SEARCH

SEARCH BY CITATION

Keywords:

  • Endosome;
  • PDGF receptor;
  • Rho GTPases;
  • RhoD;
  • Rab5;
  • Rabankyrin-5

Abstract

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

RhoD is a member of the classical Rho GTPases and it has essential roles in the regulation of actin dynamics. RhoD localizes to early endosomes and recycling endosomes, which indicates its important role in the regulation of endosome trafficking. Here, we show that RhoD binds to the Rab5 effector Rabankyrin-5, and RhoD and Rabankyrin-5 colocalize to Rab5-positive endosomes, which suggests a role for Rabankyrin-5 in the coordination of RhoD and Rab5 in endosomal trafficking. Interestingly, depletion of RhoD using siRNA techniques interfered with the internalization of the PDGFβ receptor and the subsequent activation of the downstream signaling cascades. Our data suggest that RhoD and Rabankyrin-5 have important roles in coordinating RhoD and Rab activities during internalization and trafficking of activated tyrosine kinase receptors.

Vital cellular processes such as intracellular trafficking of organelles and vesicles, cell migration and signal transduction require the precise orchestration of the mechanisms that govern cytoskeletal and membrane dynamics [1]. Members of the Rho GTPases are key elements in the machinery that regulates cytoskeletal dynamics, and thereby the signaling pathways that regulate the ability of cells to respond and adapt to the extracellular environment [2]. In humans, the Rho subfamily of small GTPases includes 20 proteins [2]. Despite the large number of Rho GTPases, the vast majority of studies still focus on the three classical Rho GTPases: Cdc42, Rac1 and RhoA.

In addition to being key regulators of cytoskeletal reorganization, some of the small GTPases have additional roles in the regulation of membrane dynamics. For instance, Cdc42 is involved in the regulation of polarized transport of vesicles, and thereby, is involved in the establishment of apical to basal polarity in epithelial cells [3, 4]. Studies on RhoB implicate it in the control of the endocytic pathway. Depending on the cellular context, RhoB can facilitate trafficking of signaling molecules, including receptor-tyrosine kinases, Akt and Src, to the cell surface, the nucleus or lysosomes [5-7]. Another key operator in this context is the less-studied GTPase RhoD, as it has been shown to have important roles in coordinating actin reorganization and endosomal trafficking [8, 9].

RhoD was first identified by Chavrier et al. using a polymerase chain reaction (PCR) cloning approach [10]. Together with the related GTPase Rif, it constitutes a unique subgroup of the classical Rho GTPases [8-13]. Both RhoD and Rif have profound effects on the organization of the actin filament system. Ectopic expression of active variants of RhoD and Rif in HeLa cells and baby hamster kidney cells promotes the formation of long protrusions that emerge from the periphery or from the dorsal side of the cells [8, 12]. In addition, RhoD and Rif have been shown to trigger the formation of peripheral protrusions in porcine aortic endothelial cells [14]. Ectopically expressed RhoD and Rif localize to the plasma membrane, and RhoD has also been seen to localize to vesicles throughout the cytoplasm [8, 12, 15, 16]. These vesicles are positive for Rab5, which implies that they represent early endosomes. There are indications of a collaboration between Rab5 and RhoD in the regulation of endosome movement, as the enlargement and perinuclear accumulation of endosomes induced by overexpression of a constitutively active Rab5 (Rab/Q79L) can be antagonized by simultaneous expression of a constitutively active RhoD mutant (RhoD/G26V) [8].

Clearly, RhoD has a role in the regulation of cell migration, as activation of RhoD has been negatively correlated with cell locomotion in several assays [15, 17]. To date, the very few RhoD-binding partners that have been identified include the diaphanous-related formins, hDia2 and mDia1 and the Semaphorin receptors PlexinB1 and PlexinA1 [16, 18-21]. However, these RhoD-binding proteins do not provide clues to the mechanisms underlying the diverse cellular effects of RhoD. Therefore, we performed yeast two-hybrid screening to find out more about the mechanisms underlying RhoD-dependent effects on actin reorganization and membrane trafficking. We identified the Rab5 effector Rabankyrin-5 as a RhoD-binding protein. In the same screen, we identified FilaminA-interacting protein 1 (FILIP1), the actin nucleation-promoting factor WASP homolog associated with actin Golgi membranes and microtubules (WHAMM), and zipper-interacting protein kinase (ZIPK) [22, 23]. Rabankyrin-5 has been shown to regulate macropinocytosis [24]. Our data suggest that Rabankyrin-5 has an important function in the coordination of Rab5- and RhoD-regulated cellular processes. In particular, we show that RhoD and Rabankyrin-5 participate in the regulation of the internalization of platelet-derived growth factor-β receptor (PDGFRβ). This implies a novel function of RhoD in the regulation of receptor tyrosine kinase trafficking.

Results

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

RhoD is involved in endosomal localization

Ectopic expression of a constitutively active mutant of RhoD has been shown to have a dominant effect on the formation of filopodia and the assembly of short bundles of actin filaments [8, 14]. In addition, RhoD localizes to early endosomes and has been ascribed roles in endosomal trafficking [8, 15, 16]. Transfection of the constitutively active (i.e. GTP-bound) RhoD/G26V and the dominant-negative mutant (nucleotide free RhoD, representing the GDP conformation) RhoD/T31N in human foreskin fibroblasts (BJ/SV40T cells) showed that both of these RhoD mutants localize to Rab5-positive vesicles, in agreement with earlier observations [8]. These Rab5 vesicles showed an increased tendency to accumulate in the perinuclear area in cells expressing RhoD/T31N (Figure 1A). To confirm the nature of these RhoD-positive vesicles, we co-transfected RhoD with members of the Rab family of small GTPases. Rab5 is known to localize to early endosomes and Rab11 to associate with recycling endosomes, whereas Rab7 resides in late endosomes [25]. By manual analysis of randomly acquired images, we observed that RhoD was predominantly associated with Rab5 and Rab11 (Figure 1B,D), and not with Rab7 (Figure 1C,D), further supporting a role for RhoD in the endosome recycling pathway [8].

image

Figure 1. RhoD localizes to Rab5-positive endosomes. A) Colocalization of Myc-RhoD/G26V and Myc-RhoD/T31N (as indicated) with Rab5 in transiently transfected BJ/SV40T cells. The endosomes were visualized using rabbit anti-Rab5 antibodies followed by AlexaFluor488-conjugated anti-rabbit antibodies, and RhoD was visualized using mouse anti-Myc antibodies followed by TRITC-conjugated anti-mouse antibodies. Scale bar, 20 µm. B and C) Colocalization of Myc-RhoD/G26V with EGFP-Rab5 and EGFP-Rab11 (B) and lack of colocalization of Myc-RhoD/G26V with EGFP-Rab7 (C), as visualized using rabbit anti-Myc antibodies followed by TRITC-conjugated anti-rabbit antibodies and EGFP fluorescence. Scale bar, 20 µm. D) Quantification of vesicles co-harboring RhoD and Rab proteins, as described in Materials and Methods. The data are percentages of total RhoD-positive vesicles that contained both RhoD and the Rabs. Fifteen randomly acquired images for each condition were analyzed by manual examination of all of the RhoD-containing vesicles, followed by quantification of the RhoD-positive vesicles that also contained the Rabs, (i.e. the ratio of RhoD+Rab-positive particles over the total RhoD-positive particles, expressed as % of the total). Error bars, standard deviation (SD).

Download figure to PowerPoint

Rabankyrin-5 is a RhoD binding protein

To identify new binding partners for RhoD, we performed yeast two-hybrid screening. One set of positive clones represented the Rab5 effector protein Rabankyrin-5, which is also known as KIAA1255 and ANKFY1 (Ankyrin repeat and FYVE domain containing 1) [24]. Rabankyrin-5 consists of 1170 amino-acid residues and has an N-terminal BTB domain and a C-terminal FYVE domain. The central part of Rabankyrin-5 contains 21 Ankyrin repeats. The RhoD-binding yeast two-hybrid clone was found to encompass amino-acid residues 652–1170 and to include the C-terminal 11 Ankyrin repeats (Figure 2A).

image

Figure 2. Rabankyrin-5 is a RhoD binding partner. A) Schematic representation of the domain organization of Rabankyrin-5 and the deletion mutants used in this study. White boxes, Ankyrin repeats; dark gray box, BTB domain; light gray box, FYVE domain. The RhoD-binding fragment isolated in the yeast two-hybrid screen is indicated. B) Interactions between RhoD and Rabankyrin-5 determined by immunoprecipitation in transiently transfected HEK293T cells. The presence of FLAG-Rabankyrin-5 in the Myc-RhoD/G26V and Myc-RhoD/T31N precipitates was determined by western blotting using a FLAG-specific antibody. i.p., immunoprecipitate; TCL, total cell lysate. The TCL represents 1/20 of the total volume of the lysate used for i.p. C) Mapping the RhoD-binding domain on Rabankyrin-5. The presence of FLAG-Rabankyrin-5 deletion mutants in the Myc-RhoD/G26V precipitates from transiently transfected HEK293T cells was determined by western blotting using a FLAG-specific antibody. D) RhoD-binding epitope on Rabankyrin-5 confirmed by GST pull-down. GST-fusion proteins (GST-Rabankyrin-5/650-759 and GST alone) were incubated with lysates from HEK293T cells transfected with Myc-tagged RhoD/G26V. The presence of RhoD in the GST pull-down material (PD) was detected by western blotting using a Myc antibody. The input lysate represents 1/20 of the total volume of the lysate used for PD. E) Specificity of Rabankyrin-5 for members of the Rho GTPases. The presence of Rabankyrin-5 in precipitates of Myc-tagged RhoD/G26V, Rif/Q77L, RhoA/Q63L and Cdc42/Q61L isolated from transiently transfected HEK293T cells was determined by western blotting. Rabankyrin-5 appears to be a relatively sticky protein, as it consistently gave weak signals, also in the control well (Myc vector control in (B) and (E)).

Download figure to PowerPoint

We began this study by confirming the RhoD and Rabankyrin-5 interaction by co-immunoprecipitation, and addressing whether the interaction requires RhoD to be in the GTP-bound conformation. To this end, FLAG-tagged Rabankyrin-5 was transiently co-transfected with the constitutively active mutant RhoD/G26V or the dominant-negative RhoD/T31N mutant in human embryonic kidney 293T (HEK293T) cells. Rabankyrin-5 interacted with the RhoD variants, which indicates that this interaction is independent of the GTP-loaded status of RhoD (Figure 2B).

To map the RhoD-binding-site, we produced a series of deletion mutants of Rabankyrin-5 (Figure 2A). In co-immunoprecipitation experiments, the fragments of Rabankyrin-5 that included a domain that encompasses amino-acid residues 650–759 retained RhoD-binding capacity, which indicated that RhoD interacts with this region of Rabankyrin-5 (Figure 2C). Furthermore, this was confirmed using a glutathione S-transferase (GST) pull-down assay with GST-Rabankyrin-5/650-759. This fragment that encompassed ankyrin repeats 12 and 13 efficiently pulled down RhoD from cell lysates expressing Myc-tagged RhoD (Figure 2D). The yeast two-hybrid data suggested that Rabankyrin-5 has a strong affinity for only the RhoD subgroup of Rho GTPases (RhoD and Rif), with weak affinities for the other members of the Rho GTPases (data not shown). This was further confirmed by co-immunoprecipitation of Rabankyrin-5 with a selection of Rho GTPases. Under these conditions, Rabankyrin-5 interacted only with RhoD and Rif, and marginally with RhoA and Cdc42 (Figure 2E).

RhoD and Rabankyrin-5 colocalize on early endosomes

Previously, Rabankyrin-5 has been reported to localize to early endosomes and to macropinosomes in epithelial cells [24]. We observed that ectopically expressed and endogenous Rabankyrin-5 localized to vesicular structures in BJ/SV40T fibroblasts (Figure 3A). This pattern of localization resembles that of RhoD (Figure 1A). Therefore, we transfected these cells with Myc-tagged RhoD and counter-stained with Rabankyrin-5-specific antibodies to reveal the endogenous protein. Rabankyrin-5 was in vesicles throughout the cytoplasm. In RhoD-expressing cells, Rabankyrin-5 and RhoD occupied the same vesicles (Figure 3B). The concept that Rabankyrin-5 and RhoD localize to the same compartment was further emphasized when FLAG-Rabankyrin-5 was co-transfected with RhoD/G26V. A similar colocalization was also seen with the dominant-negative mutant RhoD/T31N, further indicating that the localization of RhoD to the Rabankyrin-5-containing vesicles is independent of its GTP-loaded status (Figure 3C,D).

image

Figure 3. Subcellular localization of Rabankyrin-5 and RhoD. A) Subcellular localization of FLAG-Rabankyrin-5 in transiently transfected BJ/SV40T cells, visualized using mouse monoclonal anti-Flag antibodies followed by AlexaFluor488-conjugated anti-mouse antibodies. Endogenous Rabankyrin-5 was visualized using rabbit anti-Rabankyrin-5 antibodies followed by TRITC-conjugated anti-rabbit antibodies. Scale bar, 20 µm. B) Colocalization of endogenous Rabankyrin-5 and Myc-tagged RhoDwt, visualized using rabbit anti-Rabankyrin-5 and mouse monoclonal anti-Myc antibodies followed by AlexaFluor488-conjugated anti-rabbit antibodies and TRITC-conjugated anti-mouse antibodies. Scale bar, 20 µm. C) Colocalization of FLAG-Rabankyrin-5 with Myc-RhoD/G26V and Myc-RhoD/T31N, visualized using mouse monoclonal anti-Flag and rabbit anti-Myc antibodies followed by TRITC-conjugated anti-rabbit antibodies and AlexaFluor488-conjugated anti-mouse antibodies. Scale bar, 20 µm. D) Quantification of vesicles co-harboring Rabankyrin-5, and RhoD/G26V and RhoD/T31N. The data are represented as percentages of the total amount of RhoD-positive vesicles that contained both RhoD and Rabankyrin-5. Fifteen randomly acquired images were analyzed for each condition, by manual examination of all of the Rabankyrin-5-containing vesicles, followed by quantification of Rabankyrin-5-positive vesicles that also contained RhoD/G26V and RhoD/T31N, respectively, (i.e. Rabankyrin-5+RhoD-positive particles over the total Rabankyrin-5-positive particles, expressed as % of total) (see Materials and Methods). Error bars, SD.

Download figure to PowerPoint

RhoD and Rab5 share a binding-site on Rabankyrin-5

Rabankyrin-5 was originally identified as a Rab5 binding protein [24]. However, the Rab5 binding domain has not previously been identified. To analyze this, we co-transfected the Rabankyrin-5 deletion mutants with EGFP-tagged constitutively active Rab5/Q79L. The presence of Rabankyrin-5 in the EGFP-immunoprecipitates was determined by western blotting. Similar to RhoD, Rab5 interacted with all of the Rabankyrin-5 fragments that included the amino-acid residues 650–759 (Figure 4A). A GST-fusion protein encompassing amino-acid residues 650–759 of Rabankyrin-5 was used to pull-down Rab5 from lysates of HEK293T cells, which confirmed the Rab5 binding domain (Figure 4B).

image

Figure 4. Identification of the Rab5-binding domain of Rabankyrin-5. A) HEK293T cells were transiently transfected with EGFP-tagged Rab5/Q79L and FLAG-tagged deletion mutants of Rabankyrin-5. The presence of deletion mutants in the EGFP-Rab5/Q79L precipitates was determined by western blotting, using an antibody against GFP. TCL, 1/20 of total volume of lysate used for i.p. B) Rab5 binding epitope on Rabankyrin-5 was confirmed using a GST pull-down assay. GST-fusion proteins (GST-Rabankyrin-5/650-759 and GST alone) were incubated with lysates from HEK293T cells transfected with EGFP-tagged Rab5/Q79L. TCL, total cell lysate. The presence of Rab5 in the GST pull-down material (PD) was detected by western blotting using a GFP antibody. TCL, 1/20 of total volume of lysate used for PD. C) Subcellular localization of FLAG-Rabankyrin-5 when co-expressed with EFGP-Rab5/Q79L and Rab5/S34N in the absence and presence of Myc-RhoD/G26V. FLAG-Rabankyrin-5 was visualized using mouse monoclonal anti-Flag antibodies, followed by AMCA-conjugated anti-mouse antibodies. EGFP-Rab5 was visualized by the presence of EGFP. Myc-RhoD/G26V was visualized using rabbit anti-Myc antibodies, followed by TRITC-conjugated anti-rabbit antibodies. Scale bar, 20 µm.

Download figure to PowerPoint

We next analyzed whether RhoD, Rab5 and Rabankyrin-5 have the potential to occupy the same vesicles. Here, BJ/SV40T fibroblasts were transfected with combinations of Rabankyrin-5, RhoD and Rab5. When Rab5/Q79L and Rabankyrin-5 were co-transfected with RhoD/G26V, all three of these proteins showed strong colocalization (Figure 4C). We could not discriminate if this occurred through RhoD and Rab5 binding to the same Rabankyrin-5 molecule, or if RhoD and Rab5 bound to separate Rabankyrin-5 molecules in multimeric complexes. Importantly, the localization of Rab5 to RhoD/Rabankyrin-5–positive vesicles was dependent on Rab5 being in its GTP-bound conformation, as Rab5/S34N did not localize to the RhoD/G26V- and Rabankyrin-5-containing vesicles (Figure 4C).

The CAAX box of RhoD is required for localization to endosomes

To investigate further the role of RhoD and Rab5 in endosomal recruitment, we co-transfected various mutants of RhoD with constitutively active Rab5/Q79L and checked for the collective localization of Rab5 and RhoD in early endosomes, as determined by counterstaining with the marker EEA1. Rab5/Q79L localized together with RhoD to EEA1-positive vesicles, regardless of the GTP-bound status of RhoD (Figure 5A). The CAAX box at the C-terminus of the small GTPases is known to undergo post-translational isoprenylation, which results in membrane targeting of the GTPases, either to the plasma membrane and/or to endomembranes [1, 2]. Isoprenylation can be abolished by mutating the cysteine residue at position 207 to a serine residue. This mutant RhoD, RhoD/C207S, did not localize to early endosomes (Figure 5B). As a result, Rab5/Q79L did not recruit the CAAX box mutant RhoD to EEA1-positive vesicles (Figure 5B). In addition, constitutively active RhoD lacking a functional CAAX box (RhoD/G26VC207S) did not localized to early endosomes, neither in the presence nor in the absence of Rab5/Q79L (Figure 5C). This indicated that the endosomal localization of RhoD is dependent on membrane targeting via the CAAX box, rather than on the GTP-loaded status of the GTPase domain.

image

Figure 5. RhoD localization to early endosomes requires an intact CAAX box. A) Subcellular localization of Myc-RhoD variants in the absence and presence of EGFP-Rab5/Q79L. Myc-RhoD variants were visualized using rabbit anti-Myc antibodies followed by AMCA-conjugated anti-rabbit antibodies. EEA1 was visualized using mouse monoclonal anti-EEA1 antibodies followed by TRITC-conjugated anti-mouse antibodies. EGFP-Rab5/Q79L was visualized by the presence of EGFP. Scale bar, 20 µm. B and C) Subcellular localization of RhoD mutated in the CAAX-box. RhoD wild-type (wt) and RhoD/C207S (B), and Myc-tagged RhoD/G26V and RhoD/G26VC207S (C), were transfected into BJ/SV40T cells. Myc-RhoD variants were visualized using rabbit anti-Myc antibodies followed by AMCA-conjugated anti-rabbit antibodies. EEA1 was visualized using mouse monoclonal anti-EEA1 antibodies followed by TRITC-conjugated anti-mouse antibodies. EGFP-Rab5/Q79L was visualized by the presence of EGFP. Scale bar, 20 µm.

Download figure to PowerPoint

Depletion of RhoD or Rabankyrin-5 results in erroneous localization of endosomes

To test the cellular effects caused by the silencing of RhoD and Rabankyrin-5, we used small-interfering (si)RNAs that targeted RhoD (Figure 6A) and Rabankyrin-5 (Figure 6B). We knocked down Rabankyrin-5 in BJ/SV40T cells and analyzed the effects on the distribution of early endosomes. In the control cells, early endosome organization was normal. In contrast, the cells treated with the siRNAs that targeted Rabankyrin-5 had fewer EEA1-positive vesicles. Additionally, the vesicles accumulated in the perinuclear area (Figure 6C).

image

Figure 6. Silencing of RhoD and Rabankyrin-5 disturbs early endosome distribution. A) Human BJ/SV40T fibroblasts were treated with the control siRNA or RhoD-specific siRNAs, and stained for endogenous RhoD with rabbit anti-RhoD antibodies followed by TRITC-conjugated anti-rabbit antibodies. Scale bar, 20 µm. B) Silencing of Rabankyrin-5 in human BJ/SV40T cells using RNA interference. The presence of Rabankyrin-5 in the cell lysates was determined by western blotting using rabbit anti-Rabankyrin-5 antibodies. Mouse monoclonal anti-α-tubulin antibodies were used as the loading control. C) Localization of early endosomes in BJ/SV40T cells treated with Rabankyrin-5-specific siRNAs, determined using mouse monoclonal anti-EEA1 antibodies followed by TRITC-conjugated anti-mouse antibodies. The dotted lines mark the cell borders. Scale bar, 20 µm. D) Effect on Rabankyrin-5 and EEA1 localization in cells treated with RhoD-specific siRNAs. Rabankyrin-5 was visualized using rabbit anti-Rabankyrin-5 antibodies followed by TRITC-conjugated anti-mouse antibodies. EEA1 was visualized using mouse monoclonal anti-EEA1 antibodies followed by AlexaFluor488-conjugated anti-mouse antibodies. Scale bar, 20 µm. E and F) Subcellular localization of RhoD/wt and RhoD/G26V (E) and RhoD/G26V together with Rabankyrin-5 (F) in BJ/SV40T cells treated with Rabankyrin-5-specific siRNAs. Myc-tagged RhoD was visualized using rabbit anti-Myc antibodies followed by AlexaFluor488-conjugated anti-rabbit antibodies, and FLAG-tagged Rabankyrin-5 was visualized by mouse anti-Flag antibodies followed by TRITC-conjugated anti-rabbit antibodies. Scale bar, 20 µm.

Download figure to PowerPoint

We next analyzed the effects on Rabankyrin-5 and EEA1 localization by knocking down RhoD. In cells treated with the control siRNA, Rabankyrin-5 showed a normal cytoplasmic distribution and localization to early endosomes. However, in cells treated with the siRNAs that targeted RhoD, there were much fewer Rabankyrin-5- and EEA1-positive vesicles, and they accumulated in the perinuclear area (Figure 6D). When Rabankyrin-5 was depleted with siRNAs, the localization of exogenous wild-type or constitutively active RhoD was altered, as the RhoD-positive vesicles appeared larger and were found predominantly in the perinuclear area (Figure 6E). Importantly, this phenotype was suppressed by ectopic expression of Rabankyrin-5 (Figure 6F). Taken together, these data indicate that RhoD and Rabankyrin-5 are needed to promote the correct localization of early endosomes; however, the knocking down of either RhoD or Rabankyrin-5 does not affect the endosomal localization of the other, as they still localize to EEA1-positive vesicles.

Rabankyrin-5 is required for internalization and trafficking of the PDGF receptor

Ectopic expression of Rabankyrin-5 has previously been shown to result in increased activation of receptor tyrosine kinases [26]. To analyze the effects of RhoD and Rabankyrin-5 depletion, we transfected BJ/SV40T cells with specific siRNAs against RhoD and Rabankyrin-5, and stimulated the cells with PDGF-BB. We fixed the cells after time intervals of up to 1 h, and analyzed the internalization of PDGFRβ using an antibody against the extracellular domain of the receptor. There was a clear reduction in the receptor internalization in cells knocked down for RhoD expression (Figure 7A,B). In contrast, the knock-down of Rabankyrin-5 resulted in an initial delay in internalization, although after 60 min, the level of internalized PDGFRβ was the same as the level in the control cells (Figure 7A,B). To determine whether this effect was indeed caused by a defect in receptor internalization, we performed an assay in which the cell-surface proteins were biotinylated and isolated by Streptavidin-agarose pull-down. In control cells, PDGF-BB stimulation resulted in a rapid reduction in the cell-surface-bound PDGFRβ (Figure 7C). Interestingly, the RhoD knock-down resulted in delayed clearance of PDGFRβ from the cell surface, whereas knock-down of Rabankyrin-5 only marginally affected the kinetics of PDGFRβ internalization, as measured in this assay (Figure 7C). The effective silencing of RhoD and Rabankyrin-5 was confirmed using qPCR (Figure 7D).

image

Figure 7. Knock-down of RhoD and Rabankyrin-5 affects internalization of the PDGFβ receptor. A) BJ/SV40T cells were transfected with control, Rabankyrin-5- or RhoD-specific siRNAs. Cells were stimulated with 50 ng/mL PDGF-BB for 0, 10 and 30 min. The subcellular localization of the internalized PDGFβ receptor was visualized using mouse monoclonal anti-PDGFRβ antibodies, followed by TRITC-conjugated anti-mouse antibodies. Scale bar, 20 µm. B) Amount of internalized PDGFRβ quantified as the percentage of cells with PDGFRβ-positive internalized vesicles (i.e. cells with internalized vesicles over the total amount of cells expressed as % total). For each dataset, at least 100 cells were quantified, in triplicate. C) The amount of cell surface-bound PDGFRβ after stimulation with 20 ng/mL PDGF-BB for the times indicated, as determined by the biotinylation assay and analyzed by western blotting using anti-PDGFRβ antibodies (CTβ). D) Silencing of RhoD and Rabankyrin-5 was determined by qPCR. The expression of RhoD and Rabankyrin-5 is presented relative to GAPDH expression.

Download figure to PowerPoint

We next analyzed the signaling pathways downstream of PDGFRβ. First, we analyzed PDGFRβ activation by western blotting of cell lysates with a phosphotyrosine-specific antibody (PY99). Here, knock-down of RhoD resulted in markedly decreased tyrosine phosphorylation of PDGFRβ, which suggests decreased receptor activation (Figure 8A,D). This was further emphasized by analyzing the phosphorylation of PLCγ1. Cells treated with the RhoD-specific siRNAs showed marked reduction in PLCγ1 phosphorylation (Figure 8B). We also analyzed activation of the phosphoinositide 3-kinase (PI3K) signaling pathway by determining the phosphorylation of AKT (Figure 8C). Again, RhoD knock-down resulted in decreased AKT phosphorylation, which indicated a general decrease in receptor-tyrosine-kinase-dependent downstream signaling pathways. In contrast, Rabankyrin-5 knock-down resulted in a marginal decrease in the activation of the PDGFRβ-dependent signaling pathways.

image

Figure 8. Knock-down of RhoD and Rabankyrin-5 affect the activity of tyrosine kinase receptors. A) BJ/SV40T cells were transfected with control, RhoD- and Rabankyrin-5-specific siRNAs. The cells were stimulated with PDGF-BB (50 ng/mL) for the times indicated. Activated, tyrosine phosphorylated, PDGFRβ was detected by western blotting using anti-phospho-tyrosine antibodies (PY99). PDGFRβ was detected using anti-PDGFRβ antibodies. B and C) BJ/SV40T cells were transfected with control, RhoD- and Rabankyrin-5-specific siRNAs. The cells were stimulated with PDGF-BB (50 ng/mL) for the times indicated. PLC-γ1 activation was detected by western blotting using antibodies against phosphorylated PLC-γ1 (B). Total PLC-γ1 was detected using antibodies against PLC-γ1 (B). AKT activation was detected by western blotting using antibodies against phosphorylated AKT (C). Total AKT was detected using antibodies against AKT. D) Quantification of PDGF-BB-induced receptor tyrosine phosphorylation. The intensity of the bands was analyzed using the ImageJ software. Three blots for each condition were quantified and are represented as the fold-phosphorylation of the siRNA-treated cells. 1, phosphorylated status of the control cells at each time point. Error bars, SEM.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

Several lines of evidences implicate RhoD as a central player in orchestrating signaling networks that integrate cytoskeletal dynamics and membrane trafficking. However, the molecular mechanisms underlying this integration are unknown. Our studies indicate that RhoD can recruit specific downstream binding partners and thereby regulate different processes. Additionally, RhoD is likely to cooperate with other small GTPases in the control of endosomal trafficking. For instance, overexpression of constitutively active Rab5 has been shown to lead to increased endosomal vesicle movement, as well as vesicle fusion, which can result in the formation of large perinuclear endosomes [1, 8]. Expression of constitutively active RhoD inhibited this Rab5-dependent effect and resulted in the formation of smaller, more spherical and scattered endosomes [8]. This RhoD-dependent effect on endosome trafficking was also observed independently of Rab5 overexpression, which indicates that RhoD activity alone is required for the disturbed endosomal movement.

Rabankyrin-5 is not the only RhoD-binding protein with an identified role in endosomal trafficking. RhoD has been shown to bind and relocalize the Diaphanous-related formin (DRF) hDia2 to endosomal membranes, and hDia2 is required for the RhoD-dependent block of the endosomal movement. Overexpression of RhoD and hDia2 also promotes the relocalization of the non-receptor tyrosine kinase c-Src to endosomal vesicles, along with potent stimulation of c-Src activity [16]. RhoD-positive endosomes were shown to have a striking alignment along actin filaments, which suggests that the block in endosome movement is due to an increased association of the vesicles to actin filaments [16]. It is likely that DRFs, such as hDia2C, can collaborate with Rabankyrin-5 in the control of endosomal trafficking.

The identification of Rabankyrin-5 as a RhoD-binding partner provides a novel and important clue to the role of RhoD in endosomal trafficking. Rabankyrin-5 has been shown to localize to early endosomes and to apical macropinosomes in epithelial cells [24]. Studies by Schnatwinkel et al. [24] showed that transient transfection of Rabankyrin-5 in NIH3T3 fibroblasts and in MDCK epithelial cells resulted in an increased number of macropinosomes and increased fluid-phase uptake. In contrast, knock-down of Rabankyrin-5 reduced these processes.

RhoD has a profound effect on the organization of the actin filament system [8, 14]. The mechanisms underlying this control are not clear, but RhoD has been shown to interact with the DRF mDia1, which is known to be a key denominator in the regulation of actin polymerization [18, 27]. Surprisingly, the main role of mDia1 downstream of RhoD appears to be linked to the regulation of cell-cycle progression and centrosome duplication, rather than to the regulation of actin dynamics [18]. Previously, we observed that RhoD binds to the actin nucleation-promoting factor WHAMM and the FilaminA-interacting protein FILIP1. Together with these binding partners, RhoD forms a signaling pathway that regulates cell attachment and cell migration [22].

There is clear correlation between endocytosis and cell signaling [28]. The controlled internalization of transmembrane receptors constitutes an important step in the regulation of the activity of these receptors. There is also crosstalk between the endocytosis machinery and the apparatus that regulates cell migration [1]. In addition to RhoD, a few other members of the Rho GTPases have been shown to contribute to the control of membrane trafficking. For instance, Rac1 was shown to stimulate membrane ruffling as well as micropinocytosis [29]. Cdc42 has a role in the regulation of polarized transport of vesicles and also in the establishment of apical to basal polarity in epithelial cells [3, 4]. Moreover, the atypical Rho GTPase RhoBTB2 has been proposed to have a role in endocytosis [30]. In addition, RhoB has been shown to regulate the endosomal targeting of receptor tyrosine kinases, such as EGF and PDGFRβ [7, 31-33].

Interestingly, RhoB has been shown to work in consort with RhoD in membrane targeting and activation of the non-receptor tyrosine kinases Src, Yes and Fyn [6]. We found that knock-down of RhoD, and to some extent of Rabankyrin-5, resulted in defective PDGFRβ internalization and the subsequent decrease in the activation of PDGFRβ. Importantly, we observed mutual dependency of RhoD and Rabankyrin-5, as the knock-down of either of these two proteins resulted in markedly disturbed subcellular localization of the other of these proteins. This suggests that RhoD and Rabankyrin-5 can, at least to a certain extent, be hypothesized to act in the same pathway in endosomal positioning, but that they function distinctly from each other in their regulation of PDGFRβ dynamics.

Several binding partners of the Rho GTPases have dual roles in actin regulation and membrane dynamics, such as the WASP family proteins and the F-BAR proteins [1]. Previously, we have shown that knocking down the CIP4 family of F-BAR proteins results in decreased internalization of PDGFRβ [34]. In this study, we show that the prolonged cell-surface exposure of PDGFRβ results in increased receptor activation, as well as in an increased and sustained formation of PDGF-BB-induced dorsal ruffles in fibroblasts [34]. RhoD knock-down appears to have the opposite effects on receptor activation, indicating that the underlying molecular mechanisms are different. It is clear that membrane trafficking and cytoskeletal dynamics are processes that need to be coordinated. RhoD constitutes an attractive candidate as a master regulator for the integration of these processes.

Our studies demonstrate that RhoD and Rabankyrin-5 have a critical role in the control of endocytosis. The interaction between Rabankyrin-5 and RhoD is independent of the GTP-loaded status of RhoD. The localization of RhoD to early endosomes is dependent on the membrane targeting CAAX box, rather than on its GTP-loaded status, whereas GDP-loaded Rab5 does not localize to early endosomes. Interestingly, recent observations indicate that RhoD is regulated in yet another fashion compared to the classical Rho GTPases, as its intrinsic nucleotide exchange activity is much greater [35]. Thus, it is unlikely that RhoD is regulated by GEFs and GAPs, which is in contrast to the classical Rho members RhoA, Rac1 and Cdc42. Rabankyrin-5 might function as a RhoD regulator, by sequestration of RhoD, and the consequent modulation of its activity. Furthermore, it is probable that Rabankyrin-5 communicates with other RhoD-binding partners, such as WHAMM, in the control of vital cellular processes, such as cell migration, although this remains to be defined pending further studies.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

Antibodies, reagents and constructs

The following antibodies were used: mouse anti-Myc (9E10) (Convance); monoclonal mouse anti-Flag (M2) (Sigma-Aldrich); rabbit anti-Myc, mouse anti-phospho-tyrosine (PY99) and rabbit anti-PDGFRβ (Santa Cruz Biotechnology); mouse anti-EEA1 (BD Biosciences); rabbit anti-GFP (Invitrogen); rabbit anti-RhoD (Sigma-Aldrich); rabbit anti-Rab5, rabbit anti-phospho-PLCγ1, rabbit anti- PLCγ1, rabbit anti-phospho-AKT and rabbit anti-AKT (Cell Signaling); TRITC-conjugated anti-mouse (Jackson ImmunoResearch Laboratories), and aminomethylcoumarin acetate (AMCA)-conjugated anti-rabbit and anti-mouse (Jackson). A rabbit polyclonal antiserum against PDGFRβ was raised against a GST fusion protein containing the COOH-terminal amino-acid residues of PDGFRβ (CTβ). Mouse monoclonal anti-PDGFRβ was a generous gift from Kristoffer Rubin, Uppsala University, Sweden. Rabbit polyclonal anti-Rabankyrin-5, and EGFP-tagged cDNAs of Rab5, Rab7 and Rab11, murine RhoD wild-type, RhoD/G26V and RhoD/T31N were generous gifts from Marino Zerial, Max Planck Institute, Dresden, Germany. Human Rabankyrin-5 (KIAA1255) was acquired from Kazusa Institute, Japan. The full-length cDNA and deletion mutants of Rabankyrin-5 were subcloned into the pRK5-FLAG vector and the pGEX-2T vector. The murine RhoD variants were subcloned into the pRK5-Myc vector. The construction of pRK5Myc encoding the different mutants of Cdc42/Q61L, Rac1/Q61L, RhoA/Q63L and Rif/Q77L has been described previously [14]. Recombinant human PDGF-BB was generously provided by Amgen (Thousand Oaks, CA, USA).

Yeast two-hybrid screening

The Saccharomyces cerevisiae strain Y190 (genotype; MATa, gal4-542, gal80-538, his3, trp1-901, ade2-101, ura3-52, leu2-3, 112, URA3::GAL1-LacZ, Lys2::GAL1-HIS3cyhr) was transformed with a cDNA encoding the human RhoD/G26V fused to the GAL4 DNA-binding domain (GAL4DB) in the pYTH6 vector. The screening has been described before [22].

Cell culture, transfection and immunoprecipitation

HEK293T cells and human foreskin BJ fibroblasts stably transfected with hTERT and SV40 Large T antigen (BJ/SV40 cells) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) penicillin-streptomycin. The cells were cultured at 37C in an atmosphere of 5% CO2. The cells were transfected using JetPEI reagents (PolyPlus Transfection), according to the protocol provided by the manufacturer.

For the immunoprecipitation, the transiently transfected cells were lysed on ice in Triton X-100 buffer (20 mm HEPES, pH 7.5, 100 mm NaCl, 1% Triton X-100, 10% glycerol, 5 mm EDTA, 1% aprotinin) 48 h post transfection. The lysed cells were collected in microcentrifuge tubes and centrifuged for 15 min at 4°C. The supernatants were incubated together with the primary antibodies for 1 h, after which the immunoprecipitates were collected on protein G-Sepharose (GE Healthcare) or protein A-Sepharose (Immunosorb A, Medicago) for 1 h at 4°C. The beads were washed three times with Triton X-100 buffer and subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE); subsequently they were transferred to nitrocellulose (Hybond C, GE Healthcare).

Immunoblotting analyses were performed with the antibodies as specified in the Figure legends, followed by horseradish-peroxidase-conjugated anti-mouse or anti-rabbit antibodies (GE Healthcare). The western blots were revealed using the Luminol immunoblotting reagent (Santa Cruz Biotechnology).

RNA interference

The BJ/SV40T and COS-1 cells were seeded on coverslips and transfected using the Lipofectamine or JetPEI reagents. The knock-down of RhoD and Rabankyrin-5 expression was triggered by transfection of the BJ/SV40T cells with 20 nm specific or control siRNAs; for RhoD, the siRNA sequences were: CGGUGUUUGAGCGGUACAUtt, as RhoD siRNA#2; and GAAGUGAAUCAUUUCUGCAtt, as RhoD siRNA#3. For Rabankyrin-5, the siRNA sequences were: GGACUUCAUUUGAUGAGAAtt, as Rabankyrin-5 siRNA#1; GAAACUAGCAAAUCGGUUUtt, as Rabankyrin-5 siRNA#2; and GUACAGCGAUCUGAAGAUAtt Rabankyrin-5, as Rabankyrin-5 siRNA#3. A control siRNA was also used (Ambion-Life Technologies). We also used Mission esiRNA against RhoD (RhoD siRNA#1; Sigma-Aldrich, EHU039171). The SilentFect transfection reagent (BioRad) was used for siRNA transfections. The cells were left overnight and then transfected with a plasmid encoding Myc-tagged RhoD, using the JetPei procedure described above.

Immunocytochemistry

The cells were fixed in 3% paraformaldehyde in PBS for 25 min at 37°C, and washed with PBS. The cells were then permeabilized in 0.2% Triton X-100 in PBS for 5 min, washed again in PBS and incubated in 5% FBS in PBS for 30 min at room temperature. The primary and secondary antibodies were diluted in PBS containing 5% FBS. The cells were incubated with the primary antibodies and secondary antibodies for 1 h each, with washing in PBS. The coverslips were mounted on object slides using Fluoromount-G (Southern Biotechnology Associates). The cells were photographed using a Zeiss AxioCAM MRm digital camera attached to a Zeiss AxioVert 40 CFL microscope, and the AxioVision software was used for image processing.

Quantification of cellular effects

For the quantification of colocalized vesicles, 15 random microscopy images were acquired using the 63× immersion oil objective for each condition. In Figures 1D and 3D, all of the RhoD-positive vesicles in each cell were counted manually, and the proportion of RhoD-positive vesicles that were also positive for Rab5, Rab7, Rab11 (Figure 1D) and Rabankyrin-5 (Figure 3D) were determined. The manual analysis allowed us to focus the analysis on the vesicular signals, and it was done in blind. Particles below the size of 3 × 3 pixels were excluded from the analysis. In our hands, this assay functions better than any software-based analysis, as it allows the inclusion of particles of small size and with differences in fluorescence intensity. In Figure 7B, the cells containing internalized PDGFRβ-positive vesicles were counted and the proportion of the cells that contained internalized PDGFRβ was calculated. Under non-stimulated conditions, very few cells contained internalized PDGFRβ. The cells that contained more than 5 PDGFRβ-positive vesicles were considered as positive cells. The entire procedure was repeated three times, to allow for statistical analysis of the observed differences in the cell morphology. The statistical analysis was performed using Student's t-tests.

Real-time PCR

The efficiency of knock-down was tested after 96 h by RT-PCR. Total DNA-free cellular RNA was extracted from the cells treated with PDGF-BB for different periods of time using RNeasy kits (Qiagen). This was reverse-transcribed (SuperScript II RNase; Invitrogen) to create cDNA templates. The PCR was performed by using qPCR™ core kits for SYBR™ Green I (Bio-Rad), according to the manufacturer instructions. Glyceraldehyde-3-phosphate dehydrogenase was used as an endogenous control for the relative quantification of the target message. The specific primers were as follows: for RhoD, TGGTCAACCTGCAAGTGAA (forward) and GCAGGCGGTCATAGTCATC (reverse); for Rabankyrin-5, AATGTCAGCAGGACTCAGGAC (forward) and TGACCAGAGTGGATGCGATG (reverse); for glyceraldehyde-3-phosphate dehydrogenase, ATCACTGCCACCCAGAAGAC (forward) and ATGAGGTCCACCCTGTT (reverse).

Biotinylation of cell-surface proteins

The cells were serum-starved overnight and stimulated with 20 ng/mL PDGF-BB for different times at 37°C. Next, the cells were washed twice in ice-cold PBS, pH 7.4, and incubated for 1 h on ice with 0.2 mg/mL sulfo-NHS-SS-biotin (Pierce) in PBS. To inactivate the unbound sulfo-NHS-SS-biotin, the cells were treated for 5 min with 50 mm Tris, pH 8.0. The cells were then lysed, and the biotinylated proteins were precipitated with streptavidin-agarose (Sigma) for 1 h at 4°C. The beads were washed three times in lysis buffer and boiled with SDS sample buffer containing dithiothreitol. Eluted proteins were separated using SDS-PAGE and transferred to Immobilon P membranes. The membranes were blocked with 5% bovine serum albumin in PBS, and PDGFRβ was visualized and quantified by immunoblotting with PDGFRβ antibodies (CTβ).

Protein production and GST pull-down assays

GST-fusion proteins were expressed in Escherichia coli and purified on glutathione-Sepharose beads (GE Healthcare). Pull-down assays were performed essentially as described previously [14].

Acknowledgments

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

This study was supported by grants from the Karolinska Institutet (to P. A.), the Ludwig Institute (to J. L.), the Swedish Cancer Society (to P. A. and J. L.) and the Swedish Research Council (to P. A. and J. L.). We thank Katarina Reis and Magdalena Blom for critical comments on the manuscript.

References

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References