SEARCH

SEARCH BY CITATION

Keywords:

  • Arf-GAP1;
  • loose lipid packing;
  • protein trafficking;
  • trans-Golgi network;
  • type 2 diabetes;
  • vesicular budding

Abstract

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References
  8. Supporting Information

Saturated fatty acids (SFA) have been reported to alter organelle integrity and function in many cell types, including muscle and pancreatic β-cells, adipocytes, hepatocytes and cardiomyocytes. SFA accumulation results in increased amounts of ceramides/sphingolipids and saturated phospholipids (PL). In this study, using a yeast-based model that recapitulates most of the trademarks of SFA-induced lipotoxicity in mammalian cells, we demonstrate that these lipid species act at different levels of the secretory pathway. Ceramides mostly appear to modulate the induction of the unfolded protein response and the transcription of nutrient transporters destined to the cell surface. On the other hand, saturated PL, by altering membrane properties, directly impact vesicular budding at later steps in the secretory pathway, i.e. at the trans-Golgi Network level. They appear to do so by increasing lipid order within intracellular membranes which, in turn, alters the recruitment of loose lipid packing-sensing proteins, required for optimal budding, to nascent vesicles. We propose that this latter general mechanism could account for the well-documented deleterious impacts of fatty acids on the last steps of the secretory pathway in several cell types.

image

Obesity and dyslipidemia predispose individuals to metabolic disorders including type 2 diabetes (T2D) and cardiovascular diseases. The increasing prevalence of this metabolic syndrome is closely correlated with the worldwide generalization of the Western-diet which is excessively rich in saturated fat, originating from both animal and vegetal (e.g. palm oil) sources. In obese individuals, the incidence of the metabolic syndrome is generally associated with high plasma levels of long-chain (i.e. 16 carbons and above) saturated fatty acids (SFA) [1, 2]. When the storage capacity of adipocytes is exceeded, SFA begin to accumulate into tissues not suited for lipid storage, among which muscle cells and pancreatic β-cells are prime examples [1].

Exposure of pancreatic β-cells to SFA alters insulin secretion [3] and induces a so-called ER (endoplasmic reticulum)-stress that can ultimately lead to cell death by apoptosis [4]. These processes are believed to participate in insulin-deficiency via β-cell dysfunction and, on the longer term, a decrease in β-cell mass. In muscle cells, major impacts of SFA appear to be a downregulation of the insulin receptor [5] and of the glucose transporter GLUT4 [6, 7]. Collectively, these mechanisms could account for both insulin-deficiency and insulin resistance in T2D.

However, the precise molecular mechanisms of SFA toxicity are still a matter of debate. It has been proposed that SFA could alter ER function either by promoting a cellular accumulation of ceramides/sphingolipids, as potent apoptosis inducers [8, 9], or by redistributing themselves within phospholipids (PL; [10-12]). By increasing membrane order, saturated PL could impact several ER-based processes such as vesicular budding, calcium homeostasis and protein translocation and folding [13]. Most likely, these effects may act in combination for the induction of the ER-stress, the trademark of which is the induction of a complex, coordinated signaling pathway, known as the unfolded protein response (UPR).

SFA may also have impacts later in the secretory pathway. Indeed, impairment of β-cell function by the SFA palmitate is associated to decreased glucose-stimulated insulin release [14]. In muscle cells, downregulation of the GLUT4 transporter under SFA accumulation relates, at least in part, to its impaired translocation to the plasma membrane [6]. Finally, SFA-shutdown of adiponectin secretion, one of the most abundant and functionally significant adipokines for improvement of whole body insulin sensitivity and glucose tolerance, relies on its targeting to the lysosome for degradation in adipocytes [15].

In this study, we took advantage of a simple yeast-based model, which recapitulates the main characteristics of lipotoxicity in human cells, to carefully track the relative contributions of ceramides/sphingolipids and saturated PL to SFA impacts on the secretory pathway, with a main emphasis on its later steps.

Results

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References
  8. Supporting Information

SFA alter the morphology of the trans-Golgi network

We have recently developed a yeast-based assay that brings together most of the trademarks of the lipid-induced ER-stress observed in pancreatic β-cells [11]. This system is based on a knock-out mutant of the Δ-aminolevulinate (ALA) synthase (hem1Δ; Figure S1A). This strain can synthesize haem only if the medium is supplemented with ALA. Since haem is required in yeast as the prosthetic group of Ole1p, the fatty acid desaturase, as well as several enzymes of the ergosterol (ERG) pathway, the hem1Δ strain suffers double-lipid depletion when grown in the absence of ALA, i.e. loss of both ERG and unsaturated fatty acids (UFA) [16, 17]. When transferred from ALA-supplemented to YPD medium supplemented with or without an exogenous source of ergosterol (YPD + ERG and YPD, respectively), hem1Δ cells stop growing as early as 5 h after the shift [16]. This arrest correlates with an accumulation of SFA [mainly myristic (C14:0), palmitic (C16:0) and stearic (C18:0) acids] at the expense of unsaturated forms [UFA; palmitoleic (C16:1) and oleic (C18:1) acids] [17].

As with pancreatic β-cells, SFA accumulation is associated with significant impacts on the ER function and morphology, in a process that can be synergized by ERG [11]: endogenous SFA accumulation results in the induction of the UPR and, if ERG and long-chain SFA (namely palmitate) are supplied as exogenous sources, in a swelling of the ER that appears as clefts expanding throughout the cytosol.

In the later secretory pathway, we have also demonstrated that SFA result in the preclusion of the delivery of a model plasma membrane transporter, the uracil permease Fur4p, to its final destination [17]. Under SFA accumulation and in a way independent of the addition of an exogenous ERG source, Fur4p fails to exit the Golgi and is rather diverted to the vacuole for degradation (Figure S1A).

These two processes are paralleled by an increase in the saturation rate of PL and results in an ordering of the membrane bilayers [18] (Figure S1B). Interestingly, cell growth can be fully recovered, the UPR alleviated and trafficking to the plasma membrane restored if selective UFA, such as the mono-unsaturated fatty acid oleic acid, are added to the medium (Figure S1B; [18]). Under these conditions, exogenous UFA are efficiently incorporated within PL and restore membrane properties to normal [18].

In this study, we hypothesized that preclusion of Fur4p in the late secretory pathway could be related to general effects of SFA on organelle function/integrity. Indeed, to account for permease diversion from the Golgi to the vacuole, a simple explanation would be that SFA could have a general impact on vesicle formation at the trans-Golgi Network. To evaluate this hypothesis, we used a strain bearing a thermosensitive mutation in the SEC6 gene, encoding a protein required for optimal targeting and fusion of secretory vesicles to sites of exocytosis at the plasma membrane [19]. As shown in Figure 1A, as compared to control conditions, a threefold decrease in the number of accumulating vesicles was observed under endogenous SFA accumulation at the non-permissive temperature. Moreover, under these conditions, many vesicles displayed an intriguing polygonal shape (Figure 1C–E), which appeared very different from the normal, characteristic, round morphology (Figure 1B). Intriguingly, some of the accumulating structures under SFA accumulation were delineated by two distinct membranes (Figure 1C–F). Overall, these polygonal structures represented 66% of the total vesicle population (estimated from 30 independent cells) within the hem1Δ, sec6ts strain under SFA accumulation. In order to address whether these structures conserved some ability to be efficiently targeted to and fused with the plasma membrane, such as regular secretory vesicles, their number was compared between hem1Δ and hem1Δ, sec6ts cells. In this aim, cells were grown for 7 h in YPD at 28°C before transfer to 39°C for 2 h, and the number of polygonal structures was determined as described in the legend of Figure 1. Interestingly, the average number of polygonal structures per cell was found to be 19.7 ± 2.1 in hem1Δ, sec6ts and 2.5 ± 0.3 in hem1Δ cells, respectively (n = 30; p < 0.0001). This observation strongly suggests that the polygonal structures/vesicles induced by SFA accumulation can be efficiently targeted and tethered to active sites of exocytosis at the plasma membrane in the non-sec6ts background.

image

Figure 1. SFA impact the late secretory pathway. hem1Δ, sec6ts cells were grown in YPD or YPD + ALA during 7 h. The accumulation of secretory vesicles was induced by incubating the cells at 39°C for 2 h. Cells were harvested and prepared for electron microscopy observation as described in the Materials and Methods. A) The number of secretory vesicles per cell was determined in at least 30 different cells. The p value was calculated by a two-tailed t-test, using the Graphpad Prism 5 software. ***: p < 0.0001. Means ± SEM are indicated. Characteristic electron micrographs of the vesicles are showed for cells grown in either YPD + ALA (B) or YPD (C–F). Eighty-seven percent of 31 random sections of hem1Δ, sec6ts cells grown in YPD, from three independent experiments, exhibited polygonal structures/vesicles at non-permissive temperature (C–F). In marked contrast, hem1Δ, sec6ts cells grown in YPD + ALA did not display any such structures, but rather round vesicles, with a bright content delineated by a single membrane (B).

Download figure to PowerPoint

In summary, we concluded from these experiments that SFA affect the organizations of the trans-Golgi network/late secretory pathway, by decreasing the number of secretory vesicles en route to the plasma membrane. This process could account for altered delivery of proteins destined to the cell surface, including Fur4p, to their final destination.

Genome wide transcription profiling reveals intense remodeling of specific lipid biosynthetic pathways under SFA accumulation

A possible explanation to account for SFA alterations of the Golgi morphology could be their indirect impacts on the regulation of genes encoding tethers, coats and/or accessory proteins of the Golgi vesicular machinery, such as members of the COPI complex [20].

To check this hypothesis, we conducted a genomic analysis on hem1Δ cells by comparing their transcriptomic profiles under growth in complete medium supplemented with ergosterol and oleate (YPD + ERG + OLE), or with ergosterol alone (YPD + ERG; SFA accumulation). Differential expression analysis, conducted with a cut-off of 1.7 for fold change (FC) and of 0.0025 for the p value, identified a total of 92 genes with dysregulated expression under SFA accumulation, 71 being overexpressed and 21 being downregulated (Table S2).

However, among these genes, none of them appeared to be related to the COPI machinery and, more generally, to vesicle formation (Table S2). Instead, 16 showed direct connections to lipid homeostasis (Table 1), including sterol, fatty acid and sphingolipid metabolisms, some of which displaying strong functional similarities with mammalian homologues known to be related to T2D.

Table 1. SFA-dysregulated genes related to lipid metabolism
Gene namep valueFold ChangeDescription
  1. Gene descriptions are from the Saccharomyces Genome Database (http://www.yeastgenome.org/).

Downregulated genes
ERG52.53E−06−1.74467734C-22 sterol desaturase, a cytochrome P450 enzyme that catalyzes the formation of the C-22(23) double bond in the sterol side chain in ergosterol biosynthesis; may be a target of azole antifungal drugs
YPC12.88E−06−1.73308228Alkaline ceramidase that also has reverse (CoA-independent) ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance
SCS70.00107647−1.80540177Sphingolipid alpha-hydroxylase, functions in the alpha-hydroxylation of sphingolipid-associated very long-chain fatty acids, has both cytochrome b5-like and hydroxylase/desaturase domains, not essential for growth
FAA10.00227896−2.25801109Long-chain fatty acyl-CoA synthetase, activates imported fatty acids with a preference for C12:0-C16:0 chain lengths; functions in long-chain fatty acid import; accounts for most acyl-CoA synthetase activity; localized to lipid particles
Upregulated genes
INO11.55E−062.7454811Inositol-3-phosphate synthase, involved in synthesis of inositol phosphates and inositol-containing phospholipids; transcription is coregulated with other phospholipid biosynthetic genes by Ino2p and Ino4p, which bind the UASINO DNA element
IZH44.36E−065.1719371Membrane protein involved in zinc ion homeostasis, member of the four-protein IZH family, expression induced by fatty acids and altered zinc levels; deletion reduces sensitivity to excess zinc; possible role in sterol metabolism
RTA16.40E−064.8023256Protein involved in 7-aminocholesterol resistance; has seven potential membrane-spanning regions; expression is induced under both low-heme and low-oxygen conditions; member of the fungal lipid-translocating exporter (LTE) family of protein
IZH21.44E−052.2640908Plasma membrane protein involved in zinc homeostasis and osmotin-induced apoptosis; transcription regulated by Zap1p, zinc and fatty acid levels; similar to mammalian adiponectins; deletion increases sensitivity to elevated zinc
FAA42.17E−052.0488887Long-chain fatty acyl-CoA synthetase, activates imported fatty acids with a preference for C12:0-C16:0 chain lengths; functions in long-chain fatty acid import; important for survival during stationary phase; localized to lipid particles
ALE12.47E−052.0267613Broad-specificity lysophospholipid acyltransferase, part of MBOAT family of membrane-bound O-acyltransferases; key component of Lands cycle; may have role in fatty acid exchange at sn-2 position of mature glycerophospholipids
ICT13.42E−052.2208792Lysophosphatidic acid acyltransferase, responsible for enhanced phospholipid synthesis during organic solvent stress; null displays increased sensitivity to Calcofluor white; highly expressed during organic solvent stress
ATF16.97E−052.4021553Alcohol acetyltransferase with potential roles in lipid and sterol metabolism; responsible for the major part of volatile acetate ester production during fermentation
OLE17.84E−054.4421267Delta(9) fatty acid desaturase, required for mono-unsaturated fatty acid synthesis and for normal distribution of mitochondria
MGA20.000218761.7750116ER membrane protein involved in regulation of OLE1 transcription, acts with homolog Spt23p; inactive ER form dimerizes and one subunit is then activated by ubiquitin/proteasome-dependent processing followed by nuclear targeting
FAS20.000951851.7266125Alpha subunit of fatty acid synthetase, which catalyzes the synthesis of long-chain saturated fatty acids; contains the acyl-carrier protein domain and beta-ketoacyl reductase, beta-ketoacyl synthase and self-pantetheinylation activities
HES10.001134121.7001732Protein implicated in the regulation of ergosterol biosynthesis; one of a seven member gene family with a common essential function and non-essential unique functions; similar to human oxysterol binding protein (OSBP)

For example, SFA accumulation resulted in the upregulation of Ole1p, a homologue of the human stearoyl CoA desaturase 1 (SCD1). SCD1 levels have been demonstrated to be strictly related to sensitivity to SFA in humans. Indeed, enhanced expression of SCD1 protects β-cells from lipoapoptosis [10], whereas low hepatic SCD1 activity is associated with fatty liver and insulin resistance in obese individuals [21].

Particularly pertinent hits from our genomic screen were also two members of the IZH [implicated in zinc homeostasis; [22]] family (IZH2 and IZH4). IZH are homologues of mammalian adiponectin receptors [22] which mediate antidiabetic metabolic effects [23]. It therefore appears that a core, basic pathway could have been conserved from yeast to human, for cells to adapt lipotoxicity, via the conserved IZH/AdipoRQ membrane sensors/receptors.

Another interesting observation was the upregulation of two genes encoding broad-specificity lysophospholipid acyltransferases, namely ALE1 and ICT1. Ale1p and Ict1p have been shown to display a strong preference for unsaturated acyl-CoA substrates [24, 25]. One may therefore assume that, under conditions of UFA scarcity, cells may try to counter saturated PL accumulation by specifically targeting UFA to PL. Interestingly, Ale1p displays human homologues, belonging to the membrane-bound O-acetyltransferases (MBOAT), namely MBOAT 1, 2, 5 and 7, all of them showing a strong preference for unsaturated substrates [26]. These proteins, which could constitute potential targets for future therapies, will deserve particular attention.

Sphingolipid metabolism could also be altered in yeast under SFA accumulation since two genes encoding enzymes involved in this pathway were found to be downregulated (YPC1 and SCS7; Table 1 and see below). Scs7p, which catalyzes the hydroxylation of ceramides/sphingolipids, has a direct functional homologue in mammalian cells, known as FA2H. Relevantly, FA2H has been connected to insulin resistance, since depletion of FA2H inhibits both basal and insulin-stimulated glucose uptake (ISGU) in adipocytes [27] (see below).

In more to this first observation, we focused in this study on the ceramide/sphingolipid metabolism for additional reasons. First, the late steps for complex sphingolipid synthesis take place in the Golgi apparatus [28]. Second, sphingolipids have been shown to play critical roles in the sorting of specific sets of cargo proteins, en route to the plasma membrane, at the Golgi level [29]. Third, implication of ceramides/sphingolipids in insulin resistance and lipotoxicity has been clearly demonstrated [30]. These lipid species have been somehow connected to insulin signal transduction, chronic inflammation, lipotoxicity in several organs and nutrient transport [30, 31]. This latest process refers to the property of ceramides to downregulate nutrient permeases in yeast [32, 33] and mammalian cells [31], which could, in turn, lead to cell death by starvation. However, the mechanisms of action of ceramides/sphingolipids on permease biogenesis remain poorly understood. Consistently, we could observe the transcriptional downregulation of four different genes encoding nutrient transporters under SFA accumulation, namely the high-glucose affinity transporter Hxt4p (a strict functional homologue of the human glucose transporter GLUT4), the uracil permease Fur4p, the oligopeptide transporter Opt2p and the di-tripeptide transporter Ptr2p (Table S2).

Altogether, these observations prompted us to investigate in further detail the connections between permease biogenesis and the ceramide/sphingolipid pathway under SFA accumulation in our yeast model.

Ceramides/sphingolipids act at early steps of the secretory pathway

As already mentioned, among the two genes involved in ceramide/sphingolipid biosynthetic pathway that were shown to be downregulated under SFA accumulation, was the SCS7 gene, encoding a sphingolipid alpha-hydroxylase. Accordingly, SCS7 downregulation correlated with the accumulation of hypo-hydroxylated forms [twofold increase for complex sphingolipids (Figure 2A) and ninefold increase for ceramides (Figure S2)]. Sphingolipids are important components of the lipid rafts. Interestingly enough, accelerated diffusional mobility of raft-associated lipids has been shown to be increased under depletion of FA2H (the mammalian Scs7p homologue), a process that could account for enhanced degradation of both GLUT4 and the insulin receptor in adipocytes under these conditions [27]. It therefore seemed important to test whether preclusion of sphingolipid hydroxylation could account for Fur4p mistargeting in our yeast model. In this aim, Fur4p trafficking was evaluated in a scs7 deleted strain. In such a strain, even if hydroxy-sphingolipids were hardly detectable (Figure 2C, right), Fur4p delivery to the plasma membrane was not fully abolished (Figure 2D, right; compare ERG and scs7Δ in Figure 2E). However, significant accumulation of intracellular Fur4p could be observed in this strain (Figure 2D, right; Figure 2E). This demonstrates that, if hydroxy-sphingolipid levels are clearly important for optimal permease delivery to the cell surface, the moderately decreased amounts observed under SFA accumulation (Figure 2A, right) cannot account, by themselves, for the complete block in Fur4p trafficking observed under these conditions (Figure 2B, right).

image

Figure 2. Impacts of hypo-hydroxylated sphingolipids on Fur4p trafficking. A) hem1Δ cells were grown in YPD + ERG + OLE or YPD + ERG (SFA accumulation) for 7 h before lipid extraction and MS analysis in the negative ion mode. The mature sphingolipid forms IPC-C (m/z = 952 Da) and IPC-B/B′ (m/z = 936 Da), which differ from each other by one hydroxyl group, are indicated. A.U.: Arbitrary Units. B) hem1Δ (pFl38gF-GFP) cells were grown in YPD + ERG or YPD + ERG + OLE for 7 h and Fur4p-GFP synthesis was induced by adding galactose to the medium before visualization of GFP by confocal microscopy. Y10000 (pFl38gF-GFP) and scs7Δ (pFl38gF-GFP) cells were grown to the stationary phase in YPD, before shifting to early exponential phase (2 x 106 cells mL−1) in fresh YPRaff. Seven hours after the shift, lipids were extracted for MS analysis of the IPC species in the negative ion mode (C) and Fur4p-GFP was visualized after galactose addition (D). Bar: 1 µm. B) In order to normalize the relative expression of Fur4p-GFP at the plasma membrane, the plasma membrane/intracellular fluorescence ratio (Fur4p-GFP PM/Intra) was estimated as described in the Materials and Methods. A.U.: Arbitrary Units. The p value was calculated by a two-tailed t test, using the Graphpad Prism 5 software. *: p < 0.05. **: p < 0.01. ****: p < 0.0001. Means ± SEM are indicated.

Download figure to PowerPoint

To get a broader view of the potential impacts of SFA on ceramide/sphingolipid synthesis, we reconsidered our microarray data and applied a hierarchical clustering on 27 yeast genes involved in this pathway (Table S3). This approach identified nine genes of the sphingolipid pathway with a highly significant deregulated expression (p < 0.02), seven of which being downregulated (IFA38, LAC1, SCS7, YPC1, LCB2, TSC13, LAG1), and two upregulated (ISC1 and SKN1) (Figure 3A). When considering these genes in the context of the overall sphingolipid pathway (Figure 3B), one may anticipate a global decrease of ceramide/sphingolipid synthesis due to a shutdown of the early steps. However, we have already reported that SFA accumulation results in complex sphingolipid accumulation in yeast [namely IPC, MIPC and M(IP)2C; [17]] and quantification of ceramides in this study revealed an overall increase of these species under the same conditions (Figure S2). The apparent discrepancies between expected and measured ceramide/sphingolipid amounts likely find their explanation in the fact that palmitate, which is the main SFA-accumulating species under our experimental conditions, is the substrate of serine palmitoyltransferase (SPT; under the form of palmitoyl-CoA), the first enzyme of the ceramide/sphingolipid pathway (Figure 3B). In reaction to this, knowing the deleterious effects of high ceramide/sphingolipid levels, cells may react by shutting down the overall pathway at the transcriptional level.

image

Figure 3. SFA-induced remodeling of the sphingolipid pathway. A) Hierarchical clustering of selected genes of the sphingolipid pathway. hem1Δ cells were grown to the stationary phase in YPD + ALA, before shifting to early exponential phase (2 x 106 cells mL−1) to YPD + ERG + OLE or YPD + ERG (SFA accumulation). After 7 h growth in the indicated conditions, differential expression analyses were driven on 4 independent biological samples (1–4), as described in the Materials and Methods. Among the 27 genes involved in the ceramide/sphingolipid pathway in yeast (Table S3), 9 showed significant variations in expression (FC > 1.2 and p value < 0.02) under SFA accumulation, 7 being downregulated (green) and 2 upregulated (red). B) Outline of the sphingolipid pathway in the yeast Saccharomyces cerevisiae. Intermediates of the sphingolipid pathway are shown in regular lettering and genes are in italics. Genes which are either down- (green) or upregulated (red) under SFA accumulation are also indicated. Adapted from Dickson [34].

Download figure to PowerPoint

Since high ceramide amounts have been demonstrated to kill both yeast and mammalian cells by inducing intracellular nutrient limitation subsequent to nutrient transporter downregulation [31, 32, 35], we next questioned if these lipid species may contribute to the observed Fur4p trafficking defect under SFA accumulation. To test this hypothesis, cells were incubated with the serine palmitoyl transferases inhibitor myriocin (Figure 4A). As expected, treating SFA-intoxicated cells with myriocin resulted in decreased levels of ceramides (Figure S2). Surprisingly, however, myriocin failed to restore normal Fur4p trafficking (Figure 4A,B), demonstrating that high ceramide/sphingolipid levels are not, by themselves, responsible for impaired permease localization.

image

Figure 4. Physiological effects of myriocin under SFA accumulation. A) hem1Δ, end3Δ (pFl38gF-GFP) cells were grown to the stationary phase in YPD + ALA, before shifting to early exponential phase (2 x 106 cells mL−1) in fresh YPRaff + ERG + OLE or in YPRaff + ERG supplemented with myriocin at the indicated concentrations. Seven hours after the shift, Fur4p-GFP expression was induced by adding galactose, and GFP fluorescence was visualized 12 h later. Bar: 1 µm. B) The Fur4p-GFP PM/Intra ratio was estimated as described in the legend of Figure 2. A.U.: Arbitrary Units. The p value was calculated by a two-tailed t test, using the Graphpad Prism 5 software. ****: p < 0.0001. ns: non-significant. Means ± SEM are indicated. C and D) hem1Δ (pJC104) cells were grown to the stationary phase in YPD + ALA, before shifting to early exponential phase (2 x 106 cells mL−1) in fresh YPD + ALA or YPD + ERG + OLE and YPD + ERG supplemented with myriocin at the indicated concentrations. After 7 h following the shift to the indicated medium, cells were harvested to measure HXT4 expressions by RT-qPCR (C), or to quantify β-galactosidase activities to follow induction of the UPR (D), as described in Materials and Methods. A.U.: Arbitrary Units. RT-qPCR values are expressed as a percentage of ALG9 expression, used as a standard. Values are means ± SD of at least three independent determinations.

Download figure to PowerPoint

We next questioned if ceramides/sphingolipids could act at earlier steps of permease biogenesis. SFA accumulation is associated to the transcriptional downregulation of nutrient permeases (Table S2). To evaluate the potential involvement of ceramides/sphingolipids in this process, the mRNA of the glucose tranporter HXT4 were quantified by RT-qPCR (Figure 4C) under myriocin treatment. As shown, myriocin restored mRNA amounts to levels very similar to what observed under non SFA-accumulating conditions. Interestingly, similar results were obtained for Fur4p, Opt2p and Ptr2p (data not-shown), showing that permease transcriptional downregulation is likely a ceramide/sphingolipid regulated process.

Finally, the involvement of ceramides/sphingolipids on the induction of the ER-stress under SFA accumulation was evaluated. SFA accumulation is known to result in ER-stress and induction of the UPR. Interestingly, myriocin abolished SFA-induced UPR (Figure 4D).

Taken together, this set of data shows that ceramides/sphingolipids are not the main actors of Fur4p trafficking defect at the Golgi exit but are important modulators of both SFA-induced UPR induction and permease transcriptional downregulation.

Saturated PL as key regulators of vesicle formation at the trans-Golgi network

A striking characteristic of the ER and the Golgi apparatus is that their membranes are constituted of highly unsaturated PL species, whereas saturated PL levels increase later secretory pathway, to reach a maximum at the plasma membrane [36]. High levels of unsaturated PL result in loose lipid packing, a biophysical parameter that appears to be crucial for the recruitment of selected proteins required for optimal vesicular budding. Prime examples are the members of the Arf-GAP1 family, one of them being Gcs1p in yeast. Gcs1p has been shown to mediate both Golgi-ER and post-Golgi vesicle transport in yeast [37]. Interestingly, deletion of the GCS1 gene and of its homolog AGE2 results in Golgi fragmentation and preclusion of post-Golgi transport [38].

Arf-GAP1 proteins respond to membrane curvature through the membrane absorption of a specific motif, referred to as ArfGAP1 Lipid Packing Sensor (ALPS; [39]). In fact, the ALPS motif does not recognize membrane curvature per se, that is, a curved geometry, but loose lipid packing, which is a consequence of membrane curvature [39]. Since increased amounts of saturated PL under SFA accumulation have been shown to increase lipid packing [18], we then questioned if abnormal Golgi morphology, poor secretory vesicle formation and consequent Fur4p trafficking defect could be the consequence of direct impacts of saturated PL on Gcs1p recruitment to the trans-Golgi network. Indeed, if we could not succeed in determining the precise PL composition of the polygonal structures displayed in Figure 1, we have already demonstrated that SFA accumulate within the PL of microsomal fractions under our experimental conditions [11]. This strongly suggests that PL composition is altered in a similar fashion within the organelles of the entire secretory pathway, including the trans-Golgi network and secretory vesicles, under SFA accumulation.

In a first step, we evaluated the recruitment of Gsc1p (Gcs1p-GFP; Figure 5) to the Golgi complex in vivo, by its colocalization with the trans-Golgi resident protein Sec7p (Sec7p-RFP; Figure 5; [37]). As shown in Figure 5, Gcs1p failed to colocalize with Sec7p under SFA accumulation, but rather appeared redistributed within the cytosol.

image

Figure 5. SFA accumulation impairs Gcs1p recruitment to the trans-Golgi network. hem1Δ, SEC7RFP cells transformed with the pRS315-GFP-GCS1 plasmid were grown for 7 h in YPD + ALA or YPD (SFA accumulation) and before visualization of the Gcs1p-GFP and Sec7p-RFP fusion proteins by confocal microscopy. Bar: 1 µm.

Download figure to PowerPoint

To evaluate if saturated PL could account by themselves for altered Gcs1p recruitment to membranes, we used a flotation assay in which liposomes of defined PL compositions and associated proteins can be recovered at the top of a density gradient (Figure 6A; [39]). In this aim, liposomes were obtained from phosphatidylcholine (PC) species purified from hem1Δ cells grown either in the presence (ALA-PC) or in the absence (YPD-PC) of ALA (Figure S1). ALA-PC are mainly constituted of di-unsaturated species (i.e. bearing two mono-unsaturated fatty acyl chains; 55%), followed by mono-unsaturated species (one saturated chain and one mono-unsaturated chain; 40%) and saturated species (two saturated chains; 5%) and form highly disordered membranes [17, 18]. On the other hand, saturated forms raise up to 40% in YPD-PC (55% mono-unsaturated species and 5% di-unsaturated species) and result in highly ordered, packed membranes [17, 18]. As shown in Figure 6B, the binding of Gcs1p to ALA-PC liposomes strongly increased with membrane curvature, i.e. smaller liposome radius, in a very similar manner as what could be observed with liposomes obtained with a purified mono-unsaturated species, palmitoyl-oleyl PC (POPC; Figure S3). By contrast, Gcs1p poorly associated with YPD-PC liposomes, whatever their size (Figure 6C). Similar results could be obtained when the same experiments were conducted with dimyristoyl PC liposomes (a saturated species; DMPC, Figure S3). This experiment demonstrated that Gcs1p cannot bind YPD-PC liposomes, likely because of increased lipid packing related to high saturated PL amounts. This process could therefore account for Gcs1p mislocalization in vivo and may likely participate in the observed reduced vesicular budding at the trans-Golgi network.

image

Figure 6. SFA accumulation alters Gcs1p recruitment to vesicles. A) Purified Gcs1p was incubated without or with either ALA-PC or YPG-PC liposome of different radius and loaded at the bottom of a three steps sucrose gradient before centrifugation (see Materials and Methods for details). Bottom (B: 250 μL), middle (M: 150 μL) and top (T: 100 μL) fractions were collected and analyzed. B and C) Gcs1p recruitment to liposome was determined by analysis of top fractions on SDS–PAGE and comparison to 100% protein fraction (total loaded protein volume diluted into 100 μL final top volume). Typical results with ALA-PC liposome (B) or with YPG-PC liposome (C). D) Combined results from two lipid purifications with two independent extrusion each. Liposome size varied for each experiment and was here referred depending on the pore size of the polycarbonate filters used in each condition.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References
  8. Supporting Information

The impacts of SFA in β-cell death/dysfunction have been the object of intense investigations, and are supposed to occur via complementary actions including reduced ER-to-Golgi protein trafficking [40], induction of ER-stress and apoptotic pathways [4, 13] and inhibition of insulin secretion [3]. SFA accumulation correlates with increased amounts of saturated PL which could, in turn, alter membrane properties and therefore account for the observed cellular effects [13]. However, since palmitate is the substrate of SPT (Figure 3B), these impacts of SFA are also paralleled by and correlated with an increase in ceramides and/or selective sphingolipid species (Figure 2A and Figure S2; [8, 41]). A major point of this study was therefore to address more precisely the relative contributions of ceramides/sphingolipids and saturated PL to SFA toxicity (for summary, see Figure 7A).

image

Figure 7. Summary of SFA impacts on the secretory pathway. A) Excess palmitate can be either driven to the ceramide/sphingolipid pathway or to the PL pathway, leading to high saturated PL-levels. In turn, high ceramide/sphingolipid amounts downregulate the transcription of target nutrient transporters (e.g. Hxt4p) and result in the induction of the UPR in the early secretory pathway. On the other hand, saturated PL increase membrane order and impact vesicle formation at the Trans-Golgi network, reducing the number of secretory vesicles ‘en route’ to the plasma membrane. B) A model for decreased vesicular budding in response to high saturated PL amounts. SFA accumulation within PL shifts PL shape from rather conical to cylindrical. This results in an overall increase in lipid packing which, in turn, alters Gcsp1 recruitment to nascent vesicles. See text for details.

Download figure to PowerPoint

Using myriocin, a specific SPT inhibitor, we could first demonstrate that ceramides/sphingolipids mediate SFA-induced downregulation of nutrient transporters at the transcriptional level (Figure 4C). High ceramide levels have been demonstrated to kill both yeast and mammalian cells by inducing intracellular nutrient limitation subsequent to nutrient transporter downregulation [31, 32, 35]. A similar process could therefore participate directly, at least in part, to SFA toxicity. The fact that the glucose transporter GLUT4 homologue Hxt4p belongs to the list of ceramide targets (Figure 4C), suggests that this mechanism could also account for previously reported SFA inhibition of ISGU [6, 7], which leads to insulin resistance in diabetes. Relevantly, treating muscles with SPT inhibitors make them resistant to palmitate inhibition of ISGU in isolated soleus muscles [9].

A second observation is that ceramides/sphingolipids mediate SFA-related induction of the ER-stress/UPR pathways in our yeast model (Figure 4D). Since ER-stress is closely related to cell death, these data nicely correlate with previous studies showing that inhibitors of the ceramide biosynthetic pathway (i.e. fumonisin B and myriocin) abolish SFA-induced apoptosis of β-cells [14, 42]. Altogether, these observations demonstrate that high ceramide/sphingolipid levels are not the prime cause of protein trafficking disruption.

Interestingly, SFA alter the late secretory pathway in two ways, i.e. by decreasing the amount of secretory vesicles emerging from the trans-Golgi network (Figure 1A), but also by catalyzing the accumulation of intriguing polygonal vesicular structures (Figure 1C–F). Formation of a spherical vesicle is a complex process that requires the orchestration of several elementary events, including membrane deformation by protein coats, to initiate the budding, and local lipid redistributions to obtain specific areas of positive and negative curvature (Figure 7B). A central actor of vesicle formation in the Golgi is the small G protein Arf1 [43]. Arf1-GTP initiates membrane curvature and dissociates upon GTP hydrolysis when a mature curved lattice is formed. Arf1 release from the mature vesicle is driven by Arf-GAP1 (or Gcs1p in yeast) that promotes GTP hydrolysis in Arf1. Arf-GAP1/Gcs1p is specifically recruited to the highly curved/mature vesicle via its loose lipid-packing sensor ALPS motif [39].

We bring in this study several lines of evidence suggesting that saturated PL directly impact vesicle formation by two means (Figure 7B). First, conical lipids are required to form areas of positive and negative curvature, and SFA accumulation within PL is known to shift PL shape from conical to rather cylindrical [17]. Such SFA-related conical-PL depletion is expected to alter membrane bending and could therefore account for the formation of the observed non-spherical, polygonal vesicles/structures (Figure 1C–F). Second, accumulation of saturated PL results in increased membrane order (i.e. high lipid packing; [18]) which alters Gcs1p recruitment to liposomes in vitro (Figure 6C) and is likely to account for the observed SFA impacts on Gcs1p targeting to the Golgi in vivo (Figure 5). Altogether, these processes may participate actively to disrupting the overall secretory pathway.

If extrapolated to mammalian cells, such a general mechanism could account, at least partly, for the many dysregulations in the secretory pathway that have been reported for adipocytes, muscle and β-cells in response to SFA, including altered vesicular budding in the ER [40], decreased GLUT4 translocation to the plasma membrane [6, 7] and decline in adiponectin secretion [15].

Materials and Methods

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References
  8. Supporting Information

Strains and culture conditions

Saccharomyces cerevisiae strains used in this study are listed in Table S1. The hem1Δ cells were grown aerobically at 28°C in YPD medium [1% Yeast extract (w/v), 1% Peptone (w/v), 2% Glucose (w/v)] supplemented with 80 µg mL−1 ALA. Accumulation of endogenous SFA was obtained as previously described [11] by cultivating the cells in YPD supplemented or not with 80 µg mL−1 ERG. Where indicated, myriocin (Sigma) was added from a stock solution in DMSO, and 1% Tween 80 (v/v) was used as the source of oleic acid (OLE). For Fur4p biogenesis studies, cells were transformed with the centromeric plasmid pFl38gF-green fluorescent protein (GFP). This plasmid codes a FUR4 fusion gene, encoding Fur4p with a C-terminal GFP tag under the control of the inducible GAL10 promoter [44]. Fur4p-GFP synthesis was induced by adding galactose to a final concentration of 4% (wt/v) to a YPRaff medium in which Raffinose (4%; wt/v) is substituted to Glucose to avoid the repression of Glucose on the GAL10 promoter. For visualization of secretory vesicles, the hem1Δ, sec6ts strain was used. Cells were grown to early logarithmic phase in YPD medium supplemented or not with 80 µg mL−1 ALA, at 28°C for 7 h, before shift at 39°C for 2 h to induce the accumulation of secretory vesicles. Localization of Gcs1p was conducted using a single-copy plasmid expressing Gcs1p tagged at the amino terminus with GFP (pRS315-GFP-GCS1; [37])

Microarrays

RNA extraction was from 2 x 107 cells using a commercial kit (RNeasy Mini Kit, Qiagen). For each condition of growth, samples were prepared from four individual biological samples. Agilent's Yeast oligo microarray contains 60-mer oligonucleotide probes to 6256 annotated ORFs for the S288C strain of S. cerevisiae. The ORF list was downloaded from the Saccharomyces Genome Database (SGD: http://genome-www.stanford.edu/Saccharomyces/) at Stanford University. For statistical confidences and determination of differential gene expression, data files were analyzed using the free software R associated to packages of ‘Bioconductor’ project. Developed workflows begin by data normalization using Robust multichip average (RMA) method [45] that allows reduction of block effect done at the probeset level. The second step of data analysis workflow consists in selecting differentially expressed genes between ‘control’ and ‘experiment’. The statistical algorithm SAM (Significance Analysis of Microarrays) [46] was used to compute p value and FC for each gene. Selected genes were obtained using a cut-off both for FC and p value (FC Cut-off = 1.7, p value Cut-off = 0.0025).

Real-time quantitative polymerase chain reaction

RNA extraction was from 2 x 107 cells using a commercial kit (RNeasy Mini Kit, Qiagen). Reverse transcription-PCR (RT-PCR) was done with SuperScript II (Invitrogen) using the procedure supplied by the manufacturer. Gene expression was assessed relative to asparagine-linked glycosylation (ALG9) expression by real-time quantitative PCR (RT-qPCR) with the GeneAmp 9500 Sequence Detection System and SYBR Green chemistry (Applied Biosystems). The RT-qPCR primers used were: ALG9 forward GCAGGCCAGGCAATGTCACG, ALG9 reverse ACCGGTGCCTTCACACCACC, HXT4 forward CCAGCTGATGCTTTGTCGCCAG, HXT4 reverse CGGAGGCGGGCTTCTTTGGA. The amplicons were sequenced directly using the ABI PRISM Big Dye Terminator™ Cycle sequencing Ready Reaction kit (Applied Biosystems) and ABI PRISM 310 automatic sequencer.

Lipid analyses and mass spectroscopy

Lipid extracts were prepared from 1010 (PC purification for floatation assays) or 108 (ESI-MS analysis) yeast cells, grown as indicated, according to Ferreira et al. [16]. The final organic phase was evaporated and PL/sphingolipids were dissolved in 100 μL chloroform/methanol/H2O (16:16:5, v:v:v) for analysis by mass spectrometry or 100 μL chloroform/methanol (2:1) for PC purification.

In order to analyze sphingolipid species by mass spectrometry (MS), 1% (v/v) diethylamine was added to the samples for analysis in the negative ion mode. The molecular profile of inositol phosphoceramide (IPC) was obtained by scanning for the negative ion precursors of m/z 241, specific for the dehydration product of inositol phosphate [17].

For flotation assays, PC species were purified as described by Ferreira et al. [16]. PC amounts were estimated by the ammonium ferrothiocyanate method [47]. After evaporation, PC samples were finally resuspended to a concentration between 1 and 1.3 mg mL−1 in chloroform.

β-Galactosidase assays

The UPR can be monitored in yeast by using reporter enzymes, such as β- galactosidase encoded by the LacZ gene, whose synthesis is placed under control of the UPR element (UPRE). UPRE is a 22 bp sequence present in the promoters of genes that are activated by the UPR [48]. In this aim, hem1Δ cells were transformed with plasmid pJC104 bearing a UPRE-CYC-LacZ gene fusion, provided by Dr. Peter Walter (University of California; [48]). β-Galactosidase assays were performed at 30°C as previously described [11].

Confocal and electron microscopy

Samples were examined by confocal laser scanning microscopy using a Bio-Rad MRC 1024 equipped with a 15-mW argon-krypton gas laser. GFP fusion proteins and Sec7p-RFP were visualized by excitation at 488 nm and 568 nm, respectively, and with a 522 nm pass band filter or a 605 nm pass band filter, respectively (35 nm width). Quantification of Fur4p-GFP at the plasma membrane was performed according to the procedure described by Nalaskowski et al. [49]. For each experiment, a minimum of 60 cells were randomly selected and examined. To determine the plasma membrane/intracellular ratio, GFP fluorescence intensities both over the plasma membrane and in intracellular areas in each cell were averaged to calculate the ratio of plasma membrane over intracellular intensity. For evaluation of data, unpaired Student's t test was used using the Graphpad Prism 5 software. Mean values and SEM are given.

For electron microscopy, hem1Δ, sec6ts cells on carbon-coated grids were prepared as described by Glauert et al. [50]. To visualize secretory vesicles, grids were finally immersed in a staining solution, to improve contrast in the microscope, composed of 2.5% uranyl acetate in alcohol 70% and lead citrate. A 1010 Jeol electron microscope was used in examining sections at 80 kV. Micrographs were obtained with a digital camera Quemesa from Olympus.

Protein expression and purification

Full-length Gcs1p expressed in Escherichia coli was purified as described by Poon et al. [51].

Liposome preparation and Flotation experiments

A dried film was prepared by evaporation of 1.3 mg of either purified ALA-PC or YPD-PC lipids in chloroform, and then resuspended in 50 mm HEPES pH 7.2 and 120 mm K-acetate. After five steps of thawing and freezing in liquid nitrogen, the liposome suspension was extruded sequentially through (pore size) 0.4, 0.2, 0.1, 0.05 and 0.03 mm polycarbonate filters using a hand extruder (Avanti) at a final lipid concentration of 1–2.5 mm. The liposome radius was estimated by Dynamic Light Scattering (DLS) in a Dyna Pro instrument. Liposomes were stored at room temperature and used within 2 days after preparation.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References
  8. Supporting Information

We are very grateful to Anne Cantereau and Emile Bere (Confocal and Electron Microscopy facilities of FRE CNRS 3511, Poitiers, France) for their precious advice regarding confocal and electron microscopy imaging and Lidwine Trouilh (Biochips Platform, LISBP, Toulouse, France) for performing microarray preparations and analyses. We thank Dr. Peter Walter (University of California, USA), Dr. Rosine Haguenauer-Tsapis (Institut Jacques Monod, Paris, France) and Dr. Jeffrey E. Gerst (Weizmann Institute of Science, Rehovot, Israel) for strains and plasmids. We also acknowledge Drs. Bruno Antonny (Université de Nice-Sophia Antipolis, Valbonne, France) and Miroslava Spanova (Université de Poitiers, Poitiers, France) for their fruitful comments on the manuscript. This work was supported by the French MENRT (with a grant to L. A. P.), the CNRS, the EFSD (European Foundation for the Study of Diabetes) and the FEDER (Fonds Européen de Développement Régional).

References

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References
  8. Supporting Information
  • 1
    Kusminski C, Shetty S, Orci L, Unger R, Scherer P. Diabetes and apoptosis: lipotoxicity. Apoptosis 2009;14:14841495.
  • 2
    Sabin MA, De Hora M, Holly JMP, Hunt LP, Ford AL, Williams SR, Baker JS, Retallick CJ, Crowne EC, Shield JPH. Fasting nonesterified fatty acid profiles in childhood and their relationship with adiposity, insulin sensitivity, and lipid levels. Pediatrics 2007;120:e1426e1433.
  • 3
    Hagman DK, Hays LB, Parazzoli SD, Poitout V. Palmitate inhibits insulin gene expression by altering PDX-1 nuclear localization and reducing MafA expression in isolated rat islets of langerhans. J Biol Chem 2005;280:3241332418.
  • 4
    Diakogiannaki E, Morgan NG. Differential regulation of the ER stress response by long-chain fatty acids in the pancreatic beta-cell. Biochem Soc Trans 2008;36:959962.
  • 5
    Dey D, Mukherjee M, Basu D, Datta M, Roy SS, Bandyopadhyay A, Bhattacharya S. Inhibition of insulin receptor gene expression and insulin signaling by fatty acid: interplay of PKC isoforms therein. Cell Physiol Biochem 2005;16:217228.
  • 6
    Alkhateeb H, Chabowski A, Glatz JFC, Luiken JFP, Bonen A. Two phases of palmitate-induced insulin resistance in skeletal muscle: impaired GLUT4 translocation is followed by a reduced GLUT4 intrinsic activity. Am J Physiol: Endocrinol Metab 2007;293:E783E793.
  • 7
    Tsuchiya Y, Hatakeyama H, Emoto N, Wagatsuma F, Matsushita S, Kanzaki M. Palmitate-induced down-regulation of sortilin and impaired GLUT4 trafficking in C2C12 myotubes. J Biol Chem 2010;285:3437134381.
  • 8
    Boslem E, MacIntosh G, Preston AM, Bartley C, Busch AK, Fuller M, Laybutt DR, Meikle PJ, Biden TJ. A lipidomic screen of palmitate-treated MIN6 beta-cells links sphingolipid metabolites with endoplasmic reticulum (ER) stress and impaired protein trafficking. Biochem J 2011;435:267276.
  • 9
    Holland WL, Summers SA. Sphingolipids, insulin resistance, and metabolic disease: new insights from in vivo manipulation of sphingolipid metabolism. Endocr Rev 2008;29:381402.
  • 10
    Busch AK, Gurisik E, Cordery DV, Sudlow M, Denyer GS, Laybutt DR, Hughes WE, Biden TJ. Increased fatty acid desaturation and enhanced expression of stearoyl coenzyme a desaturase protects pancreatic {beta}-cells from lipoapoptosis. Diabetes 2005;54:29172924.
  • 11
    Pineau L, Colas J, Dupont S, Beney L, Fleurat-Lessard P, Berjeaud JM, Berges T, Ferreira T. Lipid-induced ER stress: synergistic effects of sterols and saturated fatty acids. Traffic 2009;10:673690.
  • 12
    Borradaile NM, Han X, Harp JD, Gale SE, Ory DS, Schaffer JE. Disruption of endoplasmic reticulum structure and integrity in lipotoxic cell death. J Lipid Res 2006;47:27262737.
  • 13
    Pineau L, Ferreira T. Lipid-induced ER stress in yeast and beta cells: parallel trails to a common fate. FEMS Yeast Res 2010;10:10351045.
  • 14
    Maedler K, Oberholzer J, Bucher P, Spinas GA, Donath MY. Monounsaturated fatty acids prevent the deleterious effects of palmitate and high glucose on human pancreatic beta-cell turnover and function. Diabetes 2003;52:726733.
  • 15
    Karki S, Chakrabarti P, Huang G, Wang H, Farmer SR, Kandror KV. The Multi-Level Action of Fatty Acids on Adiponectin Production by Fat Cells. PLoS ONE 2011;6:e28146.
  • 16
    Ferreira T, Regnacq M, Alimardani P, Moreau-Vauzelle C, Berges T. Lipid dynamics in yeast under haem-induced unsaturated fatty acid and / or sterol depletion. Biochem J 2004;378:899908.
  • 17
    Pineau L, Bonifait L, Berjeaud JM, Alimardani-Theuil P, Berges T, Ferreira T. A lipid-mediated quality control process in the Golgi apparatus in yeast. Mol Biol Cell 2008;19:807821.
  • 18
    Deguil J, Pineau L, Rowland Snyder EC, Dupont S, Beney L, Gil A, Frapper G, Ferreira T. Modulation of lipid-induced ER stress by fatty acid shape. Traffic 2011;12:349362.
  • 19
    Songer JA, Munson M. Sec6p anchors the assembled exocyst complex at sites of secretion. Mol Biol Cell 2009;20:973982.
  • 20
    Hsu VW, Yang J-S. Mechanisms of COPI vesicle formation. FEBS Lett 2009;583:37583763.
  • 21
    Stefan N, Peter A, Cegan A, Staiger H, Machann J, Schick F, Claussen C, Fritsche A, Häring H-U, Schleicher E. Low hepatic stearoyl-CoA desaturase 1 activity is associated with fatty liver and insulin resistance in obese humans. Diabetologia 2008;51:648656.
  • 22
    Lyons TJ, Villa NY, Regalla LM, Kupchak BR, Vagstad A, Eide DJ. Metalloregulation of yeast membrane steroid receptor homologs. Proc Natl Acad Sci USA 2004;101:55065511.
  • 23
    Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, et al. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 2003;423:762769.
  • 24
    Ghosh AK, Ramakrishnan G, Rajasekharan R. YLR099C (ICT1) encodes a soluble acyl-CoA-dependent lysophosphatidic acid acyltransferase responsible for enhanced phospholipid synthesis on organic solvent stress in Saccharomyces cerevisiae. J Biol Chem 2008;283:97689775.
  • 25
    Riekhof WR, Wu J, Jones JL, Voelker DR. Identification and characterization of the major lysophosphatidylethanolamine Acyltransferase in Saccharomyces cerevisiae. J Biol Chem 2007;282:2834428352.
  • 26
    Gijón MA, Riekhof WR, Zarini S, Murphy RC, Voelker DR. Lysophospholipid acyltransferases and arachidonate recycling in human neutrophils. J Biol Chem 2008;283:3023530245.
  • 27
    Guo L, Zhou D, Pryse KM, Okunade AL, Su X. Fatty acid 2-hydroxylase mediates diffusional mobility of Raft-associated lipids, GLUT4 level, and lipogenesis in 3T3-L1 adipocytes. J Biol Chem 2010;285:2543825447.
  • 28
    Dickson RC, Sumanasekera C, Lester RL. Functions and metabolism of sphingolipids in Saccharomyces cerevisiae. Prog Lipid Res 2006;45:447465.
  • 29
    Surma MA, Klose C, Simons K. Lipid-dependent protein sorting at the trans-Golgi network. Biochim Biophys Acta: Mol Cell Biol Lipids 2012;1821:10591067.
  • 30
    Summers SA. Ceramides in insulin resistance and lipotoxicity. Prog Lipid Res 2006;45:4272.
  • 31
    Guenther GG, Peralta ER, Rosales KR, Wong SY, Siskind LJ, Edinger AL. Ceramide starves cells to death by downregulating nutrient transporter proteins. Proc Natl Acad Sci USA 2008;105:1740217407.
  • 32
    Chung N, Mao C, Heitman J, Hannun YA, Obeid LM. Phytosphingosine as a specific inhibitor of growth and nutrient import in Saccharomyces cerevisiae. J Biol Chem 2001;276:3561435621.
  • 33
    Skrzypek MS, Nagiec MM, Lester RL, Dickson RC. Inhibition of amino acid transport by sphingoid long chain bases in Saccharomyces cerevisiae. J Biol Chem 1998;273:28292834.
  • 34
    Dickson RC. Thematic review series: sphingolipids: New insights into sphingolipid metabolism and function in budding yeast. J Lipid Res 2008;49:909921.
  • 35
    Welsch CA, Roth LW, Goetschy JF, Movva NR. Genetic, biochemical, and transcriptional responses of Saccharomyces cerevisiae to the novel immunomodulator FTY720 largely mimic those of the natural sphingolipid phytosphingosine. J Biol Chem 2004;279:3672036731.
  • 36
    Schneiter R, Brugger B, Sandhoff R, Zellnig G, Leber A, Lampl M, Athenstaedt K, Hrastnik C, Eder S, Daum G, Paltauf F, Wieland FT, Kohlwein SD. Electrospray ionization tandem mass spectrometry (ESI-MS/MS) analysis of the lipid molecular species composition of yeast subcellular membranes reveals acyl chain-based sorting/remodeling of distinct molecular species en route to the plasma membrane. J Cell Biol 1999;146:741754.
  • 37
    Robinson M, Poon PP, Schindler C, Murray LE, Kama R, Gabriely G, Singer RA, Spang A, Johnston GC, Gerst JE. The Gcs1 Arf-GAP mediates Snc1,2 v-SNARE retrieval to the Golgi in yeast. Mol Biol Cell 2006;17:18451858.
  • 38
    Poon PP, Nothwehr SF, Singer RA, Johnston GC. The Gcs1 and Age2 ArfGAP proteins provide overlapping essential function for transport from the yeast trans-Golgi network. J Cell Biol 2001;155:12391250.
  • 39
    Bigay J, Casella JF, Drin G, Mesmin B, Antonny B. ArfGAP1 responds to membrane curvature through the folding of a lipid packing sensor motif. EMBO J 2005;24:22442253.
  • 40
    Preston A, Gurisik E, Bartley C, Laybutt D, Biden T. Reduced endoplasmic reticulum (ER)-to-Golgi protein trafficking contributes to ER stress in lipotoxic mouse beta cells by promoting protein overload. Diabetologia 2009;52:23692373.
  • 41
    Lang F, Ullrich S, Gulbins E. Ceramide formation as a target in beta-cell survival and function. Expert Opin Ther Targets 2011;15:10611071.
  • 42
    Lupi R, Dotta F, Marselli L, Del Guerra S, Masini M, Santangelo C, Patané G, Boggi U, Piro S, Anello M, Bergamini E, Mosca F, Di Mario U, Del Prato S, Marchetti P. Prolonged exposure to free fatty acids has cytostatic and pro-apoptotic effects on human pancreatic islets. Diabetes 2002;51:14371442.
  • 43
    Antonny B. Membrane deformation by protein coats. Curr Opin Cell Biol 2006;18:386394.
  • 44
    Marchal C, Dupre S, Urban-Grimal D. Casein kinase I controls a late step in the endocytic trafficking of yeast uracil permease. J Cell Sci 2002;115:217226.
  • 45
    Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, Speed TP. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 2003;4:249264.
  • 46
    Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 2001;98:51165121.
  • 47
    Stewart JCM. Colorimetric determination of phospholipids with ammonium ferrothiocyanate. Anal Biochem 1980;104:1014.
  • 48
    Cox JS, Walter P. A novel mechanism for regulating activity of a transcription factor that controls the unfolded protein response. Cell 1996;87:391404.
  • 49
    Nalaskowski MM, Fliegert R, Ernst O, Brehm MA, Fanick W, Windhorst S, Lin H, Giehler S, Hein J, Lin YN, Mayr GW. Human inositol 1,4,5-trisphosphate 3-kinase isoform B (IP3KB) is a nucleocytoplasmic shuttling protein specifically enriched at cortical actin filaments and at invaginations of the nuclear envelope. J Biol Chem 2011;286:45004510.
  • 50
    Glauert AM, Lewis PR. Biological Specimen Preparation for Transmission Electron Microscopy. USA: Princeton University Press, Princeton, New Jersey; 1998.
  • 51
    Poon PP, Cassel D, Huber I, Singer RA, Johnston GC. Expression, analysis, and properties of yeast ADP-ribosylation factor (ARF) GTPase activating proteins (GAPs) Gcs1 and Glo3. Methods Enzymol 2001;329:317324.

Supporting Information

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References
  8. Supporting Information
FilenameFormatSizeDescription
tra12117-sup-0001-TableS1.docWord document42KTable S1: Yeast strains used in this study.
tra12117-sup-0002-TableS2.docWord document124KTable S2: SFA-dysregulated genes.
tra12117-sup-0003-TableS3.docWord document47KTable S3: List of the genes involved in sphingolipid pathway used for hierarchical clustering.
tra12117-sup-0004-FigureS1.tifTIFF image392KFigure S1: A yeast model for lipotoxicity. A) hem1Δ cells can synthesize haem only if the medium is supplemented with Δ-aminolevulinate (ALA). Since haem is used as the prosthetic group of Ole1p, the fatty acid desaturase, and of several enzymes of the ergosterol pathway, hem1Δ cells accumulate saturated fatty acids (SFA) and suffer ergosterol depletion when grown in the absence of ALA (YPD). As with pancreatic β-cells, SFA accumulation is associated with ER-swelling and induction of the unfolded protein response (UPR) in this organelle, but also with the diversion of selective plasma membrane proteins, such as the uracil permease Fur4p, from the Golgi apparatus to the vacuole for degradation. Full growth can be recovered if the cells are grown in the presence of exogenous sources of ergosterol and unsaturated fatty acids (UFA), such as the mono-unsaturated species oleic acid. B) On a biophysical point of view, SFA accumulation correlates with an increase in the saturation rate of phospholipids which results, in turn, in an ordering of the membrane bilayers. See text for details.
tra12117-sup-0005-FigureS2.tifTIFF image221KFigure S2: Ceramide quantification. hem1Δ cells were grown in the media indicated for 7 h before lipid extraction and MS analysis in the positive ion mode. The relative quantities of the phytoceramide species t18:0/26:0-B (m/z = 696.7 Da) and t18:0/26:0-C (m/z = 712.7 Da), which were the most represented ceramides in our samples and differ from each other by one hydroxyl group, were estimated by comparison to N-octadecanoyl-phytosphingosine (Avanti Polar Lipids, Inc.), used as a standard. Their schematic structures are also displayed. These species were unambiguously identified by scanning for the positive ion precursors of m/z 282.3 (2). A.U.: Arbitrary Units.
tra12117-sup-0006-FigureS3.tifTIFF image2589KFigure S3: Gcs1p recruitment to liposomes of defined composition and various radiuses. To determine the role of unsaturated lipids on Gcs1p recruitment, purified Gcs1p was incubated with either pure DOPC (dioleoyl phosphatidylcholine), pure POPC (palmitoyl-oleyl PC) or pure DMPC (dimyristoyl PC) liposomes of different radius [i.e. extruded through polycarbonate filters of respective pore size 0.4 µm (T2), 0.1 µm (T3) and 0.03 µm (T3), or no added liposomes (T1)], then loaded at the bottom of a three steps sucrose gradient before centrifugation as described in Figure 6. Gcs1p recruitment to liposome was quantified by analysis of top fractions on SDS–PAGE and comparison to 100% protein fraction (total loaded protein volume diluted into 100 μL final top volume).

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.