SEARCH

SEARCH BY CITATION

Keywords:

  • antioxidant;
  • ATPase;
  • DNA and RNA helicase;
  • Oryza sativa ;
  • salinity stress;
  • SUV3;
  • unwinding

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

To overcome the salinity-induced loss of crop yield, a salinity-tolerant trait is required. The SUV3 helicase is involved in the regulation of RNA surveillance and turnover in mitochondria, but the helicase activity of plant SUV3 and its role in abiotic stress tolerance have not been reported so far. Here we report that the Oryza sativa (rice) SUV3 protein exhibits DNA and RNA helicase, and ATPase activities. Furthermore, we report that SUV3 is induced in rice seedlings in response to high levels of salt. Its expression, driven by a constitutive cauliflower mosaic virus 35S promoter in IR64 transgenic rice plants, confers salinity tolerance. The T1 and T2 sense transgenic lines showed tolerance to high salinity and fully matured without any loss in yields. The T2 transgenic lines also showed tolerance to drought stress. These results suggest that the introduced trait is functional and stable in transgenic rice plants. The rice SUV3 sense transgenic lines showed lesser lipid peroxidation, electrolyte leakage and H2O2 production, along with higher activities of antioxidant enzymes under salinity stress, as compared with wild type, vector control and antisense transgenic lines. These results suggest the existence of an efficient antioxidant defence system to cope with salinity-induced oxidative damage. Overall, this study reports that plant SUV3 exhibits DNA and RNA helicase and ATPase activities, and provides direct evidence of its function in imparting salinity stress tolerance without yield loss. The possible mechanism could be that OsSUV3 helicase functions in salinity stress tolerance by improving photosynthesis and antioxidant machinery in transgenic rice.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Abiotic stresses represent the most limiting environmental factors affecting agricultural productivity. To overcome these limitations and to improve production in order to feed the ever-increasing population, it is imperative to develop crop cultivars that are stress tolerant. Soil salinity and drought stress are increasing threats for agriculture; therefore, it is necessary to develop stress-tolerant varieties (Mahajan and Tuteja, 2005; Tuteja, 2007a,b). Many genes including helicases are known to be involved in abiotic stress tolerance. Helicases are ubiquitous enzymes that catalyse the unwinding of energetically stable duplex DNA or RNA secondary structures, and thereby play an important role in almost all DNA and/or RNA metabolic processes, including replication, DNA repair, recombination, transcription, pre-mRNA processing, RNA degradation and translation (Tuteja, 2003; Tuteja and Tuteja, 2004; Abdelhaleem, 2010). Based on several conserved amino acid sequence motifs present in helicases, they are classified into five different superfamilies (SFs), designated SF1–SF5 (Gorbalenya and Koonin, 1993). SF1 and SF2 are the largest, and their members contain nine conserved motifs (Q, I. Ia, Ib, II, III, IV, V and VI) that constitute the helicase core region (approximately 350–700 amino acids). Based on variations in motif II, the SF2 family of helicases is further divided into subgroups: DEAD box, DEAH box, and Ski2-like proteins, generally referred to as DExD/H box helicases (Tuteja and Tuteja, 2006; Umate et al., 2010). All these helicase conserved motifs are located in two different domains: domain 1 contains motifs Q–III, whereas domain 2 contains motifs IV–VI (Bleichert and Baserga, 2007). The Q motif is present upstream of motif I, and consists of an invariant glutamine (Q) in a sequence of nine amino acids, and is therefore given the name ‘Q motif’. The functions of these motifs have been described earlier (Tuteja and Tuteja, 2006; Bleichert and Baserga, 2007). Helicases are also involved in responses to abiotic stress (Vashisht and Tuteja, 2006; Owttrim, 2013). Earlier, a Pisum sativum (pea) helicase (PDH45) was reported to be induced by salinity stress, and was shown to be involved in salinity tolerance in transgenic Nicotiana tabacum (tobacco; Sanan-Mishra et al., 2005) and Oryza sativa (rice; Amin et al., 2012; Sahoo et al., 2012).

The SUV3 (suppressor of Var 3) gene encodes an NTP-dependent DNA/RNA helicase that belongs to the DExH/D (Ski2p) superfamily. The SUV3 helicase was originally identified in Saccharomyces cerevisiae (yeast) as a dominant suppressor allele, SUV3–1, that suppressed three dodecamer deletion phenotypes on the VAR1 gene (Butow et al., 1989). The product of the nuclear-encoded SUV3 gene in S. cerevisiae was reported to be localized in mitochondria, and is a subunit of the degradosome complex that regulates RNA surveillance and turnover (Dziembowski et al., 2003; Malecki et al., 2007). In humans, hSuv3p has been shown mainly in the mitochondrial matrix, and is essential for the degradation of mature mtRNAs (Szczesny et al., 2010). hSuv3p unwinds double-stranded DNA, double-stranded RNA and RNA-DNA heteroduplexes (Shu et al., 2004). Yeast SUV3 was reported to be involved in mtDNA replication, maintenance of mtDNA stability and RNA turnover (Guo et al., 2011). To date, plant SUV3 has not been characterized in detail. Gagliardia et al. (1999) have reported that nuclear-encoded Arabidopsis thaliana SUV3 (AtSUV3) is localized in Arabidopsis mitochondria, and possesses ATPase activity. Here, we report on the detailed characterization of SUV3 from rice. Our results show that the rice SUV3 (OsSUV3) exhibits ATPase, RNA and DNA helicase activities, and its overexpression in IR64 rice enhances salinity stress tolerance by improving the antioxidant machinery of the transgenic rice.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Identification and sequence analysis of OsSUV3

OsSUV3 encodes an NTP-dependent RNA/DNA helicase, which is related to the DExH/D (Ski2p) superfamily. An alignment of the complete amino-acid sequence of OsSUV3 orthologue with SUV3 from A. thaliana, Homo sapiens and S. cerevisiae was performed using clustal w2 (http://www.ebi.ac.uk). OsSUV3 demonstrates approximately 32–61% identity with its counterparts from S. cerevisiae, H. sapiens and A. thaliana (Figure S1). OsSUV3 contains all the characteristic conserved helicase motifs from I, Ia, Ib, II, III, IV, V and VI (Figure S1). Although there are significant differences in the sequences of these motifs from other SF2 helicases, some important residues are found to be conserved among the whole family. For example, the OsSUV3 does not contain the Q motif, and instead of PTRELA (motif Ia), DEAD (motif II) and SAT (motif III), it has PLRLLA, DEIQ and GDP, respectively. The analysis of its amino acid sequence further indicated that the core region is highly conserved and that OsSUV3 is smaller in size, compared with its counterparts from S. cerevisiae and H. sapiens (Figure S1). This difference results from shorter N- and C–terminal regions in OsSUV3 and AtSUV3, compared with its human and yeast counterparts (Figure S1). Further detailed analysis of the protein sequence at Expasy (http://prosite.expasy.org) indicated that both OsSUV3 and AtSUV3 contain two distinct domains: a helicase ATP-binding domain and a helicase C–terminal domain (Figure S2a,b).

Molecular modelling of OsSUV3 structure and secondary structure analysis

For structural modelling, the sequence of full-length OsSUV3 was submitted to the Swiss Model homology-modelling server (http://swissmodel.expasy.org) (Arnold et al., 2006). The model that was built using H. sapiens SUV3 as the template was studied in detail (Jedrzejczak et al., 2011). OsSUV3 primary sequence residues 59–541 showed approximately 40% sequence identity with the SUV3 helicase from H. sapiens (Jedrzejczak et al., 2011). The structural modelling of OsSUV3 was therefore performed using the known crystal structure of this homologue as the template (Protein Data Bank (PDB) number 3rc8A at http://www.rcsb.org/pdb). The ribbon diagram of the template is shown in Figure 1a, and the predicted structure of OsSUV3 is shown in Figure 1b. When the modelled structure of OsSUV3 and the template were superimposed, it is clear that these structures superimpose partially (Figure 1c). Molecular graphic images were produced using the UCSF Chimera package (http://www.cgl.ucsf.edu/chimera) from the Resource for Biocomputing, Visualization and Informatics at the University of California, San Francisco (supported by NIH P41 RR-01081; Pettersen et al., 2004). The PDB file of the modelled OsSUV3 protein was subjected to the PDBsum server (http://www.ebi.ac.uk/thornton-srv/databases/pdbsum/Generate.html) for further secondary structure analysis (Laskowski, 2009). The predicted secondary structure of the OsSUV3 protein shows the presence of four sheets, three β–α–β units, two β hairpins, one β bulge, 18 strands, 22 helices, 27 helix–helix interactions, 35 β turns and three γ turns (Figure S2c).

image

Figure 1. Structure modelling, purification and enzymatic activities of the OsSUV3 protein. (a–c) Structure modelling: (a) template; (b) OsSUV3; (c) superimposed image. (d,e) Purification of OsSUV3. (d) Coomassie blue-stained gel of purified OsSUV3: lane 1, molecular weight marker; lane 2, purified OsSUV3 (200 ng). (e) Western blot of purified OsSUV3: lane 1, protein molecular weight marker; lane 2, purified OsSUV3. (f–h) Enzymatic activities of OsSUV3. (f) ATPase activity: lane 1, control reaction without enzyme; lane 2, reaction with OsSUV3 (10 ng). (g) DNA helicase activity. Lane 1, control reaction without enzyme; lane 2, boiled substrate; lane 3, reaction with OsSUV3 (10 ng); S, substrate; UD is unwound DNA. (h) RNA helicase activity: lane 1, control reaction without enzyme; lane 2, reaction with OsSUV3 (10 ng); lane 3, heat-denatured substrate; S, substrate; UR is unwound RNA.

Download figure to PowerPoint

Purification and characterization of OsSUV3

The OsSUV3 cDNA was expressed in Escherichia coli, adding a six-histidine tag at its C terminus. The approximately 67–kDa OsSUV3 protein was purified to near homogeneity and confirmed by SDS-PAGE analysis (Figure 1d, lane 2). The identity of the purified protein was confirmed by western blot analysis using anti-His antibody (Figure 1e, lane 2). This purified preparation was used for all of the enzyme assays. The ssDNA-dependent ATPase activity of OsSUV3 protein was checked using standard assay conditions, as described in the Experimental procedures, in the presence of traces of radiolabelled ATP with 1 mm cold ATP and purified enzyme (10 ng). OsSUV3 protein (10 ng) exhibits ATPase (Figure 1f, lane 2), DNA unwinding (Figure 1g, lane 3) and RNA helicase activities (Figure 1h, lane 2).

Expression profile of the OsSUV3 gene in wild-type IR64 rice in response to abiotic stress

The salt treatment of IR64 rice seedlings showed a significant increase in the transcript level of OsSUV3. The 200–mm NaCl treatment induced a roughly fivefold increase in expression of OsSUV3 during the first hour (1 h), and this transcript accumulation gradually increased until 12 h (approximately 13-fold; Figure 2a). It appears as an early as well as prolonged and strong response against NaCl exposure. However, as compared with the NaCl, the WT plants accumulated lesser transcripts of OsSUV3 when subjected to KCl treatment (Figure 2b). The maximum expression of OsSUV3 was five-fold after treatment with KCl (Figure 2b; 2 and 12 h), as opposed to a 13–fold increase after NaCl treatment. The heat stress upregulated the OsSUV3 transcript level to a lesser extent (threefold at 2 and 12 h), as compared with the NaCl treatment (Figure 2c). ABA treatment induced OsSUV3 with a sixfold increase in expression during the early period (2 h; Figure 2d).

image

Figure 2. Quantitative RT-PCR analyses of OsSUV3 under different abiotic stress conditions: (a) 200 mm NaCl; (b) 200 mm KCl; (c) heat stress at 45°C; (d) 100 μm ABA. Error bars indicate the standard errors (±SEs) calculated from three independent experiments. Different letters on top of the bars indicate significant differences at a level of P < 0.05, as determined by Duncan's multiple range test (DMRT).

Download figure to PowerPoint

Response of T1 transgenic IR64 rice plants to salt stress

The T–DNA construct of the OsSUV3 gene (sense and antisense orientation) used for the development of transgenic rice plants is shown in Figure 3a. The analysis for the presence of genomic integration of the transgene was carried out on T1 plants. Phenotypically there were no significant differences among the empty vector control (VC), antisense (AS) and sense lines (L1–L3) of transgenic rice plants, as compared with the WT plants. The integration of the transgene (SUV3) was confirmed twice by PCR, and the observed copy number was one in lines 1 and 2, and two in line 3, as described earlier (Sahoo and Tuteja, 2012). The Gus activity was found to be positive in leaf tissues of all the three transgenic lines (L1–L3), as well as in the AS and VC plants (Figure 3b).

image

Figure 3. Analysis and expression of T1 transgenic lines (OsSUV3). (a) OsSUV3 gene cloned in pCAMBIA1301 vector at HindIII site. (b) Histochemical GUS assay shows the expression of GUS gene (blue stain) in the SUV3 transgenics leaves. (c) Relative expression of the OsSUV3 gene in WT and transgenic lines under control (unstressed) conditions. (d) Salinity tolerance index of T1 sense transgenic lines, as compared with WT, VC and AS plants. (e) Leaf disc senescence assay for salt tolerance in T1 OsSUV3 transgenic rice lines, as compared with WT, VC and AS plants under 100 and 200 mm NaCl concentrations. (f) Chlorophyll content (mg per g fresh weight) in T1 OsSUV3 transgenic lines under 100 and 200 mm NaCl. In panels (b–f), WT is wild type, VC is the empty vector control, AS is antisense, and L1–L3 are the sense transgenic lines. Error bars in (c), (d) and (f) panels indicate standard errors (±SEs) calculated from three independent experiments. Different letters on top of the bars indicate significant differences at a level of P < 0.05, as determined by Duncan's multiple range test (DMRT).

Download figure to PowerPoint

The quantitative real-time PCR (qRT-PCR) showed between eight and ninefold induction in the transcript level of sense transgenic lines (L1–L3), compared with WT plants under normal (unstressed) conditions (Figure 3c). The salinity tolerance index of T1 sense transgenic lines was found to be higher (79.8, 81.6 and 80.8%, respectively) in comparison with WT plants (33.8%) (Figure 3d). The AS and VC plants showed the same expression and salinity tolerance indexes as WT plants.

To further test salinity tolerance, leaf discs from T1 sense transgenic lines, WT, VC and AS rice plants were floated separately on 100 and 200 mm NaCl for 96 h. The salinity-induced loss of chlorophyll was lesser in sense transgenic lines compared with WT, VC and AS plants (Figure 3e). The damage caused by stress was reflected in the degree of bleaching observed in the leaf tissue after 96 h. The measurement of the chlorophyll content of the leaf discs from all the above plants provided further evident support for a positive co-relationship between the T1 sense transgenic lines and tolerance of salinity stress (Figure 3f).

OsSUV3 T1 sense transgenic rice plants accumulate less MDA, H2O2 and ion leakage, and show better antioxidant response

We compared the salt-induced changes in the accumulation of H2O2, MDA (lipid peroxidation product) and ion leakage in T1 sense transgenic lines (L1–L3), WT and VC rice seedlings. The MDA, H2O2 and ion leakage levels were significantly reduced in OsSUV3 sense transgenic lines under salt stress (200 mm NaCl), as compared with WT and VC seedlings (Figure 4a–c). These results indicate that overexpression of OsSUV3 could decrease the accumulation of reactive oxygen species (ROS) in sense transgenic rice seedlings. The data for AS seedlings were found to be almost similar to those for the WT and VC seedlings.

image

Figure 4. Biochemical analysis of T1 OsSUV3 transgenic lines (L1–L3) under conditions of 200 mm NaCl. (a) Determination of lipid peroxidation expressed in terms of Malondialdehyde (MDA) content in OsSUV3 transgenic lines, WT and VC. (b) Changes in the level of hydrogen peroxide (H2O2) content in OsSUV3 transgenic lines, WT and VC. (c) Estimation of the percentage electrolytic leakage in OsSUV3 transgenic lines, WT and VC. (d) Catalase (CAT) activity in OsSUV3 transgenic lines, WT and VC. One unit of enzyme activity is defined as 1 μmol H2O2 oxidized per min. (e) Changes in ascorbate peroxidase (APX) enzyme activity in OsSUV3 transgenic lines, WT and VC. One unit of enzyme activity is defined as 1 μmol of ascorbate oxidized per min. (f) Changes in glutathione reductase (GR) enzyme activity in OsSUV3 transgenic lines, WT and VC. One unit of enzyme activity is defined as 1 μmol of glutathione synthetase-5-thionitrobenzoic acid (GS-TNB) formed per min as a result of the reduction of 5-5'-dithiobis (2-nitrobenzoic acid) (DTNB). (g) Changes in the level of proline accumulation in OsSUV3 transgenic lines, WT and VC. (h) Estimation of the percentage relative water content (RWC) in OsSUV3 transgenic lines, WT and VC. Data represent the means ± SDs of three independent experiments (n = 3), aP < 0.05, bP < 0.01, cP < 0.001.

Download figure to PowerPoint

Salt treatment (200 mm NaCl) increased the activities of CAT, APX and GR (Figure 4d–f) in both WT and transgenic plants; however, the OsSUV3 sense transgenic lines (L1–L3) exhibited a higher increase in the activities of antioxidant enzymes (except CAT), as compared with WT and VC seedlings in response to salt stress. Proline accumulation was strongly upregulated in OsSUV3 T1 sense transgenic lines (Figure 4g), which eventually also maintained the water balance (Figure 4h) in these lines during salt-stress conditions. The data for AS seedlings were almost similar to those for the WT and VC seedlings.

Agronomic performance of T1 transgenic plants

There was no significant difference observed in the survival rates of seedlings of the T1 sense transgenic (with NaCl stress), as compared with seedlings of WT, VC and AS (without stress) (Table 1). The seeds showing hygromycin resistance clearly displayed a segregation ratio of 3:1 in inoculation analysis (Table 1). Significant differences in growth parameters were observed between WT and T1 sense transgenics (under 200 mm NaCl stress) lines. The OsSUV3 sense transgenic plants showed better performance in several growth parameters, such as plant height, root length, root dry weight and leaf area, under salt stress, as compared with the WT (Table 2). Several yield attributes, such as days required for flowering, number of tillers per plant, panicles per plant, filled grain per panicle, chaffy grain per panicle, 100 grain weight at 200 mm NaCl were recorded and found to be almost similar to the WT plants grown in water (0 mm NaCl). However, the WT plants did not survive till flowering stage under 200 mm NaCl stress (Table 3). Under identical conditions the growth parameters and yield attributes of VC and AS plants were almost similar to WT plants.

Table 1. Comparison of segregation ratio and plant seedling survival (%) of the WT and T1 generation of OsSUV3 overexpressing transgenic plants (lines 1–3; Oryza sativa L. cv. IR64) grown in the presence of 0 (H2O) or 200 mm NaCl, respectively
AttributesWater-grown control plants200 mm NaCl-grown OsSUV3 transgenic plants
WTVCASLine 1Line 2Line 3
  1. Each value represents the mean of three replicates ± SEs.

  2. AS, antisense transgenics; VC, vector control transgenics; WT, wild type.

  3. The letters a, b, c indicate significant differences at the level of P > 0.05, as determined by Duncan's multiple range test (DMRT).

Segregation ratio03.1:1 (132)3.2:1 (132)3.3:1 (152)2.85:1 (156)3.2:1 (142)
Plant seedling survival (%)98 ± 3.8a98 ± 3.8a97 ± 3.8a98 ± 4.1a98 ± 3.8a97 ± 4.2a
Table 2. Growth [plant height (cm), root length (RL), root dry weight (g), leaf area (cm2)], photosynthesis [total chlorophyll content (mg per g fresh weight); net photosynthetic rate (μmol CO2 m−2 s−1), stomatal conductance (mmol m−2 s−1) and internal CO2 concentration (μmol mol−1) and total protein (mg per g fresh weight)] and nutrients [nitrogen (%), phosphorus (%), potassium (%), sodium (%)] of non-transgenic (WT) and T1 generation of OsSUV3 overexpressing transgenic lines (lines 1–3) of rice (Oryza sativa L. cv. IR64) grown with 0 or 200 mm NaCl
AttributesControl WT plants200 mm NaCl-grown T1 OsSUV3 transgenic plants
0 mm NaCl200 mm NaClLine 1Line 2Line 3
0 mm NaCl200 mm NaCl0 mm NaCl200 mm NaCl0 mm NaCl200 mm NaCl
  1. Each value represents the mean of three replicates ± SE.

  2. Means were compared using anova.

  3. Data followed by the same letters in a row are not significantly different at the level of P > 0.05, as determined by a least-significant difference (LSD) test. a,b,cSignificant differences at the level of P > 0.05, as determined by Duncan's multiple range test (DMRT).

Plant height (cm)78 ± 3.9a34.66 ± 1.52b80 ± 3.2a75 ± 3.8a78 ± 3.6a74 ± 3.9a83 ± 3.2a79 ± 3.5a
Root length (cm)25 ± 0.97a,b11.66 ± 0.06b28 ± 1.1a24 ± 1.0a,b29 ± 1.2a24 ± 1.2a,b31 ± 1.3a27 ± 1.1a
Root dry weight (g)2.88 ± 0.11b0.923 ± 0.04c4.1 ± 0.16a3.5 ± 0.15a4.0 ± 0.15a3.5 ± 0.15a4.8 ± 0.20a3.9 ± 0.16a
Leaf area (cm2 per plant)95 ± 2.7a,b52.83 ± 2.1c110 ± 1.2a97 ± 1.5a,b112 ± 1.1a96 ± 1.7a,b109 ± 1.8a97 ± 1.6a,b
Total chlorophyll (mg per g fresh weight)9.48 ± 0.41b2.05 ± 0.08c9.77 ± 0.45a9.67 ± 0.42a9.82 ± 0.51a9.79 ± 0.38a9.95 ± 0.48a9.83 ± 0.35a
Total protein (mg per g fresh weight)19.18 ± 0.55b8.014 ± 0.34c26.12 ± 0.88a24.15 ± 0.87a,b25.98 ± 0.91a,b24.25 ± 0.85a,b27.10 ± 0.85a26.71 ± 0.88a
Net photosynthetic rate (PN, μmol CO2 m−2 s−1)10.45 ± 0.7b6.93 ± 0.28c12.63 ± 0.68a11.23 ± 0.60a12.51 ± 0.71a11.37 ± 0.4a12.07 ± 0.48a11.15 ± 0.5a
Stomatal conductance (gs, mmol m−2 s−1)268 ± 15.4a126.33 ± 5.9b280 ± 13.89a271 ± 16.5a280 ± 13.94a280 ± 11.8a285 ± 15.32a276 ± 11.4a
Intracellular CO2 (Ci, μmol mol−1)255 ± 15.2a122.31 ± 4.7b260 ± 14.52a258 ± 11.5a259 ± 13.96a256 ± 11.4a263 ± 12.54a258 ± 10.5a
Nitrogen (%)0.327 ± 0.011b0.107 ± 0.004c0.407 ± 0.012a0.415 ± 0.015a0.418 ± 0.014a0.427 ± 0.012a0.430 ± 0.013a0.431 ± 0.013a
Phosphorus (%)0.343 ± 0.010b0.1223 ± 0.005c0.385 ± 0.011a0.382 ± 0.011a0.382 ± 0.012a0.381 ± 0.011a0.375 ± 0.012a0.373 ± 0.012a
Potassium (%)0.154 ± 0.004b0.074 ± 0.003c0.170 ± 0.004a0.168 ± 0.004a0.172 ± 0.003a0.166 ± 0.005a0.173 ± 0.004a0.168 ± 0.005a
Sodium (%)0.045 ± 0.001a0.063 ± 0.001a0.047 ± 0.001a0.047 ± 0.001a0.048 ± 0.001a0.048 ± 0.001a0.044 ± 0.001a0.044 ± 0.001a
Table 3. Comparison of various yield parameters of non-transgenic (WT) and T1 generation of OsSUV3 overexpressing transgenic lines (lines 1–3) of rice (Oryza sativa L. cv. IR64) grown with 0 or 200 mm NaCl, respectively
Yield attributesControl WT plants200 mm NaCl-grown T1 OsSUV3 transgenic plants
0 mm NaCl200 mm NaClLine 1Line 2Line 3
0 mm NaCl200 mm NaCl0 mm NaCl200 mm NaCl0 mm NaCl200 mm NaCl
  1. ND, no data.

  2. a

    *WT plants did not survive until harvest under 200 mm NaCl.

  3. Each value represents the mean of three replicates ± SE.

  4. Means were compared using anova.

  5. Data followed by the same letters in a row are not significantly different at P > 0.05, as determined by the least-significant difference (LSD) test. a,b,cSignificant differences at the level of P > 0.05, as determined by Duncan's multiple range test (DMRT).

Time required for flowering (days)90 ± 2.5aNDa93 ± 3.8a90 ± 2.5a92 ± 3.2a90 ± 2.6a93 ± 3.5a90 ± 2.5a
No. of tillers per plant26 ± 1.0cND33 ± 0.13a,b31 ± 1.2a,b31 ± 0.14a,b31 ± 1.1a,b39 ± 0.12a37 ± 1.0a
No. of panicles per plant22 ± 0.7cND30 ± 0.12a,b28 ± 1.0a,b33 ± 0.12a,b29 ± 1.0a,b37 ± 0.15a35 ± 1.1a
No. of filled grains per panicle70 ± 3.2bND103 ± 4.81a98 ± 4.1a105 ± 4.63a97 ± 4.3a108 ± 4.77a98 ± 4.1a
No. of chaffy grains per panicle12 ± 0.33aND07 ± 0.11b05 ± 0.21b03 ± 0.07b05 ± 0.20b04 ± 0.23b07 ± 0.11b
Straw dry weight (g)53 ± 2.1bND69 ± 3.05a65 ± 2.5a70 ± 3.13a67 ± 2.1a70 ± 2.9b71 ± 2.6a
100-grain weight2.81 ± 0.1aND2.89 ± 0.130b2.83 ± 0.12a2.87 ± 0.122b2.83 ± 0.10a2.86 ± 0.14b2.83 ± 0.11a

Measurement of photosynthetic characteristics

Photosynthetic machinery was also severely affected by salt stress, but the extent of the damage was higher in the WT as compared with sense transgenic plants (Table 2). OsSUV3 T1 sense transgenic lines experienced less reduction in chlorophyll content and total protein content, compared with WT plants, under 200 mm NaCl stress. OsSUV3 sense transgenic plants showed a lesser percentage reduction in net photosynthetic rate, in comparison with WT plants. Moreover, stomatal conductance and intercellular CO2 also followed the same higher trend as the net photosynthetic rate in transgenic lines, compared with WT plants (Table 2). Under similar conditions the photosynthetic characters of VC and AS plants were similar to those in WT plants.

Estimation of endogenous ion contents

Salt-treated T1 sense transgenic lines showed more accumulation of nitrogen, phosphorus and potassium, and less accumulation of sodium, in comparison with WT plants (Table 2). All the plants (WT and sense) contain almost the same nutrients when compared with conditions of no stress (0 mm NaCl). Under similar conditions the endogenous ion contents of VC and AS plants were almost identical to that of WT plants.

Analysis and confirmation of T2 transgenic IR64 rice plants and their response to salt stress

The integration of transgene and different phenotypic characters were studied in OsSUV3 T2 sense transgenic lines. Phenotypically the T2 sense transgenic plants were similar to the WT, VC and AS plants. The integration of the OsSUV3 gene (1.7 kb) was confirmed by PCR in all the transgenic lines using gene-specific primers (Figure 5a). The amplification of the transgene was further confirmed by using promoter-specific (CaMV 35S) forward and gene-specific reverse primers, and the expected size (2.2–kb) fragment was obtained (Figure 5b). The qRT-PCR showed a between seven- and ninefold induction in the transcript level of T2 sense transgenic lines (L1–L3), as compared with WT plants under normal (unstressed) conditions (Figure 5c). GUS activity was visualized in the leaf tissue of all three transgenic lines of T2 plants, and they all showed expression of the GUS gene but the WT plants were not GUS-positive (Figure 5d).

image

Figure 5. T2 SUV3 transgenic lines were used for further analysis. (a) Confirmation of SUV3 overexpressing sense lines (L1–L3) by PCR using gene-specific forward and reverse primers. (b) PCR analysis of T2 OsSUV3 sense transgenic plants by using the promoter (CaMV 35S) forward and OsSUV3 gene-specific reverse primers. (c) Relative expression of OsSUV3 gene in WT and T2 sense transgenic lines under unstressed conditions. (d) GUS assay of OsSUV3 T2 transgenic lines. (e) Germination of T2 OsSUV3 transgenic and WT seeds on an MS plate supplemented with 200 mm NaCl. (f) Leaf disc assay of T2 OsSUV3 transgenic rice under salinity stress (100 and 200 mm NaCl). (g) Chlorophyll estimation (mg per g fresh weight) of WT and T2 transgenics under 100 and 200 mm NaCl. (h) Salt tolerance response of transgenic plants [sense OsSUV3, antisense (AS) OsSUV3, VC (empty vector-pCAMBIA1301)] and WT after 2 days of 200 mm NaCl stress. (i) Salt stress tolerance response of same set of plants after 12 days of 200 mm NaCl stress. (j) Salt stress tolerance of same set of mature plants after 30 days of NaCl stress.

Download figure to PowerPoint

To study the effect of salt stress during germination, seeds of WT and T2 transgenic plants were grown on MS plates (Murashige and Skoog, 1962) supplemented with 200 mm NaCl. The sense transgenic seeds showed efficient growth, whereas lesser or no germination was observed in the case of WT seeds under salt stress (Figure 5e). The VC and AS plants showed germination patterns similar to that of WT plants. In the leaf disc assay the salinity stress-induced loss of chlorophyll was lower in OsSUV3 T2 sense transgenic lines, as compared with WT, VC and AS plants (Figure 5f). The damage caused by stress was visible in the degree of bleaching observed in the leaf-disc tissue after 96 h. Moreover, measurement of the chlorophyll content supported the leaf disc assay results under 100 and 200 mm NaCl stress (Figure 5g).

T2 sense transgenic plants showed better growth performance under salt stress. The leaves of control (AS, VC and WT) plants showed curling and dropping characteristics during the initial period of stress (after 2 days of salt treatment; Figure 5h); however, after 12 and 30 days of salt treatment, the SUV3 sense plants (L1) survived more efficiently up to maturity, and gave viable seeds (Figure 5i,j), whereas the control (AS, VC and WT) plants completely died. The other two T2 sense transgenic lines (L2 and L3) showed similar performances as L1 under salt stress.

Effect of drought and cold stress on post-germination growth of T2 transgenic seeds

Seeds of T2 sense transgenic plants showed good post-germination growth under drought stress conditions, whereas WT seeds failed to germinate under the same conditions (Figure 6a). There was no germination in T2 transgenics and WT seeds at 4°C, for up to 14 days (Figure 6b).

image

Figure 6. (a) Germination of T2 OsSUV3 transgenic and WT seeds on an MS plate supplemented with 20% polyethylene glycol (PEG). (b) Germination of T2 OsSUV3 transgenic and WT seeds on an MS plate at 4°C, for cold stress.

Download figure to PowerPoint

Interactome of OsSUV3

The results of interactome analysis showed that OsSUV3 interacts with a variety of different proteins, such as exoribonuclease, exonuclease, endonuclease, some splicing factors, and a few RNA and DNA helicases (Figure S3).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Helicases are evolutionarily conserved proteins that are ubiquitous in nature, and are known to be involved in diverse cellular and metabolic processes, including their new emerging role in plant abiotic stress tolerance (Vashisht and Tuteja, 2006; Tuteja, 2007a; Umate et al., 2010; Owttrim, 2013). The OsSUV3 gene encodes a DNA/RNA helicase and belongs to the family of DExH-box helicases. In the present study we have characterized the SUV3 homologue from O. sativa. This study shows that OsSUV3 protein contains the highest sequence homology to A. thaliana SUV3 mitochondrial helicase, as compared with its yeast and human counterparts. Similar to both yeast and human counterparts, AtSUV3 is also present in the mitochondria (Gagliardia et al., 1999); therefore, it is most likely that OsSUV3 is also present in mitochondria.

Both OsSUV3 and AtSUV3 exhibit the characteristic helicase ATP-binding and helicase C–terminal domains, with some peculiarities and uniqueness in the sequences of the conserved motifs, which are almost similar to the human SUV3 (Jedrzejczak et al., 2011). In OsSUV3 there is no Q motif, and DEIQ is present instead of DEAD. Although most of the typical helicase motifs are present in OsSUV3, but the conserved sequences show some unique characteristics, suggesting that OsSUV3 protein may constitute a separate subfamily of helicases, as also suggested for human SUV3 helicase (Jedrzejczak et al., 2011). OsSUV3 protein contains ATPase and DNA and RNA helicase activities, which is similar to its human counterpart (Shu et al., 2004). To the best of our knowledge the DNA and RNA helicase activities in an SUV3 homologue from plant species have not been reported so far. In the case of yeast SUV3, the point mutants K245A and V272L carrying mutations in the helicase motifs I and Ia, respectively, showed the involvement of SUV3 in RNA turnover and mtDNA maintenance (Guo et al., 2011). As these mutations abolish the ATPase and helicase activities of the yeast SUV3 protein, these results also confirm, therefore, that the biochemically active protein is required for the functions of the protein.

The transcript level of the OsSUV3 gene was found to be induced by several fold in response to NaCl, as compared with KCl. An Na+–specific response has previously been reported for the PDH45 gene (Sanan-Mishra et al., 2005). The heat stress had no effect on the expression of the OsSUV3 gene. The transcript of the OsSUV3 gene was also found to be induced in response to the phytohormone, ABA, which is already known for activation and repression under multiple stress conditions (Tuteja, 2007b). Similar to OsSUV3 the transcript of the PDH45 gene was also reported to be induced in response to ABA (Sanan-Mishra et al., 2005).

Rice plants expressing the OsSUV3 gene show enhanced tolerance to salinity stress, as indicated by the higher chlorophyll content, photosynthesis and plant dry weight of NaCl-stressed transgenic plants in comparison with WT plants. Moreover, the T1 as well as T2 rice seedlings were able to grow, flower and set viable seeds under continuous NaCl stress. This result suggests that the introduced trait is functional and stable in transgenic rice plants. Interestingly, the NaCl-stressed rice transgenics showed yield stability, because there was no loss in seed number. The transgenic lines accumulated lesser quantities of Na+ than the WT plants. Lower Na+ content in the leaves of OsSUV3-expressing lines of rice plants showed less damage to photosynthetic apparatus, thus maintaining normal growth and plant dry weight and yield, whereas WT plants accumulated higher Na+ content and experienced damage. The inhibition of photosynthesis under salinity stress may be attributed to stomatal closure caused by water deficit, in addition to several other biochemical and photochemical processes, like imbalance between ROS and antioxidant machinery.

Increased ROS produced during salt stress can cause damage to cellular macromolecules, thus causing MDA accumulation, which ultimately affects the stability of membranes (Apel and Hirt, 2004; Gill and Tuteja, 2010; Gill et al., 2012). OsSUV3 sense transgenic lines showed lesser lipid peroxidation, ion leakage and H2O2 production, along with increased activities of antioxidant enzymes (CAT, APX and GR), which is in tune with other previously reported studies (Apel and Hirt, 2004). The efficient scavenging activity of ROS in OsSUV3 sense transgenic lines minimizes the damage to macromolecules, and thus prevents membrane damage, for the survival of the plant. These findings are in agreement with earlier studies reported in another variety of transgenic rice overexpressing PDH45 (O. sativa L. cv. PB1; Gill et al., 2013). The higher proline accumulation in OsSUV3 T1 transgenic lines probably provides protection against the ROS-induced disruption of lipid content of the membranes, resulting in membrane stability for the survival of plant. The presence of a number of interacting partners of OsSUV3 suggests that this enzyme might be involved in diverse cellular activities, which lead to the observed salinity tolerance. The exact mechanism of helicase-mediated salinity tolerance is not yet understood. Most probably OsSUV3 is helping in salt tolerance by improving the antioxidant machinery and by maintaining mitochondrial genome integrity of the transgenic rice plants under salt stress conditions.

Although the exact mechanism is not known yet, the interactome analysis of OsSUV3 revealed that it might be involved in a number of pathways that cumulatively result in imparting salinity stress tolerance. Overall, the maintenance of better water balance, higher accumulation of osmo-protectant and enhanced activities of antioxidant enzymes protect the OsSUV3 sense transgenic lines from the deleterious effects of oxidative damage, thus contributing effective tolerance to salt stress. From these observations, we can conclude that the upregulation of ROS machinery could be one of the main mechanism for providing salt tolerance in OsSUV3 transgenic lines.

In plant organelles, including mitochondria, some hairpin structures are present at the 3′ termini of the transcripts needed for processing mRNA and RNA degradation to regulate gene expression (Gagliardia et al., 1999). These hairpin structures have been reported to be increased or misfolded during environmental stress (Vashisht and Tuteja, 2006; Tuteja, 2007a; Kang et al., 2013; Owttrim, 2013). The functions of RNA helicases are more prominent after the cells are exposed to stresses, because misfolded RNAs cannot turn back to native conformation without the help of RNA helicases. The interactome analysis suggests that OsSUV3 might be functioning in more than one pathway in the mitochondria. On the basis of the studies reported, a supportive hypothetical mechanism could be that OsSUV3 alone, or with the help of predicted mitochondria-localized interacting partners, probably follows the same pathway in modulating stem-loop structures during stress conditions in plants. OsSUV3 might also be playing a role in maintaining mitochondrial genome stability under stress conditions. It will be interesting to characterize OsSUV3 and its interacting partners in detail to understand its exact mechanism in imparting salinity stress tolerance.

Experimental Procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Cloning of the rice SUV3 gene

The complete coding region of the 1.74–kb rice SUV3 gene was PCR amplified by using a forward primer (5′–GGATCCATGGCGTGGCTGCG–3′, with the BamHI site underlined) and a reverse primer (5′–GGATCCTTTTGATCTCACATCAATTTCTTG–3′, with the BamHI site underlined) designed from the gene sequence, and rice cDNAs as a template. The amplified fragment was cloned into pGEMT easy vector and sequenced (GenBank accession number: GQ982584).

Expression and purification of the rice SUV3 protein

The specific 1.74–kb fragment was excised from pGEMT-OsSUV3 plasmid and cloned into the pET28a+ expression vector (Novagen, http://www.emdmillipore.com), and the plasmid (pET28a-OsSUV3) was transformed into BL21 (DE3) pLysS cells. A 1% portion of the overnight-grown primary culture was inoculated in 500 ml of Luria broth (LB) and allowed to grow at 37°C, and the protein was induced and purified using Ni-NTA (Qiagen, http://www.qiagen.com) resin and standard protocols. The protein was checked for purity by SDS-PAGE [10% (w/v) polyacrylamide gel] and coomassie staining.

Western blot analysis

The protein was separated by SDS-PAGE and transferred electrophoretically to nitrocellulose membrane using the standard method. After blocking, the membrane was incubated with the appropriate primary antibody (Penta-His; Qiagen) for 3 h at room temperature (27°C) and the blot was incubated with the appropriate secondary antibody coupled to alkaline phosphatase (Sigma-Aldrich, http://www.sigmaaldrich.com) and developed using the standard method.

ATPase and helicase assays

The ATPase and DNA and RNA helicase assays were performed with the purified protein using the method described by Pham et al. (2000).

Plasmid construction and Agrobacterium-mediated transformation of IR64

The 1.74–kb rice SUV3 gene fragment was cloned in sense and antisense orientation in the pRT100 vector. The CaMV35S-OsSUV3-polyA fragment thus generated in pRT100 was then inserted into the multiple cloning site of the rice-compatible pCAMBIA1301 containing the hygromycin phosphotransferase-selectable marker to generate the plasmids pCAMBIA1301-OsSUV3 in sense and antisense orientations. A competent strain of Agrobacterium tumefaciens (LBA4404) was transformed with the sense, antisense (pCAMBIA1301-OsSUV3) and empty vector (pCAMBIA1301) construct, as vector control (VC), using standard protocols. The empty vector contained all except the OsSUV3 gene. Agrobacterium-mediated transformation of IR64 rice was carried out using an improved method (Sahoo and Tuteja, 2012). The VC plants were also generated at the same time and in the same conditions as the plants containing the vector with the OsSUV3 gene (sense or antisense).

PCR, Southern blot analysis and histochemical GUS assay

Integration and the copy number of the OsSUV3 gene was checked by PCR and Southern blot analysis, as reported previously (Sahoo and Tuteja, 2012). Leaves from transgenic (T1 and T2) plants were confirmed by β–glucuronidase (GUS) assay (Jefferson, 1987) using the indigogenic substrate X–gluc (5–bromo-4-chloro-3-indolyl β-d-glucuronide).

RNA isolation and quantitative real-time PCR (qRT-PCR)

Seedlings of the WT (21–day-old O. sativa cv. IR64) were treated with 200 mm NaCl, 200 mm KCl, abscisic acid (100 μm ABA) and heat (45°C) under controlled conditions, and samples were harvested at different time intervals (1, 2, 3, 6 and 12 h). Leaf samples of unstressed and stressed WT and OsSUV3 T1 transgenic plants were used for RT-PCR. Total RNA was isolated using TriZOL LS reagent (Invitrogen, http://www.invitrogen.com), following the manufacturer's instructions, and poly(A)-RNA was isolated. It was used for making cDNA using the RevertAid H minus first-strand cDNA synthesis kit (Fermentas, http://www.thermoscientificbio.com/fermentas). Expression analysis of the SUV3 gene was performed by qRT-PCR, following the method described by Jayaraman et al. (2008), and the relative levels of the transcript accumulated for the OsSUV3 gene (primers: forward, 5′–CAGTTGAGATGGCCGACA–3′ and reverse 5′–CAGCTGGGTCACCACAAA–3′) were normalized to α–tubulin (primers: forward 5′–GGTGGAGGTGATGATGCTTT–3′ and reverse 5′–ACCACGGGCAAAGTTGTTAG–3′) and OsSUV3 expression in the WT plant (Jain et al., 2006) using the 2–ΔΔCt method from three independent experiments (Livak and Schmittgen, 2001). The PCR efficiency, which is dependent on the assay, performance of the master mix and quality of the sample, was calculated as efficiency = 10 (–1/slope) – 1 (3.6C slope C 3.1) by the software itself (Applied Biosystems, http://www.appliedbiosystems.com) ‘C’ is defined as threshold cycle.

Tolerance index (TI)

The TI of the 200 mm NaCl-treated OsSUV3 T1 transgenic (L1–L3) and WT plants were calculated using the following formula: TI(%) = (plant dry weight with 200 mm NaCl)/(plant dry weight with water) × 100.

Leaf disc assay for salinity and drought tolerance

The leaf disc assay and chlorophyll measurement were performed as described by Sanan-Mishra et al. (2005).

Determination of antioxidant activities of OsSUV3 transgenic lines

The 21–day-old seedlings of WT and transgenic plants were used for biochemical analysis at different time points (1, 6, 12 and 24 h). Estimation of lipid peroxidation, electrolytic leakage, relative water content (RWC), measurement of activities of various antioxidant enzymes, including catalase (CAT), ascorbate peroxidase (APX) and glutathione reductase (GR), proline and hydrogen peroxide (H2O2), was performed using the methods described earlier (Garg et al., 2012).

Measurement of photosynthetic characteristics

The net photosynthetic rate (PN), stomatal conductance (gs) and intercellular CO2 concentration (Ci) were recorded in fully expanded leaves using an infrared gas analyser (IRGA; LI-COR, http://www.licor.com) on a sunny day between 10:00 and 11:00 h. The atmospheric conditions during the measurement were: photosynthetically active radiation (PAR), 1050 ± 7 l mol m−2 s−1; relative humidity, 66 ± 4%; atmospheric temperature, 24 ± 2°C; and atmospheric CO2, 350 μmol mol−1.

Agronomic performance and estimation of endogenous ion content of T1 transgenic plants

Growth characteristics were measured at 4 weeks after initiating the 0 and 200 mm NaCl treatment in T1 transgenic and WT plants. Shoot and root length was measured on a metre scale. Plant dry weight was determined after drying the samples in an oven at 80°C till reaching a constant weight. The leaf area was measured by a leaf area metre (Systronics, Hyderabad, India,http://www.grotal.com/Hyderabad/Systronics/India/Limited-C70/). The total nitrogen content in plant material was determined using the Micro Kjeldahl method (Jackson, 1973). The phosphorus content of plant samples was calculated as a percentage by using a spectrophotometer (Gupta, 2004). Potassium was estimated via the flame photometer (Chapman and Pratt, 1982). For the estimation of sodium content, plant material was digested in concentrated HNO3/H2O2 overnight, followed by digestion with 2 m HCl, and analyzed for sodium content by using simultaneous inductively coupled argon-plasma emission spectrometry (ICP trace analyzer; Labtam, http://www.labtam-inc.com).

Segregation analysis of the T1 transgenic lines

The inheritance of the OsSUV3 gene in the T1 generation was analysed. Here, the progenies were evaluated for resistance to hygromycin. T1 seeds of three independent transformants of the IR64 cultivar were germinated on hygromycin-containing medium (50 mg l−1).

Analysis of T2 transgenic plants

The T2 OsSUV3 transgenic plants were grown to maturity, and the integration of the transgene was analysed by molecular as well as phenotypic expression in all of the lines, as described for the T1 lines.

Germination test in 200 mm NaCl, 20% PEG and in cold (4°C) stress

The T2 transgenic rice seeds were germinated at 28°C under 200 mm NaCl and 20% PEG for salinity and drought stress, respectively. For cold stress, rice seeds (WT and sense lines) were germinated in MS medium at 4°C.

Analysis of T2 transgenic plants in the presence of 200 mm NaCl

The T2 transgenic plants (sense, AS and VC), along with WT plants, were kept together in one big tank filled with 200 mm NaCl instead of water. The response of these plants was recorded at 1–day intervals.

Statistical analysis

The experiment was arranged in a randomized block design. For various growth parameters of the WT, VC, AS and OsSUV3 sense T1 transgenic plants, values are presented as means of three replicates (each plant was considered a replicate). Here the ‘mean of three replicates’ represents the ‘mean of three independent plants’. Data were analysed statistically and standard errors were calculated. Least significant differences (LSDs) between the mean values (n = 3) of control (WT and/or VC) and OsSUV3 overexpressing transgenic rice lines (L1–L3) were calculated by one-way analysis of variance (anova) using spss 10.0 (SPSS, Inc., now IBM, http://www-01.ibm.com/software/analytics/spss). A comparison between the means was performed using Duncan's multiple range tests. The WT, VC and transgenic lines at P < 0.05, P < 0.01 and P < 0.001 were considered statistically significant.

Study of interactome of OsSuv3

The interactome of OsSuv3 was analysed using string 9.0 (http://string-db.org). The protein sequence of OsSUV3 was submitted and the results are presented in Figure S3.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

The authors gratefully acknowledge the help of Drs Pawan Umate and Maryam Sarwat in the initial stages of the work, and Mr Dipesh Trivedi for Figure 1. We also thank Dr Sarvajeet Singh Gill for his help in analysing the agronomical data. Work on plant helicases and abiotic stress tolerance in N.T.'s laboratory is partially supported by the Department of Biotechnology (DBT), Government of India. We do not have any conflict of interest to declare.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Abdelhaleem, M. (2010) Helicases: an overview. Methods Mol. Biol. 587, 112.
  • Amin, M., Elias, S.M., Hossain, A., Ferdousi, A., Rahman, M.S., Tuteja, N. and Seraj, Z.I. (2012) Overexpression of a DEAD box helicase, PDH45, confers both seedling and reproductive stage salinity tolerance to rice (Oryza sativa L.). Mol. Breed. 30, 345354.
  • Apel, K. and Hirt, H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373399.
  • Arnold, K., Bordoli, L., Kopp, J. and Schwede, T. (2006) The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics, 22, 195201.
  • Bleichert, F. and Baserga, S.J. (2007) The long unwinding road of RNA helicases. Mol. Cell, 27, 339352.
  • Butow, R.A., Zhu, H., Perlman, P. and Conrad-Webb, H. (1989) The role of a conserved dodecamer sequence in yeast mitochondrial gene expression. Genome, 31, 757760.
  • Chapman, H.D. and Pratt, P.F. (1982) Method and of Analysis of Soil, Plant and Water, 2nd edn. California: California University Agricultural Division, pp.170.
  • Dziembowski, A., Piwowarski, J., Hoser, R., Minczuk, M., Dmochowska, A., Siep, M., van der Spek, H., Grivell, L. and Stepien, P.P. (2003) The yeast mitochondrial degradosome. Its composition, interplay between RNA helicase and RNase activities and the role in mitochondrial RNA metabolism. J. Biol. Chem. 278, 16031611.
  • Gagliardia, D., Kuhnb, J., Spadingerb, U., Brennickeb, A., Leavera, C.J. and Binderb, S. (1999) An RNA helicase (AtSUV3) is present in Arabidopsis thaliana mitochondria. FEBS Lett. 458, 337342.
  • Garg, B., Jaiswal, J.P., Misra, S., Tripathi, B.N. and Prasad, M.A. (2012) Comprehensive study on dehydration-induced antioxidative responses during germination of Indian bread wheat (Triticum aestivum L. em Thell) cultivars collected from different agro climatic zones. Physiol. Mol. Biol. Plants, 18, 217228.
  • Gill, S.S. and Tuteja, N. (2010) Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48, 909939.
  • Gill, S.S., Singh, L.P., Gill, R. and Tuteja, N. (2012) Generation and scavenging of reactive oxygen species in plants under stress. In Improving Crop Resistance to Abiotic Stress. (Tuteja, N., Gill, S.S., Tiburcio, A.F. and Tuteja, R., eds). Germany: Wiley-VCH Verlag GmbH and Co. KGaA, pp. 4970.
  • Gill, S.S., Tajrishi, M., Madan, M. and Tuteja, N. (2013) DESD-box helicase functions in salinity stress tolerance by improving photosynthesis and antioxidant machinery in rice (Oryza sativa L. cv. PB1). Plant Mol. Biol. 8, 122.
  • Gorbalenya, A.E. and Koonin, E.V. (1993) Helicases: Amino acid sequence comparisons and structure-function relationships. Curr. Opin. Srruct. Biol. 3, 419429.
  • Guo, X.E., Chen, C.-F., Ding-Hwa, D., Wang, D.D., Modrek, A.S., Phan, V.H., Wen-Hwa Lee, W.H. and Chen, P.L. (2011) Uncoupling the roles of the SUV3 helicase in maintenance of mitochondrial genome stability and RNA degradation. J. Biol. Chem. 286, 3878338794.
  • Gupta, P.K. (2004) Methods in Environmental Analysis Water, Soil and Air. India: Agrobios, pp. 242245.
  • Jackson, T.L. (1973) Soil Chemical Analysis. New Delhi: Prentice-Hall of India Private Limited.
  • Jain, M., Nijhawan, A., Tyagi, A.K. and Khurana, J.P. (2006) Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem. Biophys. Res. Commun. 345, 646651.
  • Jayaraman, A., Puranik, S., Rai, N.K., Vidapu, S., Sahu, P.P., Lata, C. and Prasad, M. (2008) cDNA-AFLP analysis reveals differential gene expression in response to salt stress in foxtail millet (Setaria italica L.). Mol. Biotechnol. 40, 241251.
  • Jedrzejczak, R., Wang, J., Dauter, M., Szczesny, R.J., Stepien, P.P. and Dauter, Z. (2011) Human Suv3 protein reveals unique features among SF2 helicases. Acta Crystallogr. 67, 988996.
  • Jefferson, R.A. (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep. 5, 387405.
  • Kang, H., Park, S.J. and Kwak, K.J. (2013) Plant RNA chaperones in stress response. Trends Plant Sci. 18, 100106.
  • Laskowski, R.A. (2009) PDB sum new things. Nucleic Acids Res. 37, 355359.
  • Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2-DDCt method. Methods, 25, 402408.
  • Mahajan, S. and Tuteja, N. (2005) Cold, salinity and drought stresses: an overview. Arch. Biochem. Biophys. 444, 139158.
  • Malecki, M., Jedrzejczak, R., Stepien, P.P. and Golik, P. (2007) In vitro reconstitution and characterization of the yeast mitochondrial degradosome complex unravels tight functional interdependence. J. Mol. Biol. 372, 2336.
  • Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassays with tobacco cultures. Physiol. Plant. 15, 473497.
  • Owttrim, G.W. (2013) RNA helicases: diverse roles in prokaryotic response to abiotic stress. RNA Biol. 10, 96110.
  • Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S. and Greenblatt, D.M. (2004) UCSF chimera - a visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1600516012.
  • Pham, X.H., Reddy, M.K., Ehtesham, N.Z., Matta, B. and Tuteja, N. (2000) A DNA helicase from Pisum sativum is homologous to translation initiation factor and stimulates topoisomerase I activity. Plant J. 24, 219229.
  • Sahoo, R.K. and Tuteja, N. (2012) Development of Agrobacterium-mediated transformation technology for mature seed-derived callus tissues of indica rice cultivar IR64. GM Crops Food, 3, 18.
  • Sahoo, R.K., Gill, S.S. and Tuteja, N. (2012) Pea DNA helicase 45 promotes salinity stress tolerance in IR64 rice with improved yield. Plant Signal. Behav. 7, 10371041.
  • Sanan-Mishra, N., Pham, X.H., Sopory, S.K. and Tuteja, N. (2005) Pea DNA helicase 45 overexpression in tobacco confers high salinity tolerance without affecting yield. Proc. Natl Acad. Sci. USA 102, 509514.
  • Shu, Z., Vijayakumar, S., Chen, C.F., Chen, P.L. and Lee, W.H. (2004) Purified human SUV3p exhibits multiple-substrate unwinding activity upon conformational change. Biochemistry, 43, 47814790.
  • Szczesny, R.J., Borowski, L.S., Brzezniak, L.K., Dmochowska, A., Gewartowski, K., Bartnik, E. and Stepien, P.P. (2010) Human mitochondrial RNA turnover caught in flagranti: involvement of hSuv3p helicase in RNA surveillance. Nucleic Acids Res. 38, 279298.
  • Tuteja, N. (2003) Plant DNA helicases: the long unwinding road. J. Exp. Bot. 54, 22012214.
  • Tuteja, N. (2007a) Mechanisms of high salinity tolerance in plants. Meth. Enzymol. 428, 419438.
  • Tuteja, N. (2007b) Abscisic acid and abiotic stress signalling. Plant Signal. Behav. 2, 135138.
  • Tuteja, N. and Tuteja, R. (2004) Prokaryotic and eukaryotic DNA helicases. Essential molecular motor proteins for cellular machinery. Eur. J. Biochem. 271, 18351848.
  • Tuteja, N. and Tuteja, R. (2006) Helicases as molecular motors: an insight. Phys. A 372, 7083.
  • Umate, P., Tuteja, R. and Tuteja, N. (2010) Genome–wide analysis of helicase gene family from rice and Arabidopsis: a comparison with yeast and human. Plant Mol. Biol. 73, 449465.
  • Vashisht, A.A. and Tuteja, N. (2006) Stress responsive DEAD–box helicases: a new pathway to engineer plant stress tolerance. J Photochem. Photobiol. 84, 150160.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
tpj12277-sup-0001-FigS1-S3.pptxapplication/pptx857K

Figure S1. Comparison of amino acid sequences of Oryza sativa (Os) SUV3 (1–579) with SUV3 from Arabidopsis thaliana (At) (1–571), Homo sapiens (Hs) (1–786) and Saccharomyces cerevisiae (Sc) (1–737).

Figure S2. Domain analysis of OsSUV3 and AtSUV3 proteins, and the secondary structure of the OsSUV3 protein generated by the PDBsum server.

Figure S3. Prediction of OsSUV3 protein-interacting proteins.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.