Distribution of herbicide-resistant acetyl-coenzyme A carboxylase alleles in Lolium rigidum across grain cropping areas of South Australia

Authors


Summary

Resistance to the acetyl-coenzyme A carboxylase (ACCase)-inhibiting herbicides in Lolium rigidum is widespread in grain cropping areas of South Australia. To better understand the occurrence and spread of resistance to these herbicides and how it has changed with time, the carboxyl transferase (CT) domain of the ACCase gene from resistant L. rigidum plants, collected from both random surveys of the mid-north of Southern Australia over 10 years as well as stratified surveys in individual fields, was sequenced and target site mutations characterised. Amino acid substitutions occurring as a consequence of these target site mutations, at seven positions in the ACCase gene previously correlated with herbicide resistance, were identified in c. 80% of resistant individuals, indicating target site mutation is a common mechanism of resistance in L. rigidum to this herbicide mode of action. Individuals containing multiple amino acid substitutions (two, and in two cases, three substitutions) were also found. Substitutions at position 2041 occurred at the highest frequency in all years of the large area survey, while substitutions at position 2078 were most common in the single farm analysis. This study has shown that target site mutations leading to amino acid substitutions in ACCase of L. rigidum are widespread across South Australia and that these mutations have likely evolved independently in different locations. The results indicate that seed movement, both within and between fields, may contribute to the spread of resistance in a single field. However, over a large area, the independent appearance and selection of target site mutations conferring resistance through herbicide use is the most important factor.

Introduction

Lolium rigidum Gaud. (annual ryegrass) is the most significant weed of Australian crop production systems (Neve & Powles, 2005), making it the most targeted weed species for control in grain production in South Australia. Herbicides are widely used to control this weed in crop production systems, due to their efficacy, ease of use and cost-effectiveness. The grass-selective acetyl-coenzyme A carboxylase (ACCase)-inhibitors have been particularly widely used. However, the intensive use of herbicides has resulted in the evolution of widespread herbicide resistance, with L. rigidum populations in Australia having evolved resistance to at least nine dissimilar herbicide chemistries (Preston et al., 1996).

Acetyl-coenzyme A carboxylase is the rate-limiting enzyme in fatty acid biosynthesis, catalysing the carboxylation of acetyl-CoA to produce malonyl-CoA (Post-Beittenmiller et al., 1992). Plants contain two isoforms of ACCase: a cytosolic ACCase located in the cytosol and a plastidic ACCase found in chloroplasts (Konishi & Sasaki, 1994). Unlike dicotyledonous plants, in which the plastidic ACCase is a multisubunit protein complex, the ACCase gene in Gramineae is a single multifunctional enzyme encoded by one large nuclear gene and containing three distinct functional domains: a biotin carboxylase (BC), a biotin-carboxyl-carrier protein (BCCP) and a carboxyl transferase (CT) (Gornicki et al., 1994; Konishi et al., 1996). This difference allows for the selective control of grasses, using classes of herbicides that specifically target the CT domain of the plastidic ACCase, inhibiting fatty acid biosynthesis and ultimately causing plant death (Sasaki et al., 1995; Herbert et al., 1996).

Three classes of ACCase-inhibiting herbicides: the aryloxyphenoxypropionates (APPs), such as diclofop-methyl and fluazifop-P-butyl, the cyclohexanediones (CHDs), such as tralkoxydim and clethodim (Secor et al., 1989; Devine, 1997), and the phenylpyrazoles, such as pinoxaden (Muehlebach et al., 2009), have been commercialised in Australia. Since their introduction in the late 1970s, ACCase-inhibiting herbicides have been used worldwide to selectively control grass weed species and were quickly adopted as the main herbicide to target L. rigidum in winter cereal crops in Australia (Powles & Yu, 2010). As a consequence of the extensive use of herbicides from this mode of action, resistance to these herbicides has rapidly evolved in many grass weed species (Délye, 2005), with the first case of resistance to an ACCase inhibitor in L. rigidum identified in South Australia in 1982 (Heap & Knight, 1982).

Previous studies have shown one major cause of ACCase-based resistance to be mutations in the CT domain of the ACCase gene leading to single amino acid substitutions in the plastidic ACCase. These changes reduce herbicide binding or interaction with ACCase, endowing resistance in many grass weed populations (Devine & Shukla, 2000; Délye, 2005; Powles & Yu, 2010). Resistance can also be due to other mechanisms, such as enhanced herbicide metabolism (Holtum et al., 1991; Devine, 1997) and herbicide sequestration (Holtum et al., 1994). However, these forms of resistance have been less frequently reported.

The increasing incidence of L. rigidum populations with resistance to the ACCase-inhibiting herbicides in southern Australia has raised issues about the selection and spread of resistance in this weed species. Lolium rigidum is an obligate outcrossing weed species with wind dispersed pollen. Pollen-mediated gene flow has been reported to occur over distances of up to 3000 m (Busi et al., 2008). The seeds of this species can also move in farm equipment, produce and livestock (Baker & Preston, 2008). To address some of these issues, we sequenced almost the entire CT domain of ACCase from a large number of herbicide-resistant individuals to determine the mutations that were present. The aim of this research was to determine the pattern of mutations in ACCase in L. rigidum populations at a landscape scale and its evolution over a period of 10 years. In addition, we examined the pattern of target site mutations occurring in three adjacent fields to determine the potential role of seed and pollen movement in spreading herbicide resistance between fields.

Materials and methods

Collection of plant material

Surveys of farmers' fields were conducted through the mid-north region of South Australia in 1998, 2003 and 2008 (Boutsalis et al., 2012). Sampling was performed just prior to crop harvest, once L. rigidum seed had matured. Fields were selected at random and without any prior knowledge of the herbicide history, by travelling on minor roads and stopping approximately every 5 km. In the 1998 survey, 196 fields were sampled. In 2003, 187 fields were sampled, and in 2008, 270 fields were sampled. An area of c. 1–2 ha within a single field was walked using an M pattern starting 10 m in from the edge of the crop. Mature spikes were collected from individual L. rigidum plants encountered. When L. rigidum occurred in large patches, about 20 spikes were collected from the patch. Sampling was discontinued once about 100 spikes had been collected or after 30 min, whichever occurred first. Spikes were placed in labelled paper bags, and the GPS location of the field recorded. All spikes from one field were pooled and designated as a single population. The samples were stored at the Waite Campus, University of Adelaide, for 2 months over summer to allow the seed samples to completely dry and break dormancy. The seeds where then cleaned by hand or mechanical threshing and stored in plastic bags at room temperature.

In a separate survey, three neighbouring fields at the Roseworthy Campus, University of Adelaide, were intensively sampled in 2003. The entire fields were walked in 10 m strips, and individual L. rigidum plants encountered were collected. Where plant densities were high, one plant every 10 m was collected. From Field 1, 67 individual L. rigidum plants were collected, from Field 2, 274 and from Field 3, 30. The GPS location of every sample collected was recorded.

Plant growth and resistance testing

For each survey population, 0.2 g (50–60) seed was sown directly into 0.55 L square pots using standard potting mix and grown outdoors at the Waite Campus, University of Adelaide. One standard susceptible and one resistant L. rigidum population, VLR1 and SLR31 (Burnet et al., 1994; Preston & Powles, 1998), respectively, were used as negative and positive controls. Diclofop-methyl (Hoegrass EC500, Bayer CropScience) at 500 g a.i. ha−1 (standard field rate) was applied to the plants at the 2- to 3-leaf stage. The herbicide was applied using a laboratory moving boom pesticide applicator and applied in the equivalent of 109 L ha−1 water at a pressure of 250 kPa and a speed of 1 m s−1 using Tee-Jet 001 nozzles (Tee-Jet 8001E Spraying System Co., Wheaton, IL, USA). Plants surviving 2–3 weeks after herbicide application were considered resistant. From each population where survivors occurred, fresh leaf material (c. 1 cm2) was harvested from young leaves of a single randomly selected individual plant, snap frozen in liquid nitrogen and stored at −80°C.

For the Roseworthy field samples, 20 seeds from each individual plant collected from the intensive surveys (371) were germinated on either 0.6% agar or 0.6% agar containing 5 μm fluazifop-p butyl (Fusilade Forte 128EC, Syngenta) in a controlled environment cabinet (15°C, 12 h dark period; 20°C, 12 h light period at 30 μmol m−2 s−1). If over 50% of the seeds germinated and survived for 7 days on the herbicide-containing media, the mother plant was considered resistant. If the mother plant was resistant, the surviving seedlings were harvested, wrapped in foil, snap frozen and stored at −80°C. For susceptible individuals, seedlings from the control treatment were harvested. A subsample of resistant and susceptible individuals were transplanted into soil and at the 2- to 3-leaf stage treated with 53 g a.i ha−1 fluazifop-P-butyl (standard field rate) to confirm resistance. All of the resistant individuals survived this treatment, whereas all the susceptible individuals were killed. The ACCase gene of a subset of 50 resistant mother plants collected from the survey, along with several susceptible individuals was sequenced, using tissue from the seedlings.

Sequencing of ACCase gene

DNA was extracted using the DNeasy Plant Mini Kit (Qiagen, Australia) according to the manufacturer's instructions. The concentration of nucleic acids was determined spectrophotometrically on a NanoDrop ND-1000 (Thermo scientific, USA) at 260 nm.

Standard PCR conditions and primers designed against the Alopecurus myosuroides (accession number AJ310767) ACCase gene sequence (Table 1) were used to amplify a 1.5 kb fragment covering nearly the entire CT domain without any intron. The range of amino acids covered by the fragment was equivalent to codons 1658–2157 in Alopecurus myosuroides Huds. A nested PCR approach was employed with oligo set Acclr9 and Acclr6 (Zhang & Powles, 2006), followed by oligo set AccCT 2F and AccCT 2R. PCR reactions of 25 μL contained 20 ng DNA, 1 × High-Fidelity buffer [60 mm Tris-SO4 pH 8.9, 18 mm (NH4)2SO4], 2 mm MgSO4, 0.2 mm each dNTP, 0.2 μm of each specific primer and one unit Platinum Taq High-Fidelity DNA Polymerase enzyme mix (Invitrogen, Australia). Amplification was carried out in an automated DNA thermal cycler (Eppendorf Mastercycler® Gradient, Germany) with PCR conditions as follows: 3 min denaturing at 94°C then 35 cycles of 30 s denaturation at 94°C, 30 s annealing at 56°C and 2 min elongation at 68°C and a final extension for 7 min at 68°C.

Table 1. Primer sequences used for amplification and sequencing of the CT domain of the ACCase gene in Lolium rigidum from genomic DNA. Primers amplify a 1497 bp fragment covering codons equivalent to 1658–2157 in Alopecurus myosuroides
 PrimerSequence
Round 1Acclr95′- ATGGTAGCCTGGATCTTGGACATG -3′
Acclr65′- GGAAGTGTCATGCAATTCAGCAA -3′
Round 2AccCT 2F5′- CCACTCCTGAATTTCCCAGTGG -3′
AccCT 2R5′- CGCGATTTGAGTGTACAAAGGCTG -3′
SequencingAccCT MidF5′- CCTGAGAATACATGTGATCCTCGTG-3′
AccCT MidR5′- CCATTTCCCTTGGCTGTCATCAATGCC-3′

PCR products were visualised on ethidium bromide-stained (1 mg mL−1) 1.5% agarose gels and prepared with 1 × Ficoll loading dye [15% (w/v) Ficoll 4000, 0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol FF]. Samples were electrophoresed in 1 × TAE Buffer [40 mm Trizma base, 1 mm Na2EDTA, pH to 8 with glacial acetic acid] at 100 volts and photographed under UV light (λ302 nm). DNA fragment sizes were estimated by comparing their mobility to bands of known sizes in a low mass molecular weight marker (Invitrogen, Australia). PCR products were sequenced (Australian Genome Research Facility, Australia) using primers CT Mid F and CT Mid R (Table 1) to obtain sequence data covering the full CT domain fragment.

Nucleotide sequences were analysed using the VectorNTi ContigExpress and AlignX software programmes (Invitrogen, USA) and all sequences visually rechecked using the chromatogram files.

Results

Prevalence of Resistance

The random surveys of the mid-north cropping region of South Australia over 3 years, 1998, 2003 and 2008, detected L. rigidum present in over 85% of the fields surveyed in 1998 and over 90% of fields by 2008 (Table 2). At least one individual surviving 500 g ha−1 diclofop-methyl was observed in 66–71% of the populations across the three surveys.

Table 2. Frequency of mutations. Number of fields surveyed and the number of surveyed fields containing any Lolium spp. and resistant Lolium spp. The number of resistant plants sequenced, and the percentage of those resistant individuals with no, one or two different amino acid substitutions in each sampling year, and the percentage of total alleles carrying target site mutations
 Fields surveyedFields with ryegrassFields containing resistant individualsNo. R plants sequencedTarget site mutation (%)Total R alleles (%)
NoneOneTwo
19981961671191172470647
200318716311411017612256
200827025016515911662363

The conserved CT domain of the ACCase gene of L. rigidum was sequenced from a single resistant plant from each population from the random surveys that contained any individuals resistant to diclofop-methyl. Nucleotide sequences from all populations were compared with each other, as well as to the standard susceptible population, VLR1. The presence of amino acid substitutions in seven previously characterised positions in the CT domain, known to be associated with resistance to ACCase-inhibiting herbicides (Powles & Yu, 2010), was analysed. The amino acid positions investigated were 1781, 1999, 2027, 2041, 2078, 2088 and 2096, according to the sequence of A. myosuroides ACCase (Délye, 2005). Usable sequences of the CT domain of ACCase were obtained from 117 resistant individuals from the 1998 collection, 110 resistant individuals from the 2003 collection and 159 resistant individuals from the 2008 collection. Of the resistant individuals sampled, 76% of the 1998 collection contained at least one of the known amino acid substitutions. This increased to almost 90% of resistant individuals from the 2008 collection. About 65% of individuals in all years had only a single amino acid substitution at one position in the CT domain, but by 2008, 23% of individuals had a second substitution at a different position in the CT domain (Table 2). Due to the technique used, it could not be determined whether these two individual target site mutations, leading to two separate amino acid modifications in ACCase, occur on separate ACCase alleles or both on the same allele. However, it is likely that in most cases they would occur on separate alleles.

The greatest number of individuals in each year had amino acid substitutions at position 2041 in the ACCase protein. This was followed by substitutions at amino acid 2078. Substitutions at amino acids 1999 and 2096 were not found in the 1998 collection, but were present in the other 2 years. Between 1998 and 2008, there was a decrease in the frequency of substitutions at amino acid 2027 and 2041, but an increase in the frequency of substitutions at all other amino acid positions, with the largest increase at position 1781 (Table 3).

Table 3. Percentage of mutant alleles and amino acid substitution. Percentage of alleles with target site mutations in each sampling year at each of seven amino acid positions within ACCase previously characterised as endowing resistance to ACCase-inhibiting herbicides
 1781 Leu1781 Val1999 Cys1999 Leu2027 Cys2041 Asp2041 Val2041 Thr2078 Gly2088 Arg2088 Phe2096 Ala
1998 (%)9000124604171200
2003 (%)1202193430271101
2008 (%)1721143520201413

The distribution of amino acid substitutions in the landscape across the years showed no obvious patterns or clustering (Fig. 1). At the scale of this survey, it was not possible to identify any patterns of spread of ACCase resistance in Lrigidum.

Figure 1.

Distribution and amino acid substitution type of resistant populations across the mid-north of South Australia in (A) 1998, (B) 2003 and (C) 2008.

Single field analysis

Three adjacent fields at the Roseworthy Campus at the University of Adelaide, Australia, that had been managed using typical farming practices for the district for numerous years, were surveyed in detail for L. rigidum. Two of the three fields surveyed were found to contain L. rigidum resistant to fluazifop-p butyl (Fig. 2), but resistance was not detected in the third field. Of the 67 individuals collected from Field 1, 9% were resistant. A total of 274 L. rigidum plants were collected from Field 2 and 34% were resistant. A total of 30 plants were collected from Field 3 with no resistance detected.

Figure 2.

Resistance distribution in three fields at Roseworthy. The location and amino acid substitution(s) in ACCase of each resistant individual.

A subset of 50 resistant individuals were sequenced from Fields 1 and 2 (6 from Field 1 and 44 from Field 2), with 47 containing at least one amino acid substitution in the previously characterised positions in the CT domain. Substitutions were only found in four of the seven known positions; 1781, 2041, 2078 and 2088, with over half of the individuals (25) having a single substitution at position 2078. Only three other individuals had a single substitution, occurring at position 2041, while all other individuals had two amino acid substitutions, except for two individuals, which had three. The positions and amino acid substitutions in the first individual containing three different substitutions were 1781-Leu, 2041-Asp and 2078-Gly, and in the second individual, they were 2041-Asp, 2078-Gly and 2088-Arg (Table 4). Plants containing a single substitution at 2041 appeared to be clustered together, occurring in only one area of one field, Field 1. Most other resistance alleles seemed to be widespread and did not occur in clusters (Fig. 2).

Table 4. Number of mutant alleles and amino acid substitution in individuals of the single field analysis. Number of individuals and type of amino acid substitution or combination of substitutions
Amino acid substitutionNo. of individuals
2078Gly25
2041Asp3
2041Asp/2078Gly11
2078Gly/2088Arg5
1781Leu/2041Asp1
1781Leu/2041Asp/2078Gly1
2041Asp/2078Gly/2088Arg1

Discussion

Lolium rigidum populations resistant to ACCase-inhibiting herbicides are widespread in the grain cropping region of South Australia. Target site mutations causing amino acid substitutions in ACCase were detected in the majority of the resistant individuals surveyed, ranging from 76% of individuals in 1998–89% of individuals in 2008. In addition to the seven sites within the CT domain of ACCase where amino acid substitutions are known to result in resistance to ACCase-inhibiting herbicides (Powles & Yu, 2010), amino acid substitutions were observed at a further 12 sites within the CT domain (data not shown). Substitutions at these uncharacterised positions were found in both resistant individuals that had a substitution at one or more of the seven known positions and resistant individuals that did not contain substitutions at any of the known positions. At present, it is not known whether any of these substitutions would result in resistance to herbicides. If they did, the frequency of individuals with target site mutations to ACCase-inhibiting herbicides would be higher.

The molecular analysis indicates that target site mutations in the ACCase gene occur at high frequencies in L. rigidum in the mid-north cropping region of South Australia. While these target site mutations have been shown to endow resistance to ACCase-inhibiting herbicides, not all amino acid substitutions within the seven previously characterised sites endow resistance to all ACCase-inhibiting mode-of-action herbicides, with different ACCase amino acid substitutions/combinations endowing different levels and patterns of ACCase herbicide resistance (Yu et al., 2007). For example, it has been demonstrated by Yu et al. (2007) that resistance to the field rate of diclofop in Australian L. rigidum populations is endowed by 1781-Leu, 2078-Gly or 2088-Arg substitutions, but no data regarding resistance of L. rigidum to diclofop are available for the other mutations. However, there is evidence of a link between diclofop resistance and substitutions at positions 2027, 2041 and 2096 in other grass weed species (Délye et al., 2003; Cruz-Hipolito et al., 2012; Gherekhloo et al., 2012). Similarly, this study identified a mutation at a position previously not identified in L. rigidum, position 2096 (Powles & Yu, 2010). In addition, previously uncharacterised amino acid substitutions were found at some of the mutation sites, namely 2041-Thr and 2088-Phe. As yet, these have not been proven to endow resistance.

Lolium rigidum populations in Australia have also been shown to contain non-target site mechanisms endowing resistance to ACCase-inhibiting herbicides, specifically enhanced herbicide detoxification (Holtum et al., 1991; Preston et al., 1996; Yu et al., 2013). Indeed, it is possible to have target site and non-target site resistance mechanisms co-occurring in the same population of L. rigidum (Preston et al., 1996). Non-target site resistance was not investigated in this study, but is probably responsible for resistance in individuals where no amino acid substitution in ACCase was identified. Non-target site resistance may also be present as an additional mechanism in individuals containing ACCase mutations.

While target site mutations were commonly found in L. rigidum populations in this study, surveys conducted in Europe for A. myosuroides found a majority of resistant individuals contained no mutation within ACCase, suggesting a metabolic-based resistance mechanism was the major contributor to resistance (Menchari et al., 2006; Délye et al., 2007, 2010b). It is not clear why this difference occurs, but it may be the result of intrinsic differences between the weed species, or the result of different patterns of herbicide usage and selection intensity between the two cropping systems. As would be expected due to the lower frequency of amino acid substitutions in ACCase in the A. myosuroides from France, there were fewer individuals, 0.9%, containing two different amino acid substitutions in ACCase (Délye et al., 2007, 2010b), than observed in the L. rigidum surveys from South Australia (Table 2). As only one individual from each population was sequenced in this study, the full number of substitutions present within a population could be higher, for example as seen in Roseworthy Fields 1 and 2. Several different types of mutant ACCase alleles within a population would increase the probability of finding individuals with more than one amino acid substitution and supports previous findings of complex composition in target site mutations in this species (Yu et al., 2007).

The most common amino acid substitution in ACCase found in L. rigidum populations in South Australia was at amino acid 2041, with between 37% and 50% of all substitutions observed at this position. In contrast, surveys of A. myosuroides in France reported more than 50% of substitutions in ACCase were at amino acid 1781 (Délye et al., 2007, 2010b). In the latter study, substitutions at amino acid 2041 accounted for <13% of those detected. As mentioned earlier, intrinsic differences between the two species or differences in herbicide use and selection history between France and South Australia may be the reason for selection of the different amino acid substitutions observed within ACCase.

Between 1998 and 2008, there has been an increase in the frequency of L. rigidum populations in South Australia with resistance to the cyclohexanedione herbicides, in particular with clethodim, an herbicide used in dicotyledonous crops (Boutsalis et al., 2012). Despite this change, there were no dramatic shifts in the frequency of individual amino acid substitutions observed (Table 3). The frequency of amino acid substitutions at 2027 and 2041 decreased, while the frequency of all other amino acid substitutions, especially 1781, increased. Plants homozygous for mutations at 1781, 2078 and 2088 in their two ACCase alleles have been shown to be resistant to clethodim. However, these same mutant alleles also confer cross-resistance to diclofop (Yu et al., 2007). The increase in amino acid substitutions at position 1781 and the increase in individuals with 2 or more different substitutions within ACCase may be contributing to the increased frequency of clethodim resistance. A large increase in the frequency of individuals containing two amino acid substitutions in resistant L. rigidum individuals occurred between 1998 and 2008 (Table 2). It is likely that continued selection of populations with ACCase-inhibiting herbicides has resulted in the accumulation of different resistant ACCase alleles in the same plant, or possibly additional target site mutations occurring within the same allele, and this may be contributing to the increase in clethodim resistance in populations.

The change in frequency of individual alleles is likely to be a complex interaction between changing herbicide choices by growers and fitness of individual plants carrying resistance alleles. The different mutant alleles have different levels of resistance to different ACCase-inhibiting herbicides (Yu et al., 2007). However, it is also known that some alleles carry a measurable fitness penalty. The 2078-Gly mutation has been shown to be associated with a fitness cost in A. myosuroides (Menchari et al., 2008). However, the 1781-Leu mutation does not appear to be associated with a fitness penalty and was found to be advantageous in a Setaria spp. mutant (Wang et al., 2010). The increase in the frequency of mutant 1781 alleles seen in this study is consistent with having no associated fitness penalty.

Resistance was widespread across the mid-north of South Australia, and the distribution of different mutant allele types appeared random, with no distinctive clustering or pattern. This suggests multiple, independent appearances of each type of mutant ACCase alleles and that spread of resistance has not occurred from a single individual population or area, which is a common misconception of farmers. However, this does not preclude local, or indeed long-distance, movement of resistance alleles by seed having occurred. Menchari et al. (2006) came to similar conclusions regarding the origin of resistant populations of A. myosuroides in France. In contrast, Délye et al. (2010a) concluded massive pollen flow connected adjacent populations of A. myosuroides in cropped fields in France.

The hypothesis that resistance to ACCase-inhibiting herbicides has been selected multiple times in the mid-north region of South Australia is further supported by the single field analysis, where amino acid substitutions at four of the seven known positions in the CT domain of ACCase were identified (Table 4). This suggests several evolutionary events can be present within a single field. In addition, no resistance was found in Field 3, despite this field being immediately across a road from Field 2. This last observation demonstrates that even though large numbers of herbicide-resistant L. rigidum plants may occur in one field, they do not necessarily infect adjacent fields, even with an obligate outcrossing species such as L. rigidum. Despite these observations, there was some evidence that was consistent with spread of resistance, within Field 2, where there was clustering of resistant individuals carrying the same amino acid substitution in ACCase within parts of the field. The results indicate that in an individual field, independent selection, cross-pollination and seed movement are contributing to the distribution of resistance observed. Secondly, the distribution of resistant individuals also appeared to be more concentrated around entrance gates, which are high traffic areas, and suggest seed spread via machinery, human or livestock movement. Lastly, there was also a very high percentage of individuals containing two different amino acid substitutions within the ACCase (36%), and two individuals containing three different substitutions, which would suggest cross-pollination of individuals that had evolved a single target site mutation in ACCase. Two individuals contained three substitutions in ACCase, all in the heterozygous state. Lolium rigidum is a naturally diploid species (Terrell, 1966), which suggests an unusual event where there are two separate target site mutations on the same ACCase allele. However, this remains to be verified. In a highly variable and outcrossing species, spread over a large area and heavily selected with herbicides, such unusual events may be expected.

Conclusions

Target site mutations within ACCase are common in populations of L. rigidum resistant to ACCase-inhibiting herbicides in South Australia. Over the 10-year period between 1998 and 2008, there have been some changes in the frequencies of target site mutations observed. Over the same period, there has been a substantial increase in the frequency of individuals carrying multiple target site mutations. As resistance was widespread and individual fields could contain more than one mutant ACCase allele, continued selection of these populations with ACCase-inhibiting herbicides will probably result in an increase in the frequency of individuals containing two or more different target site mutations, leading to a wider spectrum of resistance across the ACCase-inhibiting herbicides. Therefore, growers should seek other methods for managing these resistant populations. The evidence for seed spread in the Roseworthy fields suggests better farm hygiene should also play a role. However, the findings also suggest that it is likely that resistance is present at some frequency in most fields and growers should adopt non-chemical weed control methods to reduce their dependence on herbicides.

Ancillary