SEARCH

SEARCH BY CITATION

Keywords:

  • An. culicifacies ;
  • Sibling species;
  • Odisha;
  • COII gene;
  • malaria

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Objective

To identify the Anopheles culicifacies sibling species complex and study their vectorial role in malaria endemic regions of Odisha.

Methods

Mosquitoes were collected from 6 malaria endemic districts using standard entomological collection methods. An. culicifacies sibling species were identified by multiplex polymerase chain reaction (PCR) using cytochrome oxidase subunit II (COII) region of mitochondrial DNA. Plasmodium falciparum (Pf) sporozoite rate and human blood fed percentage (HBF) were estimated by PCR using Pf- and human-specific primers. Sequencing and phylogenetic analysis were performed to confirm the type of sibling species of An. culicifacies found in Odisha.

Results

Multiplex PCR detected An. culicifacies sibling species A, B, C, D and E in the malaria endemic regions of Odisha. An. culicifacies E was detected for the first time in Odisha, which was further confirmed by molecular phylogenetics. Highest sporozoite rate and HBF percentage were observed in An. culicifacies E in comparison with other sibling species. An. culicifacies E collected from Nawarangapur, Nuapara and Keonjhar district showed high HBF percentage and sporozoite rates.

Conclusion

An. culicifacies B was the most abundant species, followed by An. culicifacies C and E. High sporozoite rate and HBF of An. culicifacies E indicated that it plays an important role in malaria transmission in Odisha. Appropriate control measures against An. culicifacies E at an early stage are needed to prevent further malaria transmission in Odisha.

Objectif

Identifier les espèces sœurs du complexe Anopheles culicifacies et étudier leur rôle de vecteur dans les régions de Odisha endémiques pour le paludisme.

Méthodes

Les moustiques ont été recueillis dans 6 districts endémiques pour le paludisme en utilisant les méthodes entomologiques standard de collecte. Des espèces sœurs d’An. culicifacies ont été identifiées par la réaction en chaîne de la polymérase (PCR) multiplex basée sur la région de la sous-unité II de l’ADN mitochondrial du cytochrome oxydase (COII). Le taux de sporozoaires de Plasmodium falciparum (Pf) et le pourcentage de sang humain consommé (SHC) ont été estimés par PCR en utilisant des amorces d’ADN spécifiques de Pf et humaines. Le séquençage et l'analyse phylogénétique ont été effectués pour confirmer le type d'espèces sœurs d’An. culicifacies à Odisha.

Résultats

La PCR multiplex a détecté les espèces sœurs d’An. culicifacies A, B, C, D et E dans les régions de Odisha endémiques pour le paludisme. An. culicifacies E a été détectée pour la première fois à Odisha, ce qui a été confirmé par la phylogénie moléculaire. Le taux le plus élevé de sporozoaires et le pourcentage de SHC le plus élevé ont été observé chez An. culicifacies E comparée aux autres espèces sœurs. An. culicifacies E, recueillie dans les districts de Nawarangapur, Nuapara et Keonjhar a révélé un pourcentage de SHC et un taux de sporozoaires élevés.

Conclusion

An. culicifacies B était l'espèce la plus abondante, suivie par An. culicifacies C et E. Un taux de sporozoaires et un pourcentage de SHC élevés d’An. culicifacies E ont indiqué qu'il joue un rôle important dans la transmission du paludisme à Odisha. Des mesures de contrôle appropriées contre An. culicifacies E à un stade précoce sont nécessaires pour prévenir plus de transmission de paludisme à Odisha.

Objetivo

Identificar el complejo críptico de especies de Anopheles culicifacies y estudiar su papel vectorial en las regiones endémicas para malaria de Odisha.

Métodos

Utilizando métodos entomológicos de recolección estándares se recogieron mosquitos en 6 distritos endémicos para malaria. Se identificaron las especies gemelas de An. culicifacies mediante una PCR multiplex utilizando la subunidad II de la citocromo oxidasa (COII) del ADN mitocondrial. La tasa de esporozoitos de Plasmodium falciparum (Pf) y el porcentaje alimentado con sangre humana (ASH) se calcularon mediante PCR utilizando cebadores específicos para Pf y humanos. Los análisis de secuenciación y filogenéticos se realizaron para confirmar el tipo de especies crípticas de An. culicifacies encontradas en Odisha.

Resultados

La PCR multiplex detectó las especies crípticas de An. culicifacies A, B, C, D y E en las regiones endémicas para malaria de Odisha. Se detectó An. culicifacies E por primera vez en Odisha, confirmado mediante filogenética molecular. La tasa de esporozoitos más alta y el porcentaje de ASH se observó para An. culicifacies E en comparación con otras especies crípticas. Los An. culicifacies E recolectados en los distritos de Nawarangapur, Nuapara y Keonjhar mostraron un porcentaje de ASH y una tasa de esporozoitos altos.

Conclusión

An. culicifacies B fue la especia más abundante, seguida por An. culicifacies C y E. La alta tasa de esporozoitos y de An. culicifacies ASH indicaba que jugaban un papel importante en la transmisión de malaria en Odisha. Las medidas de control apropiadas frente a An. culicifacies E en una etapa temprana son necesarias para prevenir una mayor transmisión de malaria en Odisha.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Malaria is highly endemic in Odisha, a coastal state in the eastern region of Indian Peninsula. It contributes the maximum disease burden to the nation. Odisha, which houses 3% of India's total population, contributes more than 23.7% of all malaria cases and 21.7% of malaria death cases of the whole country. Nearly 90% of reported malaria cases are falciparum malaria (National Vector Borne Disease Control Programme 2011–12). The situation in Odisha has worsened recently due to evolution of drug-resistant parasites and insecticide-resistant mosquitoes (Mohanty et al. 2009; Singh et al. 2010).

In India, there are 58 species of anophelines, 6 of which are primary malaria vectors: An. culicifacies, An. dirus, An. fluviatilis, An. minimus, An. sundaicus and An. stephensi (Christophers 1933; Rao 1984; Kumar et al. 2007). In addition, there are some secondary vectors of local importance, that is, An. philippinensis, An. nivipes, An. varuna, An. annularis and An. jeyporiensis (Dash et al. 2007; Dash et al. 1984). An. fluviatilis, An. culicifacies and An. annularis are the major vectors of malaria transmission in Odisha (Mohanty et al. 2007; Swain et al. 2009; Tripathy et al. 2010). An. culicifacies plays an important role in malaria transmission in Odisha state. An. culicifacies Giles belongs to subgenus Cellia and Series Myzomyia (Subbarao 1998). In India, An. culicifacies has been recorded from Kashmir to Tamil Nadu except in the Andaman and Nicobar Islands. Previous studies showed the presence of 5 sibling species of An. culicifacies in India: species A, B (Green & Miles 1980), C (Subbarao et al.1983), D (Vasantha et al.1991) and E (Kar et al. 1999). With evidence of chromosomal data by Kar et al. (1999), An. culicifacies E was first reported in Rameswaram Island of Tamil Nadu state. In Odisha, all but species E were found (Tripathy et al. 2010).

The host feeding habit of a mosquito is one of the important criteria to determine its vectorial potential. Among the populations of An. culicifacies s.l. sibling species, studies have shown difference in feeding preferences, resting behaviour, infection rate, HBI (human blood index) and sporozoite rate (Sharma 2006). The HBI of An. culicifacies A was about 5% and that of An. culicifacies B, C and D, about 2% (Tripathy et al. 2010). Sharma et al. (2006) showed that the HBI and sporozoite rate of An. culicifacies E were highest in India, that is, 80% and 20%, respectively (Barik et al. 2009). Therefore, it is important to determine its host preference, that is, HBI and sporozoite rate.

Success of vector control programmes relies on correct identification of malaria vectors (Swain et al. 2010). Taxonomic identification of the mosquito is very difficult owing to the overlapping morphological characteristics of closely related species. Difficulties arise when the mosquito body parts required for species identification are partially/fully damaged or lost during collection. Furthermore, identification of sibling species complex is cumbersome as only half-gravid mosquitoes are required for differentiating the polytene chromosome inversions or bandings (Harrison 1980; Subbarao 1998; Van Bortel et al. 2001). Molecular methods of identification, such as multiplex polymerase chain reaction (PCR) assays, have advantages over conventional identification methods (Das et al. 2012). Cytochrome oxidase II (COII) region from mitochondrial DNA allowed the development of a sibling species-specific primer, which combined with universal primers, led to a simple and sensitive PCR assay for identification of An. culicifacies sibling species (Goswami et al. 2006). The mitochondrial DNA (mtDNA) sequence is a valuable source of information, because the functional regions are highly conserved. The mtDNA is a well-established molecular marker used in a wide range of taxonomic, phylogenetic, population and evolutionary investigations in animals (Hillis 1996). COII gene is also valuable in estimating phylogenetic relationships (Huang & Wang 2001).

Odisha is divided into four distinct physiographical regions: northern plateau, central tableland, Eastern Ghat and coastal belt. Odisha is rich in biodiversity and has a tropical climate with high humidity favourable for malaria transmission by different vectors. Because An. culicifacies complex plays a major role in transmission of the malaria parasite, studies on the distribution of sibling species of An. culicifacies in Odisha are scarce and more are necessary to develop a control strategy to reduce the morbidity and mortality due to malaria. Thus, our objective was to explore the sibling species composition of An. culicifacies and their vectorial role in malaria endemic regions of Odisha.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Collection of mosquitoes

Mosquitoes were collected from six malaria endemic districts of Odisha: Mayurbhanj, Nawarangapur, Khurda, Nuapara, Boudh and Keonjhar (Figure 1). These districts were chosen from different physiographical divisions of Odisha according to their endemicity for malaria as evident from the Annual Parasite Index (API) (National Vector Borne Disease Control Programme 2011–12). Mayurbhanj and Keonjhar districts from northern plateau, Nawarangapur and Nuapara districts from Eastern Ghat, Khurda district from coastal belt and Boudh district from central tableland were selected for the study.

image

Figure 1. Map of India showing Odisha and the study areas in yellow colour.

Download figure to PowerPoint

Mosquito collection and morphological identification

Mosquitoes were collected with mechanical aspirators, mouth aspirators and CDC light traps in three seasons, summer (April–June), rainy (July–August) and winter (November–January) in 2009 and 2011. In every season, 6 night traps (3 in cattle sheds and 3 in human dwellings) were installed in three locations of the study area. Adult mosquitoes were collected from indoor and outdoor resting habitats from 6.00 a.m. to 9.00 a.m. and in the evening from 6.00 p.m. to 10.00 p.m. from both human dwellings and cattle sheds. A CDC light trap was installed from dusk to dawn (i.e. from 6 p.m. to 5 a.m.) (Table 1).

Table 1. Distribution, collection sites, breeding spots surveyed, and type of sibling species identified by multiplex PCR both from larval and adult collection
Study site (Longitude and Latitude)Topographic featureLarval breeding habitatNo of larvae collectedNo of adult emerged from larvaeSibling species identified by multiplex PCR from adult emerged from larvae (no of species)Adult collection siteNo of adult collectedSibling species identified by multiplex PCR from adult collection(no of species)
Nawarangapur (19023′N,82055′E)PlateauRice field, artisan aquifers, stream with vegetation17851A(2),B(22),C(11),E(16)House hold, cattle shed279A(29),B(60),C(55),D(46),E(89)
Keonjhar (210 38′N 850 35′E)HillySlow stream with vegetation, canal,11237B(21), C(9), E(7)House hold, cattle shed126B(45),C(26),D(28),E(27)
Mayurbhanj (21.9330N 86.7330E)Foot hillSlow stream with vegetation, irrigation canal, ponds10123B(23)House hold, cattle shed52B(52)
Nuapara (20°49′N 82° 32′E)HillySlow stream with vegetation, rice field, pits12241C(13), B(28)House hold, cattle shed146C(67), B(65),E(14)
Khurda (200 11′ N, 850 37′ E)Coastal tract, plainPonds, rice field, pits10939B(39)House hold, cattle shed70B(70)
Boudh (20.84′N; 84.32′E)HillyRice field, slow stream with vegetation, pits Dam, abandoned wells, pits7919B(19)House hold, cattle shed69B(54),D(15)
   701210210 742742

Anopheline larvae were collected from different breeding spots, mainly rice fields, man-made aquifers with vegetation, streams with vegetation, etc. using dipper, and larval density was calculated per dip. Collected larvae were then reared to adult stage in the laboratory.

Morphological identification of both wild caught and adult mosquitoes reared from larvae employed morphological keys by Christophers (1933) and Nagpal et al. (2005), and An. culicifacies were separated. After identification, individual specimens of Anculicifacies were dissected into two parts, the head–thoracic region and the abdominal region. Both body parts were kept separately in two microcentrifuge tubes and used for DNA isolation.

DNA isolation

Genomic DNA was isolated from both head–thoracic region and abdominal region of individual mosquitoes separately by phenol–chloroform method (Coen et al. 1982).

PCR amplification of the allele-specific D3 region

Morphologically identified An. culicifacies s.l. were initially amplified using primer from the D3 region of the 28S rDNA (Singh et al. 2004) with minor modifications. To check the amplification, 10 μl of the PCR product was subjected to electrophoresis in an agarose gel with 1× TBE buffer and stained with ethidium bromide.

Sibling species-specific PCR for An. culicifacies

The An. culicifacies specimens identified as A/D or B/C/E by D3 PCR described by Singh et al. (2004) were subjected to sibling species-specific PCR (Goswami et al. 2006). Species belonging to A/D were subjected to AD-PCR to differentiate A from D, and species belonging to B/C/E are subjected to BCE-multiplex PCR assay to differentiate between B, C and E from each other. The PCR for A/D PCR comprised of ADF, ADR and DF primers each at 20 pmol, 200 μm dNTP, 0.5 mm MgCl2, 1× PCR buffer and 1 unit of Taq DNA polymerase (Genei, Bangalore, India). For B/C/E PCR, the BCR, BCEF, CR and ER primers were used each of 20 pmol per reaction. The rest of the PCR mix was same. The cycling condition was initial denaturation at 95°C for 5 min followed by 40 cycles each of denaturation at 95°C for 40 s, annealing at 48°C for 45 s and extension at 72°C for 1 min, followed by a final extension at 72°C for 7 min.

Multiplex PCR for human blood fed percentage and sporozoite detection

The isolated DNA from both the body parts (head–thoracic region for sporozoite and abdominal region for HBF) was subjected to one multiplex PCR assay to detect the presence of Plasmodium falciparum and human blood in An. culicifacies mosquitoes (Mohanty et al. 2007). Those samples that tested positive for Pf in the multiplex PCR were subjected to Pf-specific PCR to confirm the presence of Plasmodium falciparum. The PCR was performed using only Pf primers with the DNA of head–thoracic part of the same mosquito for confirmation for the presence of sporozoite. The sporozoite rate was calculated as percentage of mosquitoes positive for Pf, and human blood fed (HBF) was calculated as percentage of mosquitoes that had taken human blood. DNA was amplified by the Pf forward primer 5′ AGCGTGATGAGATTGAAGTCAG 3′ and Pf reverse primer 5′ CCCTAAACCCTCTAATCATTGTC 3′ for the detection of sporozoite. For human blood detection, the primers used were HUM forward 5′CGAGAGTTCTCTGGAAGAATTGA3′ and HUM reverse 5′TGATAGCCTGGAAGTGACAAAAT3′. The PCR condition was as described by Mohanty et al. (2007). Known sporozoite and human blood-positive An. culicifacies obtained earlier from Odisha was used as positive control in the PCR. To check the amplification, 10 μl of the PCR product was subjected to electrophoresis in an agarose gel with TBE buffer and stained with ethidium bromide.

Sequencing reaction

The PCR product (259 bp) generated using BCEF and BCR primer of COII gene was excised from gel, purified using QIAquick Spin Column (Qiagen, Hilden, Germany), and a sequencing PCR was performed. For each sequencing reaction, 50 ng of purified PCR product was mixed with a reaction mixture containing 2.5× sequencing buffer, 5× big dye terminator and 20 μM of either primer (BCEF/BCR) in two separate sets of reaction. Cycle sequencing parameters used were as follows: 96°C for 1 min followed by 25 cycles of 96°C for 10 s, 50°C for 5 s and 60°C for 4 min. The PCR product was purified by EDTA/ethanol precipitation. The dried pellet was resuspended in 10 μl of formamide and sequenced in a 16 capillary (36 cm) automated DNA sequencer (Applied Biosystems, Foster City, CA, USA) using performance optimised polymer 7 following the manufacturer's instructions. The sequences generated were submitted to GenBank and used for phylogenetic analysis with other available An. culicifacies sibling species sequences in GenBank.

Phylogenetic analysis

The nucleotide sequences obtained after sequencing were edited and analysed by sequencing analysis software (Applied Biosystems, Foster City, CA, USA). The An. culicifacies sequences generated have been deposited in GenBank with accession nos. JX 131317, JX 131318 (Anculicifacies B), JX131315, JX 131316 (An.culicifacies C) and JX 131308, JX131309, JX 131310, JX131311, JX 131312, JX131313 and JX 131314 (An. culicifacies E) (Table 4). Multiple sequence alignments and phylogenetic analysis were performed using partial COII gene sequences of the 10 representative An. culicifacies obtained from Odisha and An. culicifacies sequences from diverse geographical locations (Table 4) by Mega 5 software (Arizona State University, Tempe, AZ, USA) (Tamura et al. 2011). The phylogenetic tree was constructed using the maximum-likelihood method using Tamura–Nei model of Mega 5 software. The robustness of each node was estimated using 1000 bootstrap replications under the nearest neighbour interchange procedure with input genetic distance determined under the maximum-likelihood substitution model. Aedes aegypti was chosen as the outgroup.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Morphological identification of mosquitoes

A total of 2660 anopheline mosquitoes collected during 2009–2011, of which 1880 were collected by light traps and 780 by hand catch. 687 An. culicifacies were collected by hand catch, and 55 were collected by light trap. 742 mosquitoes were identified as Anculicifacies by taxonomical methods (Figure 2). Of 701 larvae collected, 210 were identified as An. culicifacies (Table 1). The number of Anculicifacies collected was largest in winter followed by rainy and summer seasons (Table 2). The largest numbers of An. culicifacies mosquitoes (N) and larvae-reared mosquitoes (n) were collected from Nawarangapur district (N = 279, n = 51) followed by Keonjhar (N = 126, n = 37), Nuapara (N = 146, n = 41), Khurda (N = 70, n = 39), Boudh (N = 69, n = 19) and Mayurbhanj (N = 52, n = 23) districts (Table 1). Adult collection was more common from cattle sheds than inside human dwellings.

Table 2. Distribution of sibling species of Anopheles culicifacies in three different seasons of Odisha with their sporozoite rate
Sibling speciesWinter seasonSummer seasonRainy season
NoNo of mosquito positive for sporozoite (%)NoNo of mosquito positive for sporozoite (%)NoNo of mosquito positive for sporozoite (%)
A172 (11.7)4081 (12.5)
B2130370980
C762 (2.6)250451 (2.2)
D536 (11.3)91 (11.1)272 (7.4)
E9419 (20.2)81 (12.5)284 (14.2)
Total453298322068
image

Figure 2. Graph showing the contribution of different mosquito collection methods used in the study.

Download figure to PowerPoint

Amplification of the allele-specific D3 region

The ASPCR amplified Anculicifacies species that demonstrated the product size, that is, A/D 313 + 400 bp and B/C/E showed 133 + 400 bp product. Of 742 Anculicifacies mosquitoes collected, 118 belonged to A/D sibling species and 624 to the B/C/E category. Of 210 adults reared from larvae, 2 belonged to A/D sibling species and 208 to the B/C/E category.

Sibling species-specific PCR

The AD-PCR assay amplified An. culicifacies sibling species A that demonstrate the product size, that is, 359 bp and for sibling species D - 166 + 359 bp (Figure 3). The BCE-PCR assay demonstrated the product size for species B - 248 bp, species C- 95 + 248 bp, species E - 178 + 248 bp. Of 742 Anculicifacies mosquitoes collected, 348 were identified as An. culicifacies B, 146 as An. culicifacies C, 130 as An. culicifacies E, 89 as An. culicifacies D and 29 as An. culicifacies A. An. culicifacies B was the most abundantly distributed sibling species in Khurda (n = 70) and Nuapara (n = 67) district, followed by Nawarangapur (60), Boudh (54), Mayurbhanj (52) and Keonjhar (45). Species C was detected in Nuapara (n = 65), Nawarangapur (n = 55) and Keonjhar (n = 26) districts. The highest numbers of An. culicifacies E (n = 89) were found from Nawarangapur district followed by Keonjhar (n = 27) and Nuapara district (n = 14). An. culicifacies E was not detected in Mayurbhanj, Khurda and Boudh. The maximum number of sibling species D (n = 46) was from Nawarangapur district followed by Keonjhar (28) and Boudh (15). Sibling species A was only found in Nawarangapur district (n = 29). Of all 210 adults reared from larvae, 152 were identified as An. culicifacies B, 33 as An. culicifacies C, 23 as An. culicifacies E and 2 as An. culicifacies A. Species D was not detected in larval collection (Table 3).

Table 3. Sibling species composition, no of visually identified blood fed mosquitoes, no of visually identified human blood fed mosquitoes which amplified by PCR, HBF percentage and sporozoite rate of Anopheles culicifacies sibling species collected from different areas of Odisha
AreaTotal no of mosquitoes collectedSibling species identifiedNo of visually identified blood fed mosquitoesNo of visually identified human blood fed mosquitoes which amplified by PCRNo of mosquito positive for human blood (HBF) (%)No of mosquito positive for sporozoite (Sporozoite rate) (%)
HGFFHGFF
  1. HG-half gravid; FF-fully-fed.

Nawarangapur279A(29)912326 (20.6)3 (10.3)
B(60)1611101 (3.1)0
C(55)1420235 (9.0)1 (1.8)
D(46)17219717 (36.9)5 (10.8)
E(89)2738142238 (42.6)17 (19.1)
Keonjhar126A(0)000000
B(45)715011 (2.2)0
C(26)98101 (3.8)0
D(28)147359 (32.1)4 (14.2)
E(27)10136815 (55.5)5 (18.5)
Mayurbhanj52A(0)000000
B(52)1217011 (1.9)0
C(0)000000
D(0)000000
E(0)000000
Nuapara146A(0)000000
B(67)1816022 (2.9)0
C(65)1922112 (4.8)2 (7.6)
D(0)000000
E(14)57246 (42.8)2 (14.2)
Khurda70A(0)000000
B(70)2224112 (2.8)0
C(0)000000
D(0)000000
E(0)00000 
A(0)000000
Boudh69B(54)813011 (1.8)0
C(0)000000
D(15)49326 (40)0
E(0)000000
Total742742211253466011339
image

Figure 3. Ethidium bromide stained agarose gel of multiplex BCE-PCR assay for the differentiation of sibling species B, C and E of An. culicifacies collected from different areas of Odisha. M represents 100-bp ladder, lane 1 and 2 denote species B, lane 3 and 4 denote species C, and lane 5, 6 and 7 denote species E.

Download figure to PowerPoint

HBF and sporozoite rate analysis

Multiplex PCR of abdominal and head–thoracic region for HBF and sporozoite rate demonstrated product of 519 bp in 113 (15%) and 205 bp in 41 (5.5%) of 742 field collected An. culicifacies (Figure 4). Four hundred and sixty-four An. culicifacies species had a visually detected blood meal, of which 113 tested positive for human blood by PCR. Of 130 An. culicifacies E, 24 (18.4%) tested positive for sporozoite and 59 (45%) for human blood. The highest HBF (42.6%) and sporozoite rate (19.1%) were observed in An. culicifacies E mosquitoes from Nawarangapur. An. culicifacies E from Nuapara district showed 14.2 sporozoite rate and 42.8% HBF. Sporozoite was not found in sibling species B. Of 89 An. culicifacies D, 12% tested positive for sporozoite and 35% for human blood. Of the total collection of sibling species A (n = 29), 20.6% were positive for human blood and 10.3% for sporozoite. Of 146 An. culicifacies C, 5.4% were positive for human blood and 2% for sporozoite. The sporozoite rate and HBF percentage were higher for all An. culicifacies species in winter than in the rainy season and summer (Tables 2 and 3).

image

Figure 4. Ethidium bromide stained agarose gel of multiplex PCR assay of An. culicifacies collected from Odisha showing band for Plasmodium falciparum sporozoite at 205 bp and human blood fed at 519 bp. M represents 100-bp ladder. Lane 3 and 7 are showing positive for both human blood and sporozoite, and lane 1, 2, 4, 5, 6 and 8 are showing positive for human blood.

Download figure to PowerPoint

Phylogenetic analysis

Phylogenetic analyses of An. culicifacies sequences from Odisha and other diverse geographical areas revealed that An. culicifacies were subdivided into four groups: An. culicifacies E, An. culicifacies D and An. culicifacies B and An. culicifacies C (Figure 5). Overall, high interspecific divergences were observed in the COII region of the An. culicifacies sibling species. The phylogenetic tree was also generated using D3 region, which further confirmed the presence of An. culicifacies E in Odisha (Figure S1).

image

Figure 5. Phylogenetic tree of COII gene of An. culicifacies from Odisha with other GenBank retrieved sequences showing the presence of An. culicifacies E in Odisha. The tree is based on COII gene sequence of An. culicifacies generated using maximum-likelihood method using the Tamura–Nei model of Mega 5 software showed that the An. culicifacies from Odisha were clustered into 4 groups: An. culicifacies E, D, B and C. COII gene sequence of Ae. aegypti was taken as outgroup. Numbers to the left of nodes indicate bootstrap values (1000 replicates). Bootstrap values of less than 50 are not shown. Numbers in parentheses are the GenBank accession numbers. Solid diamonds indicate An. culicifacies sequenced in this study. The details of the sequences in the figure are described in Table 4.

Download figure to PowerPoint

Table 4. Sequences of the COII gene region of mitochondria of Anopheles culicifacies obtained from Odisha and other regions analyzed in this study
TaxonAccession No.LocusCollection site
An. culicifacies E HQ377227 COIIIndia
An. culicifacies E AJ534646 COIIIndia
An. culicifacies E HQ377228 COIIIndia
An. culicifacies E AY879311 COIISriLanka
An. culicifacies E JX131308 COIIOdisha, India
An. culicifacies E JX131309 COIIOdisha, India
An. culicifacies E JX131310 COIIOdisha, India
An. culicifacies E JX131312 COIIOdisha, India
An. culicifacies E JX131313 COIIOdisha, India
An. culicifacies E JX131314 COIIOdisha, India
An. culicifacies D HQ377219 COIIIndia
An. culicifacies D HQ377220 COIIIndia
An. culicifacies C HQ377225 COIIIndia
An. culicifacies C HQ377224 COIIIndia
An. culicifacies C JX131315 COIIOdisha, India
An. culicifacies C JX131316 COIIOdisha, India
An. culicifacies B HQ377221 COIIIndia
An. culicifacies B HQ377223 COIIIndia
An. culicifacies B JX131317 COIIOdisha, India
An. culicifacies B JX131318 COIIOdisha, India
Ae. aegypti DQ181507 COIIPureto Rico

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

In this study, An. culicifacies mosquitoes collected from the five selected areas representing four physio-geographically different regions of Odisha belonged to A, B, C, D and E. B was the most abundant species detected followed by C, E, D and A. An. culicifacies E was identified for the first time in this study and was confirmed by molecular methods. This species is a highly competent vector for malaria globally and in India (Subbarao et al. 1980, 1988; Jude et al. 2010). Our study revealed a temporal pattern of distribution of An. culicifacies sibling species in Odisha. Most mosquitoes were obtained in winter, followed by the rainy season and summer in most of the districts surveyed. The largest numbers of An. culicifacies E were collected from Nawarangapur and Keonjhar district in winter, which indicated more malaria transmission after the monsoon (Figure 6).

image

Figure 6. Graph showing the relative distribution of An. culicifacies sibling species along with their sporozoite rate in three different seasons of Odisha.

Download figure to PowerPoint

The breeding spots of An. culicifacies were mainly rice fields, artisan aquifers with vegetation, streams with vegetation, etc. More detailed analyses revealed that An. culicifacies E were mainly breeding in rice fields and man-made aquifers. In Nawarangapur district, maximum An. culicifacies E were obtained because the district had most rice fields and man-made aquifers in comparison with other districts. In this district, the groundwater level was very high with poor drainage, which resulted in the formation of small aquifers in the rice fields from where the water flows regularly. Such water-logged rice fields were very common in Nawarangapur district, rendering the district one of the high-risk areas for malaria owing to the abundance of An. culicifacies. An. culicifacies E has adapted to breed in diverse types of habitats such as brackish water in Sri Lanka like An. culicifacies B (Jude et al. 2010). Its adaptability has enabled An. culicifacies E to invade many areas, which were so far free from it; this is a matter of serious concern for vector control strategies (Jude et al. 2010).

Human blood index and presence of sporozoite are two essential criteria that were analysed in the study for vectorial role analysis of An. culicifacies sibling species complex. In this study, An. culicifacies E showed maximum positivity for sporozoite rate and HBF, followed by D, A and C (Table 3) in all the districts surveyed. Previous studies by Rao (1984) suggest that An. culicifacies s.l. is predominantly zoophilic in nature and feeds on man when there is low population of cattle. The high HBF percentage of An. culicifacies observed in this study implies a change in host preference. Entomological findings of the study suggest that An. culicifacies E is an important vector of malaria in Odisha. Furthermore, sporozoite rate and HBF percentage in An. culicifacies were higher in winter season than rainy and summer seasons in the areas surveyed during 2009–2011 (Figures 6 and 7). Thus, temporal and seasonal pattern of malaria transmission by An. culicifacies was observed in the study, which indicated that winter season was the high-risk period for malaria outbreaks.

image

Figure 7. Graph showing the relative proportion of An. culicifacies sibling species from different districts of Odisha along with their sporozoite rate and human blood fed percentage (HBF).

Download figure to PowerPoint

Molecular phylogenetic analyses revealed the distribution of all the sibling species of An. culicifacies, A, B, C, D and E in Odisha. Furthermore, the analyses confirmed the presence of An. culicifacies E for the first time in Odisha. The phylogenetic tree showed high interspecific divergences among An. culicifacies sibling species, which indicated lack of cobreeding among interspecies. This implies that there will be no cross-breeding between the sibling species, which indicates low evolutionary divergence between them.

Our study provides crucial information on An. culicifacies sibling species distribution in the malaria endemic regions of Odisha, which will assist in developing strategic control measures against An. culicifacies. First-time detection of An. culicifacies E in different regions of Odisha is a very important outcome. The temporal pattern of distribution of sibling species of An. culicifacies E in Nawarangapur, Keonjhar and Nuapara districts may be one of the reasons for high malaria incidence in these districts especially in winter. Appropriate control measures against An. culicifacies E at an early stage are necessary to prevent further malaria transmission in Odisha.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

We are grateful to Director NRHM, Dr. S. Swain, Mrs. M. Karmakar and Mr. S. Mishra for their constant help during the preparation of the manuscript. We thank Mr. S. Biswal, Mr B. Pradhan and Mr C. S. Tripathy for technical help. We are very grateful to Dr. B. C. Das, Dr. G. Das and Dr. S. Das for their immense support during the study. This work was supported by the extramural funds of National Rural Health Mission, Government of India.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Barik TK, Sahu B & Swain V (2009) A review on Anopheles culicifacies: from bionomics to control with special reference to Indian subcontinent. Acta Tropica 109, 8797.
  • Christophers SR (1933) The Fauna of British India. Diptera, Vol-IV. Family-Culicidae. Tribe-Anophelini. Today and Tomorrow's Printers and Publishers, New Delhi.
  • Coen E, Strachan T & Dover G (1982) Dynamics of concerted evolution of ribosomal DNA and histone gene families in the melanogaster species subgroup of Drosophila. Journal of Molecular Biology 158, 1735.
  • Das B, Swain S, Patra A et al. (2012) Development and evaluation of a single-step multiplex PCR to differentiate the aquatic stages of morphologically similar Aedes (subgenus: Stegomyia) species. Tropical Medicine & International Health 17, 235243.
  • Dash AP, Behura BK & Roy JR (1984) On the distribution of Anopheline mosquitoes in Odisha. Indian Journal Zoological Society of India 36, 114.
  • Dash AP, Adak T, Raghavendra K & Singh OP (2007) The biology and control of malaria vectors in India. Current Science 92, 15711578.
  • Goswami G, Singh OP, Nanda N, Raghavendra K, Gakhar SK & Subbarao SK (2006) Identification of all members of the Anopheles culicifacies complex using allele-specific polymerase chain reaction assays. American Journal of Tropical Medicine & Hygiene. 75, 454460.
  • Green CA & Miles SJ (1980) Chromosomal evidence for sibling species of the malaria vector Anopheles culicifacies Giles. Journal of Tropical Medicine & Hygiene 83, 7578.
  • Harrison BA (1980) Medical entomology studies - XIII. The Myzomyia Series of Anopheles (Cellia) in Thailand, with emphasis on intra-interspecific variations (Diptera: Culicidae). Contributions of the American Entomological Institute (Ann Arbor) 17, 1195.
  • Hillis DM (1996) Inferring complex phylogenies. Nature 383, 130131.
  • Huang ZH & Wang JF (2001) Cloning and sequencing of cytochrome c oxidase II (COII) gene of three species of mosquitoes. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 19, 9092.
  • Jude PJ, Dharshini S, Vinobaba M, Surendran SN & Ramasamy R (2010) Anopheles culicifacies breeding in brackish waters in Sri Lanka and implications for malaria control. Malaria Journal 21(9), 106.
  • Kar I, Subbarao SK, Eapen A et al. (1999) Evidence for a new malaria vector species, species E, within the Anopheles culicifacies complex (Diptera: Culicidae). Journal Medical Entomology 36, 595600.
  • Kumar A, Valecha N, Jain T & Dash AP (2007) Burden of malaria in India: retrospective and prospective view. American Journal of Tropical Medicine & Hygiene 77, 6978.
  • Mohanty A, Kar P, Mishra K et al. (2007) Multiplex PCR assay for the detection of Anopheles fluviatilis species complex, human host preference and Plasmodium falciparum sporozoite presence, using a unique mosquito processing method. American Journal of Tropical Medicine & Hygiene 76, 837843.
  • Mohanty A, Swain S, Singh DV, Mahapatra N, Kar SK & Hazra RK (2009) A unique methodology for detecting the spread of chloroquine-resistant strains of Plasmodium falciparum, in previously unreported areas, by analyzing anophelines of malaria endemic zones of Orissa, India. Infection Genetics Evolution 9, 462467.
  • Nagpal BN, Srivastava A, Saxena R, Ansari MA, Dash AP & Das SC (2005). Pictorial Identification Key for Indian Anophelines. Malaria Research Centre (ICMR), New Delhi.
  • National Vector Borne Disease Control Programme. 2011-12. Directorate of Health Services, Odisha, Department of Health & Family Welfare, Govt. of Odisha.
  • Rao TR (1984). The Anophelines of India Delhi: Malaria Research Centre. Indian Council of Medical Research, New Delhi.
  • Sharma VP (2006). Malaria: Genetics and Evolutionary Aspects. Springer, New York, NY, USA, pp. 147167.
  • Sharma SK, Tyagi PK, Padhan K et al. (2006) Epidemiology of malaria transmission in forest and plain ecotype villages in Sundargarh district, Orissa, India. Transactions Royal Society of Tropical Medicine & Hygiene 100, 917925.
  • Singh OP, Goswami G, Nanda N, Raghavendra K, Chandra D & Subbarao SK (2004) An allele specific polymerase chain reaction assay for the differentiation of members of the Anopheles culicifacies Complex. Journal of Biosciences 29, 275280.
  • Singh OP, Dykes CL, Das MK et al. (2010) Presence of two alternative kdr-like mutations, L1014F and L1014S, and a novel mutation, V1010L, in the voltage gated Na+ channel of Anopheles culicifacies from Orissa, India. Malaria Journal 28(9), 146.
  • Subbarao SK (1998) Anopheline species complexes in South East Asia. Technical publication, serial no.18, World Health Organization, Regional Office for South East Asia, New Delhi.
  • Subbarao SK, Adak T & Sharma VP (1980) Anopheles culicifacies: sibling species distribution and vector incrimination studies. Journal Communicable Diseases 12, 102104.
  • Subbarao SK, Vasantha K, Adak T & Sharma VP (1983) Anopheles culicifacies complex: evidence for a new sibling species, species C. Annals of Entomological Society America 76, 985986.
  • Subbarao SK, Vasantha K, Raghavendra K, Sharma VP & Sharma GK (1988) Anopheles culicifacies: siblings species composition and its relationship to malaria incidence. Journal of American Mosquito Control Association 4, 2933.
  • Swain S, Mohanty A, Mahapatra N et al. (2009) The development and evaluation of a single step multiplex PCR for simultaneous detection of Anopheles annularis group mosquitoes, human host preference and Plasmodium falciparum sporozoite presence. Transactions Royal Society of Tropical Medicine & Hygiene 103, 11461152.
  • Swain S, Mohanty A, Tripathy HK, Mahapatra N, Kar SK & Hazra RK (2010) Molecular identification and phylogeny of Myzomyia and Neocellia series of Anopheles subgenus Cellia (Diptera: Culicidae). Infection Genetics Evolution 10, 931939.
  • Tamura K, Peterson D, Peterson N, Stecher G, Nei M & Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology & Evolution 28, 27312739.
  • Tripathy A, Samanta L, Das S et al. (2010) Distribution of sibling species of Anopheles culicifacies s.l. and Anopheles fluviatilis s.l. and their vectorial capacity in eight different malaria endemic districts of Odisha, India. Memórias do Instituto Oswaldo Cruz 105, 981987.
  • Van Bortel W, Harbach RE, Trung HD, Roelants P, Backeljau T & Coosemans M (2001) Confirmation of Anopheles varuna in Vietnam, previously misidentified and mistargeted as the malaria vector Anopheles minimus. American Journal of Tropical Medicine and Hygiene 65, 729732.
  • Vasantha K, Subbarao SK & Sharma VP (1991) Anopheles culicifacies complex: population cytogenetic evidence for species D (Diptera: Culicidae). Annals of Entomological Society America 8, 531535.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
tmi12112-sup-0001-FigureS1.jpgimage/jpg185KFigure S1. Phylogenetic tree of D3 region of An. culicifacies from Odisha with other GenBank retrieved sequences showing the presence of An. culicifacies E in Odisha.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.