Vitamin A Supplementation Reduces IL-17 and RORc Gene Expression in Atherosclerotic Patients

Authors

  • A. Mottaghi,

    Corresponding author
    1. Obesity Research Center, Nutrition and Endocrine Research Center, Research Institute of Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran
    • Correspondence to: A. Mottaghi, Assistant professor of nutrition at Nutrition and Endocrine Research Center, Research Institute of Endocrine Sciences, Shahid Beheshti University of Medical Sciences, P.O. Box 193-4763, Tehran, Iran. E-mail: amottaghi@sbmu.ac.ir

    Search for more papers by this author
  • S. Ebrahimof,

    1. Students' Research Committee, Faculty of Nutrition and Food Technology, National Nutrition and Food Technology Research Institute, Shahid Beheshti University of Medical Sciences, Tehran, Iran
    Search for more papers by this author
  • P. Angoorani,

    1. Faculty of Nutrition and Food Technology, National Nutrition and Food Technology Research Institute, Shahid Beheshti University of Medical Sciences, Tehran, Iran
    Search for more papers by this author
  • A.-A. Saboor-Yaraghi

    1. Department of Cellular and Molecular Nutrition, School of Nutrition and Dietetics, Tehran University of Medical Sciences, Tehran, Iran
    Search for more papers by this author

Abstract

Vitamin A is a potential mediator of T helper cells in atherosclerosis. The purpose of this study was to evaluate the effect of vitamin A supplementation on expression of Th17 cells-related IL-17 and RORc genes in atherosclerotic patients. Thirty one atherosclerotic patients and 15 healthy controls were studied for 4 months. Atherosclerotic patients were randomly divided into vitamin A or placebo groups. Healthy controls and patients in vitamin A group received 25,000 IU retinyl palmitate per day. Peripheral blood mononuclear cells were isolated, cultured and divided into three groups including fresh cells, phytohemagglutinin (PHA)-activated T cells and ox-LDL-activated T cells. Gene expressions of T cells were studied by real-time PCR. In atherosclerotic patients, vitamin A supplementation resulted in significant decrease in IL-17 gene expression by 0.63-fold in fresh cell, 0.82-fold in PHA-activated cells and 0.65-fold in ox-LDL-activated cells (P < 0.05 for all). RORc gene expression in fresh cells as well as ox-LDL-activated cells decreased significantly after vitamin A supplementation in atherosclerotic patients (P = 0.0001 for both). In PHA-activated cells, vitamin A supplementation significantly decreased RORc gene in both atherosclerotic patients and healthy subjects by 0.87-fold and 0.72, respectively, while in placebo group, the RORc gene expression significantly increased by 1.17-fold (P < 0.05 for all). Findings of this study suggest that vitamin A supplementation may be an effective approach to slow progression of atherosclerosis.

Introduction

Atherosclerosis is a chronic inflammatory condition leading to cardiovascular disease (CVD), which in turn is the dominant cause of mortality worldwide [1]. It was believed that atherosclerosis is a passive accumulation of cholesterol in the artery walls, but recently it has been shown that atherosclerosis is a multifactorial disease that involves chronic inflammation. Components of innate immunity as well as adaptive immunity regulate atherosclerosis in all stages from initiation to progression and, eventually, plaque rupture [2, 3]. T cells, especially CD+4 T cells, are found in atherosclerotic lesion [4, 5] and the presence of heat-shock protein (HSP)-60-specific T cells [6] and LDL reactive T cells [7] in the initial lesion suggests a T-cell-mediated immune response in atherogenesis [8].

Several subsets of T cells including T helper (Th) 1, Th2 and T regulatory cells (Treg) are present in atherosclerotic lesion [9, 10]. Recent studies have demonstrated the presence of Th17 cells within these lesions. These comparatively new subset of CD+4 T cells are characterized by production of inflammatory cytokine IL-17. Retinoid-related orphan receptor-c (RORc), the main transcription factor that controls Th17 cells differentiation, cooperates with other transcription factors such as STAT3, STAT 4, RUNX3, RUNX1 and aryl hydrocarbon receptor (AHR) to induce IL-17 expression [11-13]. Previously, it was suggested that IL-23 has a central role in Th17 differentiation [14]. However, activation of RORc induces the expression of IL-23 receptor, indicating that IL-23 acts on cells that are already committed to Th17. In vitro, the induction of Th17 subset is dependent on TGF-β and IL-6 or IL-21 (in mice) or on IL-1β or IL-23 (in humans), which activates RORc expression and STAT3 phosphorylation. RORc stimulates the production of IL-21 and the expression of the IL-23 receptor. IL-23 is required to expand and stabilize Th17, whereas IL-21 amplifies Th17 differentiation through autocrine and paracrine loops [15]. The effects of Th17 cells on atherogenesis are not fully defined. The existence of Th17 cells within atherosclerotic human arteries suggests a potential role for Th17 cells in atherosclerosis [16, 17]. A recent review indicates that IL-17 has a pro-inflammatory role in atherosclerosis through the induction of aortic chemokines, cytokines and accumulation of macrophages within atherosclerotic plaques [18]. Thus, inhibition of Th17 polarization is beneficial for controlling immune response and amelio-rating atherosclerotic inflammation.

Vitamin A and its well-known analogues play crucial roles in mediating immune responses [19] and are capable of ameliorating various models of autoimmune diseases such as rheumatoid arthritis [20], type 1 diabetes [21] and ulceratative colitis [22]. A strong suppressive effect of retinoids on pro-inflammatory Th17 cells function via downregulation of RORc has been demonstrated in vitro. Retinoids can also suppress Th17 function via RARα [23-25]. In vivo, it has been demonstrated that retinoic acid (RA) enhances TGF-β and Foxp3 expression and decreases Th17 differentiation and IL-17 production [25]. RA enhances TGF-β signalling by increasing the expression and phosphorylation of Smad3, and these events result in increased Foxp3 expression even in the presence of IL-6 or IL-21. RA also inhibits the expression of IL-6Rα, IRF-4 and IL-23R and thus inhibits Th17 development [26].

To the best of our knowledge, no study has been demonstrated the cellular mechanism of the effects of vitamin A supplementation on Th17 cells function. Thus, in this study, we assessed effects of vitamin A supplementation on IL-17 and RORc gene expression in atherosclerotic patients.

Materials and methods

The study protocol has been described in sufficient detail elsewhere [27]. In brief, 31 atherosclerotic patients and 15 healthy controls participated in the present double-blind study. The subjects were not taking any medicines or not suffering from any conditions affecting the immune system. Atherosclerotic patients were randomly assigned to vitamin A or placebo group. Healthy controls and patients in Vitamin A group received 25,000 IU retinyl palmitate daily for 4 months. Control patients received one pearl of placebo per day up to 4 months. Dietary intake was assessed using a food frequency questionnaire at the beginning and at the end of the study. Each subject provided written informed consent, and the study protocol was approved by the Ethical Committee of Tehran University of Medical Sciences with number of 89-01-27-10471. Protocol of this study was approved by clinicaltrials.gov with NCT01414972 identifier.

Peripheral blood mononuclear cells were isolated from heparinized blood by Ficoll–Hypaque gradient centrifugation and PBMCs divided into 3 groups. Group 1 contained fresh cells and mRNA extracted immediately, whereas PBMCs in group 2 and 3 cultured for 72 h at 37 °C and 5% CO2 under stimulation of ox-LDL (Biomedical Technology Inc, Stoughton, MA, USA), phytohemagglutinin (PHA; Sigma-Aldrich Corporation, St. Louis, MO, USA). After this period, all the cultured cells were used for RNA extraction. Cytoplasmic RNA by RNeasy Plus Mini Kit (Qiagen, Valencia, CA, USA) was extracted, and cDNA using QuantiTect Reverse Transcription Kit (Qiagen) was synthesized.

Real-time polymerase chain reaction (PCR) was performed by SYBER green detection method. Primers for β-actin, IL-17 and RORc were designed using Primer Express 3 software (Applied Biosystems, Foster City, CA, USA) and purchased from Metabion Company (Table 1). β-actine mRNA expression level was used to normalize the m-RNA expression levels of IL-17 and RORc. Comparative Ct (2−∆∆Ct) method was used for calculating the fold change of gene expression.

Table 1. Primer sequences for real-time PCR
GeneSequenceAmplicon size, bp
IL-17Forward: 5′- GGGCCTGGCTTCTGTCTGA -3′ Reverse: 5′- AAGTTCGTTCTGCCCCATCA -3′73
RORcForward: 5′- GAAGTGGTGCTGGTTAGGATGTG -3′ Reverse: 5′- GCCACCGTATTTGCCTTCAA -3′75
Β-actinForward:5′-CCTGGCACCCAGCACAAT-3′ Reverse: 5′-GCCGATCCACACGGAGTACT-3′70

Data were analysed using spss software (SPSS, Inc., Chicago, IL, USA), and statistical significance was defined as P < 0.05.

Results

Baseline clinical and biochemical data of subjects are illustrated in the Table 2. There were no statistically differences in baseline characteristics of subjects except for the abdominal circumference and LDL-C level. Abdominal circumference of atherosclerotic patients was statistically higher than healthy controls. LDL-C levels were statistically different among three groups, and the highest level was belonged to the healthy controls.

Table 2. Baseline clinical and biochemical data of patients and healthy controls
CharacteristicHealthy controlsPatientsP valuea
Vitamin APlacebo
  1. Bold values are significant.

  2. RE, Retinol equivalent.

  3. All values are expressed as means ± SD or numbers.

  4. a

    One-way ANOVA.

  5. b

    Tukey test results following one-way ANOVA.

Age (years)

Sex (male/female)

Weight (kg)

Body mass index (kg/m2)

Waist to hip ratio

Abdominal circumference (cm)

Total vitamin A intake (RE/day)

LDL-C (mg/dl)

HDL-C (mg/dl)

55.8 ± 7.04

5/7

73.0 ± 9.5

28.6 ± 4.6

0.89 ± 0.1

94.17 ± 8.3b

224.83 ± 67.1

100.5 ± 18.1b

47.2 ± 11.8

55.7 ± 7.6

8/8

79.0 ± 10.2

29.1 ± 2.3

0.94 ± 0.1

99.2 ± 5.7

256.3 ± 85.7

68.9 ± 21.8b

42.9 ± 7.9

55.1 ± 7.5

8/7

81.2 ± 13.2

30.2 ± 5.3

0.93 ± 0.1

103.2 ± 5.3b

252.3 ± 88.6

72.4 ± 23.3b

44.3 ± 10.0

0.292

0.163

0.568

0.267

0.01

0.570

0.001

0.515

In fresh cells, IL-17 mRNA expression was significantly different among three studied groups (P = 0.02). Vitamin A supplementation resulted in 0.63-fold decrease (P = 0.003) in IL-17 mRNA expression in atherosclerotic patients. IL-17 mRNA expression increased in placebo group and healthy controls by 2.03-fold (P = 0.999) and 1.06-fold (P = 0.627), respectively; however, these increases were not statistically significant (Table 3). Significant difference in RORc gene expression was also observed among groups (P = 0.001), and the difference was related to much lower expression of RORc in patients receiving vitamin A compared with placebo group (P = 0.037) (Table 4). After intervention, the expression of RORc decreased by 0.29-fold (P = 0.0001) in atherosclerotic patients. However, insignificant increases were observed in placebo group and healthy controls by 4.53-fold (P = 0.537) and 1.29-fold (P = 0.819), respectively.

Table 3. ΔCT and mean of IL-17gene expression in fresh cells
 Patient group (n = 31)Control group (n = 12)P value
Vitamin A (n = 16)Placebo (n = 15)
  1. Bold values are significant.

  2. Data are reported as means ± SD.

  3. ΔCT, CT of target gene – CT of β-actin.

  4. a

    One-way ANOVA.

  5. b

    Paired-sample t-test.

  6. c

    Kruskal–Wallis test.

ΔCT of IL-17 gene expression

Before

After

Difference

P valueb

7.87 ± 1.88

9.67 ± 1.75

+1.81 ± 2.02

0.003

7.58 ± 2.31

7.58 ± 1.61

−0.07 ± 1.89

0.999

6.07 ± 1.08

6.18 ± 1.21

+0.11 ± 0.79

0.627

0.040 a

0.000 a

0.009 c

Mean of IL-17 gene expression0.63 ± 1.062.03 ± 2.621.06 ± 0.6 0.02 c
Table 4. ΔCT and mean of RORc gene expression in fresh cells
 Patient group (n = 31)Control group (n = 12)P value
Vitamin A (n = 16)Placebo (n = 15)
  1. Bold values are significant.

  2. Data are reported as means ± SD.

  3. ΔCT, CT of target gene – CT of β-actin.

  4. a

    One-way ANOVA.

  5. b

    Paired-sample t-test.

  6. c

    Kruskal–Wallis test.

ΔCT of RORc gene expression

Before

After

Difference

P valueb

6.05 ± 1.12

8.76 ± 1.35

+2.71 ± 1.79

0.0001

7.61 ± 2.51

7.23 ± 1.44

−0.38 ± 2.53

0.572

8.11 ± 2.31

8.19 ± 2.59

+0.08 ± 1.18

0.819

0.025 a

0.072a

0.0001 c

Mean of RORc gene expression0.29 ± 0.344.53 ± 7.531.29 ± 1.18 0.001 c

In PHA stimulated cells, IL-17 mRNA expression levels were not significantly different among three studied groups (P = 0.113). Intervention decreased IL-17 mRNA expression by 0.82-fold (P = 0.001) in vitamin A consuming patients. In placebo group and healthy controls, insignificant increases in IL-17 mRNA expression by 1.36-fold (P = 0.074) and 1.19-fold (P = 0.320) were observed, respectively (Table 5). RORc gene expression in PHA stimulated cells was not significantly different among three groups (P = 0.993). The expression of RORc gene in patients receiving vitamin A and healthy controls was significantly decreased by 0.87-fold (P = 0.015) and 0.72-fold (P = 0.22), respectively. In placebo group, the expression of this gene was significantly increased by 1.17-fold (P = 0.019) (table 6).

Table 5. ΔCT and mean of IL-17 gene expression in PHA-activated cells
 Patient group (n = 31)Control group (n = 12)P value
Vitamin A (n = 16)Placebo (n = 15)
  1. Bold values are significant.

  2. Data are reported as means ± SD.

  3. ΔCT, CT of target gene – CT of β-actin.

  4. a

    One-way ANOVA.

  5. b

    Paired-sample t-test.

  6. c

    Kruskal–Wallis test.

ΔCT of IL-17 gene expression

Before

After

Difference

P valueb

8.40 ± 1.56

10.35 ± 1.55

+1.96 ± 1.91

0.001

8.24 ± 2.30

9.55 ± 2.61

+1.31 ± 2.62

0.074

8.03 ± 1.15

8.47 ± 1.14

+0.44 ± 1.46

0.32

0.867a

0.046 a

0.176c

Mean of IL-17 gene expression0.82 ± 1.911.36 ± 1.971.19 ± 1.330.113c
Table 6. ΔCT and mean of RORc gene expression in PHA-activated cells
 Patient group (n = 31)Control group (n = 12)P value
Vitamin A (n = 16)Placebo (n = 15)
  1. Bold values are significant.

  2. Data are reported as means ± SD.

  3. ΔCT, CT of target gene – CT of β-actin.

  4. a

    One-way ANOVA.

  5. b

    Paired-sample t-test.

  6. c

    Kruskal–Wallis test.

ΔCT of RORc gene expression

Before

After

Difference

P valueb

11.24 ± 1.96

12.87 ± 1.66

+1.63 ± 2.39

0.015

10.74 ± 1.98

12.23 ± 1.54

+1.49 ± 2.19

0.019

9.8 ± 1.6

11.29 ± 1.2

+01.49 ± 1.93

0.022

0.143a

0.031 a

0.979c

Mean of RORc gene expression0.88 ± 1.041.17 ± 2.320.72 ± 0.810.993c

In ox-LDL stimulated cells, no significant difference was found for IL-17 mRNA expression level among groups (P = 0.343). Vitamin A supplementation decreased IL-17 mRNA expression in both atherosclerotic patients and healthy controls by 0.65-fold (P = 0.002) and 0.97-fold (P = 0.158), respectively. In placebo group, IL-17 mRNA expression increased by 3.83-fold (P = 0.069) (table 7). In these cells, RORc gene expression level was significantly different among studied groups (P = 0.001) and the difference was related to much lower expression of RORc in patients receiving vitamin A compared with healthy controls (P = 0.014) (Table 8). In atherosclerotic patients receiving vitamin A, RORc expression decreased by 0.34-fold (P = 0.0001); while in placebo group and healthy controls, it increased in significantly by 1.05-fold (P = 0.229) and 1.63-fold (P = 0.703), respectively.

Table 7. ΔCT and mean of IL-17gene expression in ox-LDL-activated cells
 Patient group (n = 31)Control group (n = 12)P value
Vitamin A (n = 16)Placebo (n = 15)
  1. Bold values are significant.

  2. Data are reported as means ± SD.

  3. ΔCT, CT of target gene – CT of β-actin.

  4. a

    One-way ANOVA.

  5. b

    Paired-sample t-test.

  6. c

    Kruskal–Wallis test.

ΔCT of IL-17 gene expression

Before

After

Difference

P valueb

10.02 ± 1.94

11.37 ± 1.73

+1.35 ± 1.44

0.002

7.95 ± 2.15

9.35 ± 2.31

+1.40 ± 2.76

0.069

8.22 ± 1.62

8.90 ± 2.69

+0.68 ± 1.55

0.158

0.010 a

0.011 a

0.604c

Mean of IL-17 gene expression0.65 ± 0.763.83 ± 11.800.97 ± 0.810.343c
Table 8. ΔCT and mean of RORc gene expression in ox-LDL-activated cells
 Patient group (n = 31)Control group (n = 12)P value
Vitamin A (n = 16)Placebo (n = 15)
  1. Bold values are significant.

  2. Data are reported as means ± SD.

  3. ΔCT, CT of target gene – CT of β-actin.

  4. a

    One-way ANOVA.

  5. b

    Paired-sample t-test.

  6. c

    Kruskal–Wallis test.

ΔCT of RORc gene expression

Before

After

Difference

P valueb

9.56 ± 1.81

11.84 ± 1.78

+2.28 ± 1.45

0.0001

12.07 ± 0.96

12.47 ± 1.49

+0.40 ± 1.24

0.229

12.26 ± 0.65

12.45 ± 2.00

+0.19 ± 1.7

0.703

0.0001 a

0.535a

0.0001 c

Mean of RORc gene expression0.34 ± 0.461.05 ± 0.851.63 ± 1.85 0.001 c

Discussion

In the present study, we examined the effects of vitamin A supplementation on expression of IL-17 gene and its related transcription factor, RORc. Our results revealed that daily consumption of 25000 IU retinyl palmitate can reduce IL-17 and RORc genes expression of fresh cells as well as PHA and ox-LDL stimulated T cells in the patients, thus vitamin A supplementation may be an effective approach to slow the progression of atherosclerotic lesion.

Baseline characteristics of patients in the three studied groups had no significant differences except for the waist circumference and the LDL-C level. LDL-C level was significantly higher in healthy controls than atherosclerotic patients in both vitamin A and placebo groups. Other studies have either shown no difference in LDL-C levels of atherosclerotic patients and healthy controls [28-32] or reported higher levels of LDL-C for atherosclerotic patients [33, 34]. Anyway, the observed difference in LDL-C may be due to the medications generally taken by these patients.

Our results showed 0.63-fold decrease in IL-17 gene expression in fresh cells of patients who took vitamin A, whereas Il-17 gene expression increases 2.03-fold in placebo patients. Healthy controls also revealed no significant increase in this gene expression. Increased gene expression of IL-17 in placebo patients may be attributed to progression of their disease that enhances inflammatory condition in the body.

Th17 cells have a central role in host defence response to bacterial and fungal infection, especially at mucosal surfaces [35]. Previously, it was thought that Th1 cells are responsible for induction of autoimmune diseases, whereas recently it is proposed that uncontrolled or inappropriate activation of Th17 cells is linked to several autoimmune and auto inflammatory disorders including multiple sclerosis, psoriasis, rheumatoid arthritis and inflammatory bowel disease [15]. Increased L-17 has been also reported in patients with mentioned inflammatory diseases [36]. Kotake et al. [37] reported that patients with rheumatoid arthritis had significantly higher levels of IL-17 in synovial fluids compared with patients with osteoarthritis. As well, higher IL-17 gene expression has been demonstrated in patients with rheumatoid arthritis compared with healthy subjects [38]. Increased IL-17 level has been reported in the carotid plaques of symptomatic patients undergoing endarterectomy [17] as well as in patients with coronary artery disease compared with healthy controls [39]. High mRNA expression of IL-17 and RORc in patients with acute myocardial infarction and unstable angina compared with patients with stable angina and results indicates the role of Th17 cells in atherogenesis [16, 40]. It is suggested that increased concentrations of the proinflammatory cytokines IL-17, IL-6 and IL-8 in patients with acute coronary syndrome confirms the role of Th17 cells in the incidence of unstable angina and acute myocardial infarction [41]. Higher number of Th17 cells as well as higher gene expression of IL-17 and RORc has been also reported in children with primary nephrotic syndrome compared with those with haematuria and healthy controls [42]. Multiple functions of IL-17 as a pro-inflammatory cytokine include stimulating the production of other pro-inflammatory cytokines such as IL-6 and TNF-α, chemokines such as macrophage chemoattractant protein-1 (MCP-1) and macrophage inflammatory protein-2 (MIP-2), and matrix metalloproteins that mediate tissue destruction [22]. In contrast to these results, recently atheroprotective roles have been proposed for IL-17 in mice. Taleb et al., [43] have shown that administration of IL-17 reduces endothelial vascular cell adhesion molecule–1 expression and vascular T cell infiltration thus significantly limits atherosclerotic lesion development.

In line with the results of present study, positive role of vitamin A supplementation in inflammatory conditions such as atherosclerosis have been reported previously [44]. Our results showed that vitamin A supplementation decreases IL-17 expression by 0.63-fold and RORc expression by 0.29-fold in fresh PBMCs of atherosclerotic patients compared with placebo and healthy control groups.

Vitamin A and its natural bioactive metabolites including 9-cis retinoic acid and all-trans retinoic acid (ATRA) are major mediators of immune responses [45].

Results of Mohammadzadeh et al. [46] study that examines the impact of vitamin A supplementation on Avonex-treated multiple sclerotic patients, consistent with our results. Mohammadzadeh et al. also found IL-17 gene expression in patients is reduced.

Bai et al. have shown that in patients with ulcerative colitis, ATRA downregulates inflammatory responses by shifting the Treg/Th17 profile [22]. Xiao et al. [26] have shown that RA inhibits development of Th17 cells through enhancing TGF-driven Smad3 signalling and Inhibiting IL-6 and IL-23 receptor expression. Retinoic acid also exerts its inhibitory effect by decreasing the ability of antigen presenting cells (APCs) to generate Th1 and Th17 cells. Retinoic acid mediates inflammation and immunity by suppressing the IL-6-initiated IL-17 production and increasing development of anti inflammation Treg cells. Some mechanisms are proposed for the inhibitory role of RA in Th17 differentiation including: (1) enhanced TGF-β-induced Foxp3 expression by RA counteracts Th17 differentiation (2) inhibition of the IL-6 receptor upregulation by RA which decreases Th17 differentiation (3) RA inhibits IL-23R expression and thus impairs the stabilization and further maturation of the Th17 phenotype. RA diverts T cells towards the Treg lineage and away from the Th17 lineage, through RAR-α activation [20].

This study had several limitations. One of the limitations was inability to stop taking all medications used by patient to exclude possible effects due to ethical considerations. Another limitation was budget constraints that would foreclose the possibility of further investigation on role of specific antigen, HSP60 and more Th17-derived cytokines. Finally, in this study there was no possibility of separating patients according to disease stage such as stable angina, unstable angina and myocardial infarction.

Conclusion

The present study is the first study made on humans with the aim of understanding the role of vitamin A in the process of atherosclerosis is the view of Th17 cells. Given the inflammatory properties of Th17 cells and inflammatory basis of atherosclerosis, the role of Th17 cells in pathogenesis of this disease is noticeable. As vitamin A supplementation via increase in levels of ATRA and 9-Cis RA in blood could reduce Th17 cells activity, it appears that supplementation with vitamin A may be slow rate of progression of atherosclerosis. Our results showed IL-17 and RORc gene expression in the patients reduced, therefore can be expected to be less severe disease in this population.

Acknowledgment

We wish to thank the Tehran University of Medical Sciences (TUMS) and Health Services grants with number of 89-01-27-10471. The authors thank all the patients for their participation in this study.

Conflict of interest

None of the authors had a conflict of interest to disclose.

Ancillary