SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Author contribution
  8. Funding
  9. Conflict of interest
  10. References

High-grade glioma is a malignant tumour; the pathogenesis is to be further investigated. Interleukin (IL)-17 is an inflammatory cytokine. Chronic inflammation is a pathological feature of cancer. This study aimed to characterize the glioma-derived IL-17+ regulatory T cells (Treg). In this study, single cells were isolated from surgically removed high-grade glioma tissue and examined by flow cytometry. The immune suppressor effect of IL-17+ Tregs on CD8+ T cells was assessed in vitro. The results showed that abundant IL-17+ Tregs were found in high-grade glioma tissue. The immune suppressor molecule, transforming growth factor (TGF)-beta, was detected in the IL-17+ Tregs. The proliferation of CD8+ T cells was suppressed by culturing with the IL-17+ Tregs, which was partially abrogated by neutralizing antibodies of either TGF-beta or IL-17 and completely abrogated by neutralizing antibodies against both TGF-beta and IL-17. In conclusion, IL-17+ Tregs exist in the high-grade glioma tissue; this subset of T cells can suppress CD8+ T cell activities via releasing TGF-beta and IL-17.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Author contribution
  8. Funding
  9. Conflict of interest
  10. References

High-grade glioma is a malignant tumour that is characterized as diffuse high-grade glioma of astrocytic, oligodendroglial or mixed lineage with a World Health Organization grade of either III or IV. High-grade glioma is one of the most common central nervous system cancers. About 70% high-grade glioma are glioblastomas (grade IV high-grade gliomas), and 30% high-grade glioma are anaplastic (or grade III high-grade gliomas) [1]. Glioma responds poorly to standard therapeutic regimens. Patients with high-grade glioma have much shorter median survival time comparing with other tumours [2]. The pathogenesis of high-grade glioma is poorly understood currently.

T regulatory cells (Treg), characterized by the expression of the forxhead box P 3 (Foxp3), can inhibit the antitumour immunoresponses. Cumulative studies have revealed that the increases in Treg numbers within tumours and the circulation of cancer patients, which implies this subset of T cells, may be involved in the pathogenesis and disease progression of tumours. The transforming growth factor (TGF)-β is one of the major molecules in Tregs to fulfil the immune suppressor functions [3]. It is suggested that Tregs accumulate in high-grade glioma and contribute to the suppression of immune responses in the tumours. The percentage of tumour-infiltrating Tregs is strongly correlated with the WHO grade of the brain tumour [4]. The role of Tregs in the pathogenesis of high-grade glioma is not fully elucidated yet.

Interleukin (IL)-17 is a proinflammatory cytokine that is produced by T helper (Th)-17 cells. IL-17 is involved in the pathogenesis of a number of immune disorders, such as multiple sclerosis [5], inflammatory bowel disease [6] and rheumatic diseases [7]. It is also proposed that a positive association between chronic inflammation and the pathogenesis of malignant tumours, such as a portion of patients with inflammatory bowel disease, develop into colon cancer [8]. However, the underlying mechanism in such an association is poorly understood.

Recent studies have revealed a subset of T cells, the IL-17+ Tregs, in the body. This cell population expresses the immune suppressor molecule, TGF-β, and still retains the immune suppressor function [9]. Based on the above information, we propose that the IL-17-expressing Foxp3+ T cells exist in high-grade glioma tissues and play a role in compromising immune regulation in the high-grade glioma. Thus, we collected and analysed surgically removed high-grade glioma tissues. As expected, abundant IL-17+ Tregs were detected in the high-grade glioma tissue. This subset of Tregs suppressed the activities of CD8+ T cells.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Author contribution
  8. Funding
  9. Conflict of interest
  10. References

Reagents

Antibodies for flow cytometry were purchased from BD Bioscience (Shanghai, China). Materials for RT-PCR and Western blotting were purchased from Invitrogen (Beijing, China). The enzyme-linked immunoassay (ELISA) kits of IL-17, TGF-β, perforin and granzyme B were purchased from the R&D Systems (Shanghai, China). Antibodies of Foxp3 (150D/E4), IL-17 (G-4) and IL-17 receptor (N-16) were purchased from Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Recruitment of patient with high-grade glioma

Forty-two patients with high-grade glioma were recruited to this study. The diagnosis of high-grade glioma was performed by the routine procedures of our department based on clinical symptoms and image diagnosis procedures and finally proved by pathological diagnosis on the surgically removed tumour tissue. All patients did not have any special treatment for high-grade glioma before surgery. The patients consisted of 21 males (age: 11–45) and 21 females (age: 21–56). Twenty-seven patients with glioblastoma (grade IV) and 15 patients with anaplastic astrocytoma (grade III). The study was approved by the Human Research Ethic Committee at the Third Military Medical University. An informed consent was obtained from each patient.

Immune cell isolation from the high-grade glioma tissue

The surgically removed high-grade glioma tissue was collected and cut into small pieces (2 × 2 × 2 mm) and treated with predigestion solution (1 × HBSS containing 5 m EDTA and 1 mm DTT) at 37 °C for 30 min under slow rotation. The tissue was collected by centrifugation (×300 g, 10 min) and incubated in the digestion solution (dissolve 0.05 g of collagenase D, 0.05 g of DNase I and 0.3 g of dispase II in 100 ml of one times phosphate-buffered saline [PBS]) at 37 °C for 60 min under slow rotation. Cells were filtered with a cell strainer (40 μm in diameter). Isolation of immune cells was performed with commercial magnetic cell sorting kits following the manufacturer's instruction. Briefly, the mixture of single cells was incubated with magnetic beads coated with antibodies against target molecules (including CD4, CD25 and CD127, respectively). Then, the cell solution was transferred on a column placed in a strong magnetic field and washed out to a separate vessel, after removing the column from the magnetic field. The purity of the isolated immune cells was over 95% as checked by flow cytometry.

Blood collection

The peripheral blood was collected from healthy volunteers. Forty millilitres of the blood was collected from each subject. Peripheral blood mononuclear cells were isolated by gradient density centrifugation. CD8+ T cells were isolated by MACS with commercial reagent kits following the manufacturer's instruction.

Flow cytometry

Cells were fixed with 1% paraformaldehyde and treated with a permealization reagent on ice for 30 min. After washing with PBS, cells were blocked by 1% bovine serum albumin for 30 min and then incubated with fluorescence labelled antibodies (500 ng–1000 ng/ml) for 30 min on ice. The cells were analysed by a FACSarray (BD Bioscience, Shanghai, China). Data were analysed with software FlowJo (TriStar, Ashland, OR, USA).

Detection of IL-17R of CD8+ T cells

CD8+ T cells were collected from three healthy persons. A portion of the cells was subjected to quantitative real-time RT-PCR (qRT-PCR) and Western blotting. Another portion of the cells were analysed by flow cytometry to detect the IL-17R expression on CD8+ T cells.

Quantitative real-time RT-PCR

The total RNA was extracted from CD8+ T cells with the Trizol reagent. The cDNA was synthesized with a reverse-transcription reagent kit. qPCR was performed on a MiniOpticon qPCR system (Bio-Rad, Shanghai, China) with the SYBR green supermix. The results were calculated using the inline image method. The primer used to detect IL-17R is forward, tgtttcctgcccagaaatgc, and reverse, caggccatcggtgtatttgg (NCBI: U58917).

Western blotting

Total protein was extracted from CD8+ T cells and fractioned by SDS-PAGE (sodium dodecyl sulphate polyacrylamide gel electrophoresis); the fractions were transferred onto a nitrocellulose membrane; the membrane was blocked by 5% skim milk for 30 min, incubated with anti-IL-17R antibody (200 ng/ml) for 1 h at room temperature and followed by incubation with the second antibody (conjugated with horseradish peroxidase) for 1 h. Washing with TBST (tris-buffered saline-Tween-20) was performed after each incubation. The immune complex on the membrane was developed using enhanced chemiluminescence (ECL) reagent. The results were recorded using X-ray films.

CD8+ T cell activation

CD8+ T cells were activated in vitro by culturing the cells in plates coated with anti-CD3 (2 μg/ml) and in the presence of anti-CD28 (2 μg/ml) antibodies. The proliferation of CD8+ T cells and the release of perforin and granzyme B into culture medium were used as indicators of activation of CD8+ T cells.

Immune suppression assay

The proliferation of CD8+ T cell was assessed by the carboxyfluorescein succinimidyl ester (CFSE) dilution assay. CD8+ T cells were labelled with CFSE and cultured in the presence of anti-CD3/CD28 for 4 days. The CFSE dilution assay was performed by flow cytometry.

Enzyme-linked immunoassay

The levels of IL-17, TGF-β, perforin and granzyme B in the culture medium were determined by ELISA with commercial reagent kits following the manufacturer's instruction.

Statistics

Data were expressed as means ± SD. The values were analysed using the two-tailed unpaired Student's t-test when data consisted of two groups or by ANOVA when three or more groups were compared. P < 0.05 was set as the statistically significant criteria.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Author contribution
  8. Funding
  9. Conflict of interest
  10. References

Foxp3+IL-17+ T cells are detected in high-grade glioma tissue

Published data indicate that Foxp3+ T cells express IL-17 under given circumstances [10]; we predict that some of the Foxp3+ Treg cells in cancer tissue express IL-17. Therefore, we collected surgically removed high-grade glioma tissue from 36 patients to be examined by flow cytometry. The results showed that about 8% Foxp3+ IL-17+ Foxp3+ T cells were detected in the CD4+ CD25+ T cells from high-grade glioma tissue, while only about 1.5–1.9% IL-17+ Tregs were found in controls (Fig. 1). We also analysed the expression of IL-17 and Foxp3 between grade III and grade IV high-grade glioma. No significant difference was observed (data not shown).

image

Figure 1. Foxp3+ IL-17+ T cells increase in glioma tissue. The surgically removed glioma tissue was collected from 36 patients with glioma. Mononuclear cells were isolated from the glioma tissue and the marginal non-glioma tissue (the non-glioma tissue was proved by a pathologist using as a control.), respectively, and the peripheral blood from the patients with glioma and three healthy persons. CD4+ CD25+ T cells were further isolated from the mononuclear cells by MACS, and were examined by flow cytometry. The representative dot plots show the frequency of Foxp3+ IL-17+ T cells. Panel A5 is an isotype control. B, the bars indicate the summarized data of panel A. C, a portion of the isolated CD4+ CD25+ T cells (purity ≥ 98%) were cultured in the presence of anti-CD3/CD28 overnight. The culture supernatant was analysed by ELISA. The bars indicate the levels of IL-17 in culture supernatant. The data of bars are mean ± SD. *P < 0.01, compared with glioma group. Samples from individual subjects were processed separately.

Download figure to PowerPoint

High-grade glioma-derived IL-17+ Tregs express immune suppressor molecules

To further characterize the Foxp3+IL-17+ T cells from high-grade glioma tissue, the same batch cells in Fig. 1 were also stained with antibodies of TGF-β and examined by flow cytometry. As shown by Fig. 2A–C, about 80–90% gated IL-17+ Tregs showed TGF-β+ (Fig. 2A). The frequency of IL-10+ Foxp3+ T cells was below 10% (Fig. 2B). The data implicate that high-grade glioma-derived IL-17+ Tregs may still have immune suppressor functions as they express the immune suppressor molecule, TGF-β. Further results showed that the IL-17+ Tregs released high levels of TGF-β, and low levels of IL-10, into the culture medium upon activation (Fig. 2D).

image

Figure 2. The glioma-derived Foxp3+ IL-17+ T cells express high levels of TGF-β. The gated Foxp3+ IL-17+ cells in Figure 1 were further assessed for the frequency of TGF-β+ cells. A–C, the representative histograms indicate the frequency of TGF-β+ cells in gated Foxp3+ IL-17+ cells. E–G, the bars indicate the summarized data of the histograms. D and H, the bars indicate the summarized data of A–C (D) and E–G (H). Samples from individual subjects were processed separately.

Download figure to PowerPoint

High-grade glioma-derived IL-17+ Tregs suppress CD8+ T cell activities

To assess the effect of the glioma-derived IL-17+ Tregs on CD8+ T cells, we isolated CD8+ T cells from the peripheral blood of healthy subjects and patients with glioma. The CD8+ T cells were analysed for the expression of the IL-17 receptor (R). The results showed that the expression of IL-17R was detected in the CD8+ T cells of both healthy subjects and patients with glioma, which was slightly higher in glioma group, but did not reach the statistical significance. We then isolated CD8+ T cells from glioma tissue and analysed by qRT-PCR and Western blotting. The results showed the expression of IL-17R was significantly higher in the CD8+ T cells from glioma tissue than that from peripheral blood of both healthy subjects and patients with glioma (Fig. 3A,B). To determine whether the CD8+ T cells from glioma tissue still conserve the cytotoxic feature, we detected the ability of releasing the signature cytokines of perforin and granzyme B after activation in the culture. The results showed that significantly lower levels of perforin and granzyme B were detected in the culture supernatant of the CD8+ T cells of glioma tissue as compared with those from the peripheral blood (P < 0.05; Fig. 3C).

image

Figure 3. Human peripheral CD8+ T cells express IL-17 receptor (R). A–C, peripheral CD8+ T cells were obtained from six healthy persons and six patients with glioma. The cells were processed to detect the expression of IL-17R by qRT-PCR and Western blotting. A, the immune blots indicate the protein levels of IL-17R. B, the bars present the summarized data of the integrated density of the immune blots of A. C, the bars indicate the mRNA levels of IL-17R. D, CD8+ T cells were isolated from surgically removed glioma tissue of six patients. The CD8+ T cells from healthy subjects, glioma patient blood (Glioma-B) and glioma tissue (Glioma-T) were cultured (10,000 cells/ml) in the presence of anti-CD3/CD28 Ab for 4 days. The bars indicate the levels of the cytokines in the culture supernatant (by ELISA). The data of bars are presented as mean ± SD. *P < 0.05, compared with healthy subjects. Samples from individual persons were processed separately.

Download figure to PowerPoint

We also isolated CD4+ CD25+ CD127 T cells (Treg) from the high-grade glioma-derived mononuclear cells (the purity was 83.2% ± 6.3%). The cells were cultured with CD8+ T cells (labelled with CFSE) in plates in the presence of anti-CD3/CD28 antibodies for 4 days. As shown by the data in Fig. 4A,B, the exposure to anti-CD3/CD28 antibodies markedly increased the proliferation of CD8+ T cells (Fig. 4A1–2, 4B), which was abolished by the coculture with IL-17+ Tregs (Fig. 4A3, 4B). The addition of anti-TGFbeta (Fig. 4A4, 4B) or anti-IL-17 (Fig. 4A5, 4B) antibodies could partially block the suppressor effect on CD8+ T cell activation, which was further strengthened by the addition of both anti-TGF-β and anti-IL-17 antibodies (Fig. 4A7, 4B). In addition, using as controls, CD4+ CD127+ T cells did not show suppressor effect on CD8+ T cell proliferation (Fig. 4A8, 4B); natural Tregs isolated from healthy subjects showed inhibitory effect, but less than those Tregs isolated from glioma tissue (P < 0.01; Fig. 4A9, 4B), which was abolished by addition of anti-TGF-β to the culture (Fig. 410, 4B). We also found that the levels of perforin and granzyme B were increased in the supernatants of CD8+ T cell culture that was inhibited by culturing with IL-17+ Tregs (Fig. 4C). To clarify whether the cell–cell contact mechanism is required in the suppressor functions of the IL-17+ Tregs, in separate experiments, the IL-17+ Tregs and CD8+ T cells were physically separated and cultured in the Transwell system and processed in the same approaches above. The results showed that a suppressor effect on CD8+ T cell proliferation was still observed (data not shown). The results indicate that, similar to the CD4+ CD25+ Foxp3+ Tregs, the high-grade glioma-derived IL-17+ Tregs still have an immune suppressor function. The IL-17 further strengthens the immune suppressor effect on CD8+ T cells. The cell–cell contact mechanism is not required by which the glioma-derived IL-17+ Tregs suppress CD8+ T cell proliferation.

image

Figure 4. Suppressor effect on CD8+ T cell proliferation by Foxp3+ IL-17+ T cells. Peripheral CD8+ T cells were isolated and labelled with CFSE and cocultured with glioma-derived CD4+ CD25+ CD127 T cells (containing 83.2% ± 6.3% Foxp3+ IL-17+ T cells; IL-17+ Treg; or natural Treg from healthy subjects, nTreg; or normal CD4+ CD127+ T cells from healthy subjects, nCD4+ T cell) in plates coated with anti-CD3/CD28 antibodies (2 μg/ml of each; Ab) for 4 days. The ratio of CD8+ T cell and IL-17+ Treg was 10,000:2000/well. The treatment is denoted above each histogram. The cells were collected and analysed by flow cytometry, the CFSE dilution assay. A, the histograms indicate the CD8+ T cell proliferation. B, the bars show the summarized data of panel A. C, the bars indicate the contents of porforin and granzyme B in the supernatants. The data in B and C were presented as mean ± SD. *P < 0.01, compared with group A1. #P < 0.01, compared with group A2. The concentration of anti-IL-17 and anti-TGF-β in the culture was 1 μg/ml. A11 shows the results of Transwell experiments, in which IL-17+ Tregs were cultured in the inserts and CD8+ T cells were cultured in the basal chambers. Other treatments are the same as A3. The data represent six experiments.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Author contribution
  8. Funding
  9. Conflict of interest
  10. References

The present paper reports a novel finding in the properties of high-grade glioma by presenting evidence that abundant CD4+ CD25+ IL-17+ Tregs exist in the high-grade glioma tissue; the cells express the immune suppressor molecule, TGF-β; the IL-17 can promote the immune suppressor functions.

It is reported that Foxp3+ Treg cells were found in high-grade glioma [11] as well as other tumour tissues [12]. Our results are in line with these previous studies, and a large number of Foxp3+ Treg cells were detected in the high-grade glioma tissue. The functions of Treg cells in tumour are proposed to protect tumour cells from being attacked by immune effector cells via releasing immune suppressor molecules. We also detected high levels of TGF-β in the high-grade glioma tissue; the fact indicates that the Treg cells in high-grade glioma tissue have the capacity to suppress other immune effector cells.

A novel finding of the present study is that most of the Foxp3+ Treg cells in high-grade glioma tissue also express IL-17. IL-17+ Tregs have been identified in other systems in the body, such as in the peripheral blood [9], chronic intestinal inflammation [13] and colorectal cancer [14]. This subset of T cells has not yet reported in high-grade glioma before. Published data indicate that the tumour-infiltration macrophages can chemotactically attract Foxp3+ Tregs into tumour tissue; under the hypoxic environment, the Foxp3+ Tregs express IL-17 and become IL-17+ Tregs [14]; the expression of IL-17 by these Tregs may be a specific sign of activation by tumour-derived factors and the latter need to be further investigated. The hypoxia is a common feature in various cancers [15]; it also occurs in the high-grade glioma tissue [16]. Yet, whether the IL-17+ Tregs in the high-grade glioma tissue we observed in the present study also stem from the tumour infiltrating Foxp3+ Tregs under the hypoxic environment [16] needs to be further investigated.

The functions of IL-17+ Tregs have not been fully understood yet. Previous studies indicate that this subset of Tregs still possess the immune suppressor capability [9]. In addition to, in line with previous findings, our study demonstrates that the glioma-derived IL-17+ Tregs express TGF-β and IL-17. The fact implicates that this subset of T cells is capable of suppressing the immune effector cells in high-grade glioma. Our in vitro data provide supporting evidence that the high-grade glioma-derived IL-17+ Tregs can suppress the CD8+ T cells. CD8+ T cells play a very important role in the eliminating tumour cells from the body [17]. The frequency of CD8+ T cell in tumour tissue can be a prognostic sign of the tumours [18]. Thus, it is conceivable that to remove such negative factors in CD8+ T cells is potential to save more CD8+ T cells in tumour tissue that may facilitate the elimination of tumours from the body [19]. It is suggested that Tregs play a role in the suppression of CD8+ T cells in tumours so as to protect tumours from the immune surveillance [20]. IL-17+ Tregs have a similar effect on suppressing the CD8+ T cell activation as observed in the present study. TGF-β is the most important immune suppressor molecule in Treg's immune regulatory capacity [21]. To block the effect of TGF-β may abolish the Treg's immune suppressor effect on CD8+ T cells. However, our data indicate that to neutralize TGF-β in culture is not sufficient to block the effect of IL-17+ Tregs on suppressing CD8+ T cell activities. The fact implies that besides TGF-β, other factors also exist in IL-17+ Tregs to facilitate the inhibitory effect on CD8+ T cells. As IL-17 has a potential pro-tumour role [22], it may be involved in the suppression of CD8+ T cell activities. The deduction is supported by our in vitro experiments. By neutralizing IL-17 with anti-IL-17 antibody in the culture, the suppression of CD8+ T cell activities was partially abrogated. It is also proposed by published data that IL-17 plays a critical role in the pathogenesis of cancer [23].

In summary, the present data indicate that in a subset of T cells, IL-17+ Tregs exist in the high-grade glioma tissue. This subset of T cells can suppress the activities of CD8+ T cells, which can be antagonized by neutralizing the immune suppressor molecules, TGF-β and IL-17 in the culture.

Author contribution

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Author contribution
  8. Funding
  9. Conflict of interest
  10. References

H.L., L.Y., X.W. and C.Z. were involved in the collection of samples, performed experiments and analysed the data. Xu L. was the principle investigator of this project, designed the experiments, analysed data and wrote the manuscript. All authors were involved in writing the paper and had final approval of the submitted and published versions.

Funding

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Author contribution
  8. Funding
  9. Conflict of interest
  10. References

The study was supported by a grant of Daping Hospital, The Third Military Medical University.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Author contribution
  8. Funding
  9. Conflict of interest
  10. References