here, we investigated the association of polymorphisms in the IL-1 gene locus with CP in a case–case study analysing VD patients with or without CP. Seventy-four patients with VD of whom 36 had CP were genotyped for single nucleotide polymorphisms in the IL1A -889 (rs1800587), IL1B +3954 (rs1143634) and IL1B at −511 (rs16944) genes and for VNTR polymorphisms in the IL1RN gene. A significantly higher frequency (17%) for allele 1 (four repeats) of the IL1RN VNTR gene was found among the VD patients with CP compared to those without CP. In addition, the frequency of the IL1RN VNTR genotypes 1/1 (4/4 repeats) and 2/2 (2/2 repeats) were significantly higher and lower, respectively, in VD patients with CP. These findings suggest an association of genetic polymorphisms in the IL1-gene locus with risk for CP in patients with VD. The carriage of the risk genotypes, the development and the subsequent influence of CP on systemic health may constitute an additional burden in the pathogenesis of VD. This emphasizes the importance of effective periodontal treatment in patients with VD.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. References

Chronic periodontitis (CP) is a multifactorial inflammatory condition initiated by the accumulation of dental plaque. The interaction of this bacterial biofilm with the host immune system induces inflammation and immune responses that cause destruction of connective tissue and alveolar bone around the teeth and eventually tooth loss. Although risk factors such as smoking, diabetes and obesity can alter the severity and the progression of periodontitis, the disease has a complex genetic component [1].

Atherosclerosis is a multifactorial chronic inflammatory disease of the arterial walls that can lead to ischemic complications due to restriction of blood flow and thrombotic occlusion [2]. Abdominal aortic aneurysm is also a chronic inflammatory condition and is characterized by matrix degeneration and weakening and dilatation of the aorta wall [3]. In addition to risk factors such as smoking, hypertension, hypercholesterolemia, obesity and diabetes, genetic factors considerably affect the susceptibility to both diseases [2, 3].

Chronic periodontitis and atherosclerotic and aortic aneurysmal vascular diseases (VD) share a number of predisposing risk factors. However, periodontitis is suggested to be an additional risk factor for VD independent of known confounding factors [4, 5]. In a recent prospective study [6], a longitudinal improvement in periodontal status was correlated with a decreased progression of atherosclerosis. Several possible mechanisms for the link between CP and cardiovascular diseases have been suggested [7], including common genetic susceptibility loci [8, 9], but also specific genetic patterns of predisposition for each of these diseases have been reported [8-12].

As the carriage of CP-risk genotypes with subsequent development of periodontitis can cause an additional burden in the pathogenesis of VD, we aimed at finding distinctive genetic patterns that can identify persons with risk for CP within a group of patients with VD. If the risk to develop CP can be identified by genotype before the development of periodontitis, the patients can be selectively targeted for adequate preventive intervention.

Pro- and anti-inflammatory cytokines are key factors in the pathogenesis of both periodontitis and atherosclerosis. Hence, polymorphisms in the genes coding for cytokines have been investigated to explain genetic susceptibility for these diseases. Here, we have studied the frequencies of polymorphisms in the IL-1 gene cluster in patients with severe vascular diseases, divided in two groups according to periodontal status. Genetic polymorphisms within the IL-1 gene cluster have been found to influence the susceptibility to CP, but the reported results vary [13]. Different ethnical background may explain these variations [13-15]. Hence, the present study was carried out for the first time in a homogenous population from Scandinavian countries (with predominantly Norwegian patients) with vascular disease in the major arteries (abdominal aorta, a. carotis and a. femoralis). Specifically, we investigated polymorphisms in the genes coding for IL-1α (rs1800587), IL-1β (rs1143634 and rs16944) and IL-1Ra cytokines.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. References
Participants

The study included a total of 69 Norwegian, three Swedish and two Danish patients with VD. All participants were questioned about their ethnic origin. Only the participants with Norwegian, Danish or Swedish origin for the past three generations were included. The patients were recruited at the Department of Vascular Surgery, Oslo University Hospital, Aker, Oslo, Norway. They were scheduled for vascular surgery, including abdominal aortic aneurysm repair, carotid or femoral arterial endarterectomy, or percutaneous transluminal angioplasty of the femoral arteries. Clinical oral examinations were performed at the hospital ward to determine the periodontal status of the patient.

The patients were categorized into two groups according to their clinical periodontal status. The first group (VD with CP) were patients undergoing treatment for VD and that were diagnosed with CP (n = 36, mean age = 67.8, standard deviation (SD) = 6.9, range: 51.3–85.0). The second group (VD without CP) were patients undergoing treatment for VD and that were assessed without CP (n = 38, mean age = 71.5, SD = 8.0, range: 55.4–84.8). Demographic data of the study groups are shown in Table 1.

Table 1. Demographic data of the study groups with atherosclerotic and aortic aneurysmal vascular diseases (VD) with (w/) and without (wo/) chronic periodontitis (CP)
 VD w/CPVD wo/CP
n = 36n = 38 
  1. PD = periodontal pocket probing depth.

Age
Mean ± SD67.8 ± 6.971.5 ± 8.0
Median (min–max)67.4 (51.3–85.0)71.5 (55.4–84.8)
Gender (n)
Male3031
Female67
Teeth (n)
Mean ± SD18.7 ± 7.424.8 ± 2.3
Median (min–max)20 (4–28)25 (20–29)
PD (n ≥ 5 mm)
Mean ± SD15.6 ± 10.80.7 ± 0.98
Median (min–max)11 (4–55)0 (0–3)
Diabetes (n)313
Non-smokers (n)110
Current or previously smokers (n)3528
Pack-year Mean ± SD36.7 ± 19.425.1 ± 14.3
Pack-year Median (min–max)34.6 (4.9–88.0)23.8 (3.1–51.3)
Body mass index (kg/m2)
Mean ± SD26.4 ± 4.227.2 ± 4.5
Median (min–max)26.4 (14.2–35.3)26.7 (18.3–37.0)

The patients' medical records were obtained for general health information. Questions on ethnicity and smoking behaviour were self-reported. Written informed consent was obtained from all participants, and the study was approved by the Regional Ethical Committee (REK Sør, NO. 08/322b) and was in accordance with the Helsinki declaration of 1975, as revised in 1983. The study has been registered at ClinicalTrials.gov (ID. NCT01358630).

Inclusion criteria

The patients in both groups were diagnosed and treated according to standard procedures at the Department of Vascular Surgery, Oslo University Hospital, Aker, Norway. Diagnosis of CP was based on the classification system of the American Academy of Periodontology, established in 1999 at the International Workshop for Classification of Periodontal Diseases and Conditions [16]. Clinical periodontal status was assessed by periodontal pocket probing depth (PD) and bleeding on probing (Table 1). The measurements were carried out at the mesial, buccal, distal, lingual or palatinal surfaces of all teeth. Subjects who had at least four sites with PD ≥ 5 mm and bleeding on probing were categorized as having CP. All subjects classified as without CP had ≥20 remaining teeth. No subject had received periodontal treatment within the last 6 months or taken antibiotics within the last month. All periodontal examinations were carried out by a trained dentist (ZA).

Sample collection and DNA extraction

Vascular tissue biopsies and saliva samples were collected for extraction of genomic DNA. The vascular biopsies were collected under surgical treatment from the walls of aneurysms and during excision of intravascular plaques in carotid or common femoral arteries. The biopsies were stored at −80 °C. Saliva samples were collected with the Oragene™ DNA Self-Collection Kit (Genotek, Ottawa, Ontario, Canada) according to the manufacturer's instructions.

Extraction of genomic DNA was carried out by the Masterpure Complete DNA Purification Kit (Epicentre Biotechnologies, Madison, WI, USA), according to the manufacturer's extraction protocol for fluid, whole blood and tissue samples with some modifications.

The saliva samples were incubated in their original container in an air incubator for 3 h to ensure sample homogeneity before DNA extraction. 150 μl of sample was incubated with proteinase K (50 μg) (Epicentre Biotechnologies, Madison, WI, USA) and cell lysis solution. The samples were then treated with RNase A (5 μg) (Epicentre Biotechnologies, Madison, WI), before protein precipitation. Genomic DNA was precipitated with (1:1 v/v) isopropanol (Arcus, Oslo, Norway), pelleted by centrifugation, washed twice with 75% ethanol (Kemetyl, Vestby, Norway), resuspended in 1 × TE-buffer (10 mm Tris, 1 mm EDTA, pH 8.0) and stored at −20 °C.

The tissue samples were mechanically homogenized and the proteinase K (100 μg) was used for cell lysis treatment. After RNase A (5 μg) treatment and protein precipitation, the samples in 0.5 m NaCl were treated with (1:1 volume) phenol–chloroform (VWR International AS, Oslo, Norway) and centrifuged in Phase Lock Gel tubes (5Prime, Gaithersburg, Maryland, USA). The aqueous phase was then treated twice with chloroform/isoamyl alcohol (1:1 v/v) (AppliChem GmbH, Darmstadt, Germany). DNA was precipitated with 100% ethanol (Kemetyl, Vestby, Norway) in 0.3 m sodium acetate (AppliChem GmbH, Darmstadt, Germany). The pellet was washed twice with 75% ethanol, resuspended in 1 × TE- buffer and stored at −20 °C.

Analyses of DNA polymorphisms

The positions of the polymorphisms in the IL-1 gene cluster that were examined are shown in Fig. 1. For SNPs, allele discrimination assays were performed by the real-time PCR amplification method. The alleles of IL1A at −889 (rs1800587), IL1B at +3954 (rs1143634) and IL1B at −511 (rs16944) were detected by 5'nuclease allelic discrimination method using locus-specific forward and reverse primers and two allele-specific oligonucleotide probes for each SNP of interest (synthesized by Biochemistry department, Oslo Research Park, University of Oslo for this purpose) as described previously [17]. The probes for each major allele (listed in Table 2) were labelled with FAM or HEX at the 5'end, and non-fluorescent quencher or ‘black-hole’ quencher at the 3'end. The experiments were performed in the Mx-3005p (Agilent Technologies Inc., Santa Clara, CA, USA) using the TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), along with approximately 20 ng DNA template.

Table 2. Primer and probe sequences used to detect nucleotide polymorphisms in this study
GeneLocationPolymorphismPrimers and probes
  1. SNP, single nucleotide polymorphism; Fw, forward primer; Rv, reverse primer; VNTR, variable number of tandem repeats. Probes are listed with the polymorphic bases in bold.

IL1APromoterSNP −889 C>T (rs1800587)Fw: 5’ CACAGGAATTATAAAAGCTGAGAAATTC 3’
Rv: 5’ GGAGAAAGGAAGGCATGGATT 3’
FAM: 5’ CCAGGCAACACCATTGAAGGCTCATATG 3’
HEX: 5’ CCAGGCAACATCATTGAAGGCTCATAG 3’
IL1BExon 5SNP +3954 C>T (rs1143634)Fw: 5’ GGCCTGCCCTTCTGATTTTATA 3’
Rv: 5’ TCGTGCACATAAGCCTCGTTA 3’
FAM: 5’ TTCAGAACCTATCTTCTTCGACACATGG 3’
HEX: 5’ TTCAGAACCTATCTTCTTTGACACATGG 3’
IL1BPromoterSNP −511 G>A (rs16944)Fw: 5’ TTGAGGGTGTGGGTCTCTACCT 3’
Rv: 5’ TCCTCAGAGGCTCCTGCAA 3’
FAM: 5'TGTTCTCTGCCTCAGGAGCTCTCTGTCA 3’
Hex: 5’ TGCTGTTCTCTGCCTCGGGAGCTC 3’
IL1RNIntron 2VNTR (rs2234663)Fw: 5’ CCCCTCAGCAACACTCCTAT 3’
Rv: 5’ GGTCAGAAGGGCAGAGA 3’
image

Figure 1. The IL-1 gene cluster and the position of the examined polymorphisms. The IL1 gene family consists of nine members positioned on chromosome 2. Examined polymorphisms (dark arrows on the chromosome) and allele designations are indicated. 1M = allele 1 (Major allele), the more frequent allele, m = allele 2 (minor allele), the less frequent allele.

Download figure to PowerPoint

The IL1RN VNTR was amplified by primers listed in Table 2. The PCR products were detected by 1.5% agarose gel electrophoresis stained with ethidium bromide, using a 100 bp DNA ladder (GeneRuler™; Thermo Fisher Scientific, Waltham, MA, USA) as a marker for fragment length. The VNTR PCR detects variability in the repetition of 86 nucleotides within intron 2 of the IL1RN gene. Caucasians have 2 and 4 copies of the repeats in 95% of the cases. The alleles were denoted as follows: allele 1 = 4 repeats, allele 2 = 2 repeats, allele 3 = 5 repeats and allele 4 = 3 repeats [18]. PCR was performed with approximately 50 ng DNA templates, 0.2 μm of each primer, 2 mm MgCl2, 0.33 mm dNTPs and Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR amplification steps included 96 °C for 1 min, followed by 35 cycles of 95 °C for 10 s, annealing at 59 °C for 20 s and elongation at 72 °C for 90 s. Genotyping was successful in all patients. Some of the samples were regenotyped at random, and no differences were observed between the separate runs.

Statistical analyses

The statistical analyses were performed using the SPSS software (IBM SPSS Statistic version19) and JavaStat (http://statpages.org/). Chi-square and Fisher's exact tests were used for univariate comparisons of allelic and genotypic frequencies of the SNP loci between the groups. Binary logistic regression was used to adjust the genotypic differences for the effect of age, gender, BMI, diabetes and smoking status. All cases were included in the logistic regression model. The genotype analysis and the IL1RN allele frequencies were performed by comparing each allele or genotype frequency to the pooled total of the other groups. The assembly and prediction of haplotypes for the IL-1 cluster were carried out by the software ‘Phase’ [19]. All loci were in Hardy–Weinberg equilibrium. A statistically significant difference was defined when P was <0.05.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. References

In Table 3, the allelic and genotypic frequencies of the SNPs IL1A (−899), IL1B (+3954) and IL1B (−511) are listed. None of the allelic and genotypic frequencies were different (chi-square/Fisher's exact tests or logistic regression models; > 0.05), but the allelic frequency for the IL1B +3954 (C>T) polymorphism showed a trend towards statistical significant difference (chi-square; = 0.06), with VD with CP group having a higher frequency of allele 2. This association was, however, not seen in the genotype analysis (chi-square and logistic regression analysis; > 0.05).

Table 3. Allele and genotype frequencies within the IL1A and IL1B gene locus in patients with atherosclerotic and aortic aneurysmal vascular disease (VD) with (w/) or without (wo/) chronic periodontitis (CP)
  Allele frequency
VD w/CPVD wo/CPP (VD w/CP versus VD wo/CP)
n = 72n = 76 
IL1AaSNP −889 (rs1800587)   
1C0.64 (46)c0.72 (55)0.27
2T0.36 (26)0.28 (21)
IL1BaSNP +3954 (rs1143634)   
1C0.65 (47)0.79 (60)0.06
2T0.35 (25)0.21 (16)
IL1BaSNP −511 (rs16944)   
1G0.68 (49)0.62 (47)0.43
2A0.32 (23)0.38 (29)
  Genotype frequency
VD w/CPVD wo/CPP (VD w/CP versus VD wo/CP)P (VD w/CP versus VD wo/CP) (logistic regression model)d
n = 36n = 38
  1. SNP, single nucleotide polymorphism; NS, no significant difference.

  2. a

    Allele designation (1 = more frequent, major allele; 2 = less frequent, minor allele).

  3. b

    Genotype designations.

  4. c

    Number of alleles in parentheses.

  5. d

    In the binary logistic regression model, the genotypic differences was adjusted for the effect of age, gender, body mass index, diabetes and smoking status.

IL1AbSNP −889 (rs1800587)    
1/1C/C0.42 (15)0.50 (19)0.47NS
1/2C/T0.44 (16)0.45 (17)0.98NS
2/2T/T0.14 (5)0.05 (2)0.26NS
IL1BbSNP +3954 (rs1143634)    
1/1C/C0.44 (16)0.61 (23)0.17NS
1/2C/T0.42 (15)0.37 (14)0.67NS
2/2T/T0.14 (5)0.03 (1)0.10
IL1BbSNP −511 (rs16944)    
1/1G/G0.50 (18)0.37 (14)0.25NS
1/2G/A0.36 (13)0.50 (19)0.23NS
2/2A/A0.14 (5)0.13 (5)0.93NS

Table 4 displays allelic and genotypic frequency differences of the IL1RN VNTR polymorphisms. The frequency of the IL1RN allele 1 (four repeats) showed a significant difference (chi-square, = 0.02, OR = 2.28, 95% CI = 1.05–5.01) being higher in the VD with CP group (n = 56) than in the VD without CP group (n = 46), indicating a possible association of the allele 1 (four repeats) with risk for CP among patients with VD. The frequency of the IL1RN allele 2 (two repeats) showed a borderline significant difference (chi-square, = 0.052) comparing the VD with CP group (n = 16) with the VD without CP group (n = 28).

Table 4. Allele and genotype frequencies within the IL1RN gene locus in patients with atherosclerotic and aortic aneurysmal vascular disease (VD) with (w/) or without (wo/) chronic periodontitis (CP)
  Allele frequency
VD w/CPVD wo/CPP (VD w/CP versus VD wo/CP)
n = 72n = 76 
IL1RNaVNTR   
1(4)0.78 (56)c0.61 (46)0.02d
2(2)0.22 (16)0.37 (28)0.052
3(5)0 (0)0.03 (2)0.25
  Genotype frequency
VD w/CPVD wo/CPP (VD w/CP versus VD wo/CP)P (VD w/CP versus VD wo/CP) (logistic regression model)g
n = 36n = 38
  1. VNTR, variable number of tandem repeats; NS, no significant difference.

  2. a

    Allele designations. The copy numbers of the VNTR are shown in brackets.

  3. b

    Genotype designations. The copy numbers of the VNTR are shown in brackets.

  4. c

    Number of alleles in parentheses.

  5. d

    OR = 2.28, 95% CI = 1.05–5.01.

  6. e

    In the binary logistic regression model, the genotypic differences was adjusted for the effect of age, gender, body mass index, diabetes and smoking status.

  7. f

    OR = 3.67, 95% CI = 1.13–11.96.

  8. g

    OR = 0.05, 95% CI = 0.05–0.54.

IL1RNbVNTR    
11(44)0.58 (21)0.37 (14)0.060.03e
12(42)0.39 (14)0.45 (17)0.61NS
22(22)0.03 (1)0.13 (5)0.200.01f
13(45)00.03 (1)1
23(25)00.03 (1)1

The frequency of homozygote genotype 1/1 (4/4) showed a trend towards statistical significant difference being higher in the VD group with CP (n = 21) compared to the VD group without CP (n = 14) (chi-square, = 0.06). After adjustment for the risk factors age, gender, BMI, diabetes and smoking status by logistic regression, this difference was significant (= 0.03, OR = 3.67, 95% CI = 1.13–11.96) suggesting an increased risk for CP among patients VD with the 1/1 genotype.

In the logistic regression analysis, the homozygote genotype 2/2 (2/2) showed a significant lower frequency in the VD group with CP (n = 1) (= 0.01, OR = 0.05 95% CI = 0.05–0.542) compared to the VD group without CP (n = 5).

In a logistic regression model assessing the overall effect of the individual IL1RN VNTR genotypes (including the most frequent genotypes, i.e. >97%; comparing genotypes 2/2 versus 1/1 and 1/2 versus 1/1), the IL1RN VNTR genotype was significantly associated with CP (= 0.02). A significant difference was found comparing the homozygote genotypes 2/2 versus 1/1 (= 0.006, OR = 0.028, 95% CI = 0.002–0.355) with 1/1 genotype being more frequent in VD patients with CP (Table 4).

In the logistic regression analysis, no statistically significant correlations were found between the risk factors like age, gender, BMI, diabetes and smoking status.

To further examine the relationship between the genetic markers and CP among patients with VD, we assembled the IL1 haplotypes using the Phase software and analysed the haplotype differences between the two groups. No statistically significant haplotype frequency differences were found (data not shown).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. References

Chronic periodontitis and VD are chronic inflammatory diseases that share a number of predisposing factors [4]. The diseases may share genetic risk factors, but a well-defined relationship is still not determined [8-12]. Here, for the first time, we tested the hypothesis that known genetic markers for disease susceptibility can independently be related to CP in the presence of atherosclerotic and aneurysmal vascular disease in the major arteries, in a Scandinavian population.

For this purpose, we investigated frequencies of polymorphisms in members of the IL-1 gene cluster in VD patients with and without CP. The gene products IL-1α, IL-1β and IL-1Ra were chosen as previous studies indicate that susceptibility to CP is associated with their polymorphisms [20-22]. The proinflammatory cytokines IL-1α and IL-1β are involved in periodontal tissue remodelling and destruction by mechanisms such as increased production of prostaglandin E2 and matrix metalloproteinase. The IL-1 receptor antagonist IL-1Ra acts as an anti-inflammatory cytokine by binding to cellular interleukin-1 receptors without causing signal transmission and thereby regulates IL-1 activity [23].

Genetic studies on the role of genetic polymorphisms in the development of CP, including those within the IL-1 gene cluster, show varying results [13]. This may be due to gene drift and hence ethnic differences in genotype and allele frequencies. Therefore, a genetic risk factor (for complex disease susceptibility) in one population is not necessarily a risk factor in another population [13]. Consequently, only Scandinavian patients were included in the present study, as Norwegian, Swedish and Danish populations share the same genetic background [14]. The current patient groups consisted of patients with an average age of about 70 years. At this high age, the absence or presence of CP increases the likelihood of correct periodontal phenotyping. In addition, the patients without CP had in average ≥24 remaining teeth and ≤1 periodontal site with PD over 4 mm. None of them reported a history of previous periodontal treatment. In contrast, the patients with CP showed clear signs of periodontal disease measured by PD (mean = 15.6 sites with PD ≥ 5 mm). Those with high numbers of missing teeth showed clear signs of periodontal disease around the remaining teeth.

In this study, VD patients with CP showed a significantly higher frequency of allele 1 and a lower frequency of allele 2 of IL1RN VNTR when compared with VD patients without CP. The influence of allele 1 on protein production and disease susceptibility has not been emphasized in the literature to the same extent as that of allele 2. Most studies find that allele 2 is associated with CP [24]. Yet, our findings agree with the findings of studies where allele 1 of this VNTR was found to be associated with increased risk for CP [25] and with coexistence of coronary heart disease and periodontitis [8]. Allele 1 has also been associated with risk for other inflammatory diseases such as inflammatory myopathies [26] and multiple sclerosis [27]. Each repeat of the IL1RN VNTR contains several transcription binding sites, and it has therefore been suggested that the number of tandem repeats may alter the production of IL-1Ra [18]. Consequently, persons with different genotypes may produce different levels of the protein. Carriage of allele 2 of IL1RN VNTR has indeed been related to higher levels of IL-1Ra production, which in its turn could result in well-regulated (less severe) inflammation [28, 29]. Yet, the mechanism by which IL-1RN VNTR polymorphism can influence the development of CP remains unclarified [24, 30]. Some studies show that carriers of the allele 2 have higher levels of IL-1Ra in gingival crevicular fluid and display less severe periodontitis [31, 32]. However, other studies have shown a lower production of IL-1Ra associated with this minor allele [33, 34].

The IL1B (+3954) T-allele in exon 5 has been found to be associated with higher IL-1β production and greater degree of systemic inflammation [35]. The T-allele for IL1B +3954 (allele 2) showed a trend towards association with increased risk for CP in patients with VD in agreement with other studies that have associated this allele with increased risk for CP [21, 22].

In accordance with several other studies, we did not detect significant allelic or genotypic differences between our groups of patients regarding IL1A -899 and IL1B -511SNPs [13].

The varying results concerning disease susceptibility and phenotypic expression observed in the literature can also be caused by differences in gene–gene interactions that may alter individual response to environmental and epigenetic factors [13, 36]. Differences in functional haplotypes and linkage disequilibrium between racial/ethnic groups might also cause the discrepancies reported in the literature [37, 38]. In addition, miRNAs may be involved in altering disease susceptibility by gene regulation and silencing, and several miRNAs have been shown to be associated with periodontitis and atherosclerosis through their influence on immune responses [39, 40].

There are strong confounding factors in the pathogenesis of both CP and VD such as diabetes and smoking. Therefore, logistic regression analyses were used to adjust the genotypic differences for the effect of age, gender, BMI, diabetes and smoking status. Oral hygiene estimators such as plaque and supragingival calculus accumulation scores were not included as they correlate poorly with periodontitis [41].

Our results show that in persons with VD, genotypes of inflammatory factors within the IL-1 gene cluster are associated with CP. IL-1 cytokine is also involved in the pathogenesis of atherosclerosis and aneurysm formation, and different allelic variants within the IL1 gene cluster have been associated with atherosclerotic diseases [42, 43]. CP and VD may share genetic risk factors but a well-defined relationship is still not determined [8-12]. The present findings suggest that these gene variants still, however, can have a stronger association with CP than VD.

The present study included a limited number of patients because it is quite difficult to recruit patients with life-threatening vascular diseases, being prepared for major surgery. Reduced sample sizes are associated with reduction in power of the statistical tests. Post hoc power calculation showed that the power of our tests were low. The consequence is an increase in the risk for type II error, the possibility that potential differences between groups might not be detected. Yet, we have found a statistically significant difference between the study groups regarding the IL1RN VNTR allele 1: a higher frequency was detected in VD patients with CP than in VD patients without CP. This means that the IL1RN VNTR polymorphism could be a marker for CP among patients with VD, independent of shared risk factors.

The development of CP causes a sustained low-graded systemic inflammation by increasing levels of factors such as C-reactive protein (CRP), fibrinogen and plasminogen activator inhibitor antigen (PAI-1) [44]. These factors are established indicators of risk for cardiovascular diseases and can constitute an additional burden in the pathogenesis of VD. This emphasizes the importance of relieving the pressure of environmental pathogenic factors on patients with VD by lending them rigorous periodontal treatment. In this study, we have identified genetic markers that are specifically associated with CP within a group of patients with VD. Information about genetic component or predictive biomarkers may help to identify subgroup of VD patients without clinical CP but who are at risk to develop it and selectively target them for effective preventive CP intervention. Perhaps in the future, incorporating risk for developing severe CP in patients with VD overall risk profile can contribute to a better understanding of individual differences in disease expression.

Acknowledgment

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. References

We thank the staff at the Department of Vascular Surgery, Oslo University Hospital, Aker, for their kind help with the patients and the vascular biopsies. We also wish to thank Ibrahimu Mdala (Faculty of Dentistry, University of Oslo) for his statistical advice.

Conflict of interest

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. References

The authors report no conflict of interest. They alone are responsible for the content and writing of the paper.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. Conflict of interest
  9. References