Cysteine at Position 217 in the Intracellular Loop 1 Plays a Critical Role in Human PTH Receptor Type 1 Membrane Translocation and Function

Authors

  • Beena E Thomas,

    1. Department of Periodontology and Oral Biology, Boston University School of Dental Medicine, Boston, Massachusetts, USA
    2. Department of Orthopedic Surgery, Boston University School of Medicine, Boston, Massachusetts, USA
    Search for more papers by this author
  • Angela Wittelsberger,

    1. Department of Periodontology and Oral Biology, Boston University School of Dental Medicine, Boston, Massachusetts, USA
    2. Department of Orthopedic Surgery, Boston University School of Medicine, Boston, Massachusetts, USA
    Search for more papers by this author
  • Iwona Woznica,

    1. Department of Periodontology and Oral Biology, Boston University School of Dental Medicine, Boston, Massachusetts, USA
    Search for more papers by this author
  • Mo-Ying Hsieh,

    1. Department of Periodontology and Oral Biology, Boston University School of Dental Medicine, Boston, Massachusetts, USA
    Search for more papers by this author
  • Paul Monaghan,

    1. Department of Periodontology and Oral Biology, Boston University School of Dental Medicine, Boston, Massachusetts, USA
    Search for more papers by this author
  • Byung-Kwon Lee,

    1. Department of Aerospace and Mechanical Engineering, Boston University College of Engineering, Boston, Massachusetts, USA
    Search for more papers by this author
  • Michael Rosenblatt MD

    Corresponding author
    1. Department of Periodontology and Oral Biology, Boston University School of Dental Medicine, Boston, Massachusetts, USA
    • Department of Physiology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111, USA
    Search for more papers by this author

  • The authors state that they have no conflicts of interest.

Abstract

PTHR1 mutants lacking endogenous cysteines in transmembrane and intracellular domains were generated. Mutant receptors were tested for their biological activities and mRNA and cell surface expression levels. C217 in intracellular loop 1 was determined to play a critical role in cell surface translocation and function of the receptor.

Introduction: Elucidating the role of different domains of PTH receptor 1 (PTHR1) is essential for understanding the mechanism of ligand–receptor interactions. Here we present a study directed at determining the importance of cysteine residues present in the intracellular and transmembrane (TM) domains of the receptor.

Materials and Methods: Mutant receptors were generated by site-directed mutagenesis. Biological activities were characterized by adenylyl cyclase and competition binding assays. RT-PCR, ELISA, and immunofluorescence microscopy were carried out to determine receptor mRNA and protein expression levels.

Results: Mutations C460L and C462L in TM7, C568L in the C-terminal intracellular domain of the receptor, and removal of C397 in intracellular loop (ICL)3 by insertion of cleavage sites for Factor Xa did not affect binding affinity of PTH or agonist-induced adenylyl cyclase activity, although maximal responses (ICmax and ECmax) were decreased. However, mutations C217L in ICL1 or both C217L and C568L simultaneously resulted in a decrease in binding and loss of adenylyl cyclase activity. RT-PCR results showed that the observed changes in binding and activity were not caused by changes in mRNA expression. Next, we determined cell surface and total expression of the wildtype and mutant receptors by ELISA. We found that mutations of C460/C462 to L moderately decreased transfer of receptors to the cell surface. However, mutation of C217 to L in the ICL1 drastically reduced cell surface expression. Immunofluorescence and confocal microscopy studies confirmed reduced cell surface expression of receptors containing the C217L mutation. Similar results were obtained when replacing C217 and C460/C462 of the receptor with A instead of L.

Conclusions: Our studies indicate that the cysteine at position 217 in ICL1 plays a critical role in translocation to the cell surface and biological function of PTHR1.

INTRODUCTION

G protein–coupled receptors (GPCRs) form the largest family of membrane receptors. GPCRs are responsible for a multitude of physiological functions including bone homeostasis, neurotransmission, cardiovascular control, and blood pressure homeostasis. GPCRs have an N-terminal extracellular domain (N-ECD), a C-terminal intracellular domain (C-ICD), and seven transmembrane (TM)-spanning domains linked by alternating intracellular (ICL) and extracellular (ECL) loops. The PTH receptor (PTHR1) belongs to the class II subfamily and regulates calcium homeostasis by its action on kidney and bone.(1) Binding of the endogenous ligand, PTH, to PTHR1 stabilizes the receptor in an active conformation.(2) This leads to interaction of the intracellular regions of PTHR1, particularly ICL2 and ICL3, with Gs and Gq proteins, which results in the initiation of intracellular signaling.(3)

Cysteines are thought to play a critical role in the assembly and conformation of receptors. Of the eight cysteines present in the extracellular region of PTHR1, six were shown to form three disulfide bonds(4) that are conserved among class II GPCRs. All eight cysteines have been shown to be essential for receptor expression and function.(5,6) Human PTHR1 has five more cysteines, distributed in the ICL1, ICL3, TM7, and C-ICD (Fig. 1). Their role in receptor structure and function has not been studied. To study the role of these cysteines, we created a series of PTHR1 mutants with the cysteines either substituted by leucine or alanine or removed by introduction of an enzyme cleavage site. We assessed the expression levels and the biological function of the mutant receptors. One position, namely C217, was found to be critically important for transport and function of the receptor.

Figure Figure 1.

Topological model of the human PTHR1. The cysteines at position 217, 460, 462, and 568 were replaced sequentially with leucine or alanine. The cysteine at position 397 was omitted when Factor Xa cleavage sites were inserted in ICL3.

MATERIALS AND METHODS

Materials

Iodine-125 was purchased from Amersham Biosciences, and iodogen-coated tubes were obtained from Pierce (Rockford, IL, USA). DMEM, Opti-MEM serum-free medium, penicillin, streptomycin, FBS, and PBS were obtained from Invitrogen (Carlsbad, CA, USA). FuGENE6 was from Roche Molecular Biochemicals. Plasmid maxi and mini prep kits were from Qiagen (Valencia, CA, USA). All the 5′-phosphorylated oligonucleotides were from Invitrogen. Goat polyclonal anti-PTH/PTHrP-R antibody (E-17) and donkey anti-goat horseradish peroxidase (HRP) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Alexa Fluor 488 donkey anti-goat HRP for immunofluorescence studies was obtained from Invitrogen. GraphPad prism software was from GraphPad software (San Diego, CA, USA). All other reagents and plasticware were obtained from Fisher Scientific.

Plasmid construction

The c-myc epitope tag (EQKLISEEDL), Factor Xa sites (IEGR)2, C→L, and C→A mutations were introduced by in vitro mutagenesis into ssDNA using a modification of the Kunkel method.(7) The wtPTHR1 had been cloned into pcDNA 3.1 as previously described.(8) The requisite DNA (pcDNA 3.1 containing wtPTHR1 or mutant PTHR1) was introduced into Escherichia coli CJ236. The transformed clones were infected with λ phage (VCSM13), and ssDNA was isolated. Mutations were introduced into the ssDNA using appropriate oligonucleotide(s) containing the desired mutation by in vitro mutagenesis. E. coli DH5α cells were transformed with the mutant DNA constructs and grown in the presence of antibiotic. The authenticity of isolated clones was verified by DNA sequencing (Tufts University Core Facility, Tufts University, Boston, MA, USA).

Cell culture

Cos-7 cells were used because they do not express endogenous PTHR1. The cells were grown and maintained in DMEM supplemented with 10% FBS and 1>penicillin and streptomycin in a humidified 5% CO2 atmosphere at 37°C.

Radioiodination

The bovine PTH analog, [Nle8,18,Arg13,26,27,2-Nal23,Tyr34] bPTH-(1−34)NH2, herein referred to as bPTH, was synthesized in the laboratory and iodinated as described previously.(9) The radiolabeled bPTH analog, 125I-bPTH, was used as tracer in the receptor binding assays described below.

Binding assay

Cos-7 cells were seeded onto 24-well collagen-coated plates (BD Biocoat Cellware) at a seeding density of 60,000 cells/well. The cells were transiently transfected the next day with 200 ng/well wtPTHR1 or mutant receptor DNA using Fugene transfection reagent as described earlier.(9) Eighteen hours after transfection, the medium was replaced with DMEM containing 5% FBS. Various concentrations of bPTH were added followed by addition of 125I-bPTH at 100,000 cpm/well after 15 minutes. The plate was incubated for 2 h at room temperature, followed by a PBS washing step and lysis with 0.2N NaOH. The cells were transferred into tubes and read in a γ counter (Cobra-II; Packard Co.). The IC50 value was calculated by nonlinear regression analysis using the GraphPad Prism software. For calculating ICmax, a saturating amount (100 nM) of bPTH was used to compete with 125I-bPTH. Data sets were statistically analyzed using a two-tailed Student's t-test, assuming unequal variance among the two samples.

Adenylyl cyclase activity

Cos-7 cells were seeded as described above. The cells were co-transfected with 100 ng/well wtPTHR1 or specific mutant receptor and 100 ng/well Cre-luciferase DNA and 10 ng/well Renella luciferase DNA (acts as internal control for transfection efficiency). Eighteen hours after transfection, the minimal medium (OPTIMEM) was replaced with complete medium. The luciferase assay for measuring PTH stimulated adenylyl cyclase activity was carried out as described earlier.(9) The EC50 was calculated by nonlinear regression analysis using the GraphPad Prism software. For ECmax calculation, maximum stimulation obtained with 100 nM bPTH was subtracted from the observed basal adenylyl cyclase activity in absence of ligand. Data sets were statistically analyzed using a two-tailed Student's t-test, assuming unequal variance among the two samples.

RT-PCR

The Cos-7 cells were seeded in 6-well plates at a density of 30,000/well. The cells were transfected with wtPTHR1 or mutant PTHR1 receptors using Fugene transfection reagent the following day. Eighteen hours after transfection, total RNA was isolated from the cells using Trizol RNA isolation reagent (Sigma) and treated with DNase I. The samples were analyzed by RT-PCR using the one-step SuperScript II RT kit (Invitrogen). The sense primer used was CCGAGGTCTCAGGGACGC and the antisense primer used was CCTGGGCGATGGCGCGCAGC for PTHR1 fragment amplification. β-actin was used as the internal control with sense primer GGCATGGGTCAGAAGGATTC and antisense primer AGAGGCGTACAGGGACAGCA. The conditions used for RT-PCR were 55°C for 30 minutes, 94°C for 2 minutes, 30 cycles of 94°C for 15 s, 55°C for 30 s, and 68°C for 1 minute, and a 5-minute extension at 68°C (Hybaid PCR express thermocycler). The RT-PCR products were analyzed by running on 0.8% agarose gel and staining with EtBr.

Cell ELISA

Cells were seeded in 24-well collagen-coated plates and transfected as described for the binding assay. The medium was aspirated and cells were washed with 20% FBS in PBS (FPBS) and blocked with FPBS for 30 minutes. For total receptor expression analysis, the cells were fixed and permeabilized at this stage as described below. After the blocking step, primary antibody, goat anti-PTH/PTHrP-R antibody (E-17) was added at a dilution of 1:2000 in FPBS, and the plate was incubated at room temperature for 1 h. The cells were washed first with 1 ml FPBS and then PBS. For cell surface expression studies, the cells were fixed at this stage (i.e., after incubation with primary antibody) with 4% paraformaldehyde for 2 minutes. This was followed by permeabilization with 0.1% Triton X-100 in PBS for 5 minutes. The cells were washed with PBS. Secondary antibody, mouse anti-goat HRP, was added at a dilution of 1:5000, and the plate was incubated at room temperature for 1 h. After aspirating the secondary antibody, the cells were washed once with FPBS and twice with PBS. TMB (BioFX) was added, and the plate was developed in the dark for 30 minutes. The absorbance was quantified at 360 nm using a SpectraFluor Plus automated plate reader (Tecan, Research Triangle Park, NC, USA). Data sets were statistically analyzed using a two-tailed Student's t-test, assuming unequal variance among the two samples.

Immunofluorescence microscopy

Cos-7 cells plated at a density of 105 cells per 100-mm plate were transfected the following day with 4 μg PTHR1 or mutant receptor DNA as described.(9) Twenty-four hours after transfection, the cells were replated on 4-well chamber slides (BD Falcon) at a seeding density of 60,000 cells per chamber and allowed to adhere overnight. The cells were washed with 1>DMEM to remove serum, followed by a fixing step with 4% paraformaldehyde in DMEM for 5 minutes at room temperature. After three washing steps with PBS/azide of 5 minutes each, 1 ml of lysis buffer (50 mM HEPES, pH 7.2, 50 mM PIPES, pH 6.9, 1 mM MgCl2, 0.1 M EGTA, 75 mM KCl, 0.1% Triton X-100) was added and incubated for 90 s at room temperature. The cells were washed three times with PBS/azide for 5 minutes. The primary antibody (goat polyclonal anti-PTH/PTHrP-R antibody [E-17]) was added at a dilution of 1:50 to the chamber. The slide was incubated in a humidified chamber for 45 minutes at room temperature. Three washes with PBS/azide three times were followed by addition of the secondary anti-goat donkey antibody (Alexa Fluor 488) diluted 1:100. After an incubation step for 45 minutes at room temperature in a humidified chamber, the cells were washed three times with PBS/azide. A drop of 9:1 glycerol:PBS was placed on the cells followed by placement of a coverslip. The cells were viewed with a fluorescence microscope (Zeiss Axiovert fluorescence microscope, NEMC Imaging Facility, Tufts University). For further clarity, the antibody-treated wtPTHR1, XMCL, and C217L-XMCL transfected Cos-7 slides were viewed with a confocal microscope (Leica TCS SP2 Instrument, Imaging Core Facility of Center for Neurosciences, Tufts University).

RESULTS

Plasmid construction and sequence alignment

In this study, we removed endogenous cysteines from the TM and intracellular domains of the PTHR1. The PTHR1 DNA constructs prepared are shown in Table 1. The cysteines in TM and intracellular domains of PTHR1 are highly conserved across different species (Fig. 2). Alignment with PTHR2 sequences, highly homologous to PTHR1 sequences, showed that the cysteines except for the ones present at position 397 in ICL3 and 568 in C-ICD, are conserved among the homologs, too. These cysteines are not present in the aligned sequences of rhodopsin, the archetypal and best-studied GPCR (Fig. 2). Therefore, it was reasoned that these cysteines might be specific for PTHRs.

Table Table 1.. Modified Receptor Constructs Used in the Study
original image
Figure Figure 2.

Alignment of regions of human PTHR1 containing cysteines that were mutated in this study. Sequences were aligned using the program clustal-W. Boxes are drawn around cysteines present in ICL 1 (C217), ICL3 (C397), TM7 (C460, C462), and C-ICD (C568) of human PTHR1 and corresponding cysteines present in related sequences.

Functional properties of the mutant receptors

C→L mutations in TM7 and the C-ICD, and removal of C397 by insertion of the Factor Xa cleavage sites did not effect binding affinity or adenylyl cyclase–stimulating activity, which remains comparable to wtPTHR1 (Table 2). However, when Cys217 was replaced with Leu, we observed a significant decrease in binding and a complete loss in activity (construct C217L-XMCL). Also, C2XMCL, containing the C217L mutation together with the C568 substitution, similarly showed low binding affinity and no adenylyl cyclase activity (Table 2).

Binding assays of the C460L/C462L (XMCL construct) and C568L (C568-XMCL construct) mutated receptors exhibited a slightly reduced maximal response (ICmax) compared with that of wtPTHR1 (Fig. 3A). In contrast, the ICmax was reduced compared with wtPTHR1 to nearly 30% for the C217L mutation (C217L-XMCL) and 15% for C217L and C568L simultaneous mutations (C2XMCL). Similar to the ICmax values, the maximal adenylyl cyclase–stimulating activity (ECmax) was reduced in case of the XMCL and the C568L-XMCL mutant receptors (Fig. 3B). The C217L-XMCL and C2XMCL mutant receptors showed no activity. Substituting cysteines 460 and 462 with alanine rather than leucine had no effect on the ICmax or ECmax. Similar to the substitution with leucine, the mutant receptor containing the C217A mutation (C2A-XMCL) had significantly lower ICmax values than wtPTHR1 and no detectable adenylyl cyclase activity (data not shown).

Table Table 2.. Binding Activity and PTH-Stimulated Adenylyl Cyclase Activity of wtPTHR1 and Mutant Receptors
original image

RNA levels of mutant receptors

It was reasoned that the observed effect on binding and activity may be attributed to lower gene expression. RT-PCR was used to analyze mRNA levels for each of the constructs used in the study. We used a sense oligonucleotide corresponding to nucleotide region 1286–1303 and an antisense oligonucleotide corresponding to region 1814–1833 of PTHR1. We observed the expected band of 547 bp for each mutant with no observed reduction in mRNA levels compared with wtPTHR1 (Fig. 4A). Similar levels of the housekeeping gene, β-actin, were seen in all the lanes (Fig. 4B).

Cell surface and total protein expression

We studied the total and cell surface PTHR1 expression in transiently transfected Cos-7 cells using ELISA and immunofluorescence microscopy. Transiently transfected Cos-7 cells were assayed for PTHR1 expression using an anti-PTHR1 antibody. For assaying total expression, the cells were permeabilized before addition of the primary antibody. As represented in Fig. 5A, total expression was not effected by mutation of any cysteine residue in ICL1, ICL3, TM7, or C-ICD. For detection of cell surface expression, we permeabilized the transiently transfected Cos-7 cells only after addition of primary antibody. We observed a decrease in cell surface expression of receptors with removal of cysteines in the TM7 and the C-ICD (i.e., XMCL and C568-XMCL mutants; Fig. 5B). This decrease was much more dramatic for the mutants containing the C217L mutation, with as much as 92% reduction compared with wtPTHR1. These findings indicate that the C217L mutation interferes with receptor translocation to the cell surface.

Figure Figure 3.

Transiently transfected Cos-7 cells were assayed for ICmax and ECmax. (A) Specific binding activity. Saturating amounts (100 nM) of unlabelled bPTH was used as competitor. (B) PTH-stimulated adenylyl cyclase activity. The PTH-stimulated adenylyl cyclase activity was estimated from luciferase assay readouts. Saturating amounts of bPTH (100 nM) was used to check the maximum activity of the receptors. Data are expressed as the mean ± SE (n = 3). *p value between 0.01 and 0.05; **p value between 0.001 and 0.01; and ***p < 0.001 vs. wtPTHR1 activity.

Immunofluorescence studies were performed to gain further insight into the expression pattern of the mutant receptors. Transiently transfected Cos-7 cells were permeabilized before addition of primary anti-PTHR1 antibody and secondary Alexa Fluor 88-tagged antibody. As observed from the fluorescence microscopy images (Fig. 6), the expression of the c-myc-PTHR1 and XM mutants was similar to that of wtPTHR1. The signals were found to be present both intracellularly and on the cell surface, indicating abundant expression of the receptor protein. In case of the XMCL and the C568L-XMCL mutants, the expression was reduced. The signal observed with the C217L-XMCL– and C2XMCL-transfected Cos-7 cells was considerably reduced, suggesting minimal expression levels.

We also obtained images of untransfected and wtPTHR1-, XMCL-, and C217L-XMCL–transfected Cos-7 cells by confocal microscopy (Fig. 7). With wtPTHR1, we observed the immunofluorescence signal throughout the cell and on the surface. For the C460L/C462L mutant, we observed an increased concentration of the signal to the interior besides the cell surface. Cells transfected with C217L-XMCL showed localization of the fluorescence signal prominently to the interior, suggesting a defect in the transport of these mutant receptors.

Figure Figure 4.

RT-PCR. RNA isolated from transiently transfected Cos-7 cells was assayed for PTHR1 levels using RT-PCR with β-actin as loading control. The RT-PCR products were run on a 1.2% agarose gel, and bands were viewed under UV light after staining with EtBr. The lanes are as follows: 1, wtPTHR1; 2, c-myc-PTHR1; 3, XM; 4, XMCL; 5, C217L-XMCL; 6, C568L-XMCL; 7, C2XMCL. (A) Amplification of PTHR1 fragment. (B) Housekeeping gene, β-actin, expression levels.

Figure Figure 5.

Total and cell surface protein expression levels of mutant receptors as determined by ELISA in transfected Cos-7 cells. All readings were corrected for background observed with untransfected cells. Absorbance was read at 360 nm. (A) Total expression levels. The cells were permeabilized before the addition of primary antibody. (B) Cell surface expression levels. The cells were permeabilized after the addition of primary antibody. Data are expressed as the mean ± SE (n = 3). *p value between 0.01 and 0.05; **p value between 0.001 and 0.01; and ***p < 0.001 vs. wtPTHR1 expression levels.

DISCUSSION

Binding of PTH to its receptor results in stabilization of the active conformation.(10,11) Because X-ray crystal structure data are not available for any GPCR other than rhodopsin,(12) ligand−receptor interaction studies are a major source of information regarding receptor conformation and structure–function relations. Knowledge of the role of different receptor regions in interaction with ligand and activation will aid in molecular modeling of the receptor. The cysteines present in the extracellular domain have been shown to be essential for maintaining receptor functionality.(5) We wished to study the role of cysteines present in intracellular domains of PTHR1 because they are located at sites thought to be important for expression of biological activity of the hormone through its receptor.(13–16)

The results of binding and biological activity assays with mutant PTHR1 containing C→L mutations at positions 460, 462, or removal of C397, rule out critical involvement of these residues in receptor function. However, substitution of C→L at position 217 or simultaneously at position 217 and 568 (but not 568 alone) results in a decrease in binding and loss of receptor function, indicating that C217 plays a crucial role in structure and function of the receptor. The side-chain of Cys is analogous to the polar side chain of serine, but it is usually found in hydrophobic regions of proteins. We therefore decided to substitute the cysteines with leucine, a hydrophobic amino acid. Depending on the position and importance of the cysteine being substituted with leucine, different effects have been reported. In one study with the phosphoprotein regulator phospholamban, a Cys to Leu mutation resulted in the formation of a tetramer assembly instead of the usual pentameric structure.(17) The change was attributed to steric hindrance resulting in a disruption of close packing interactions at the site of introduction of the bulkier amino acid. In our study, mutants C217L-XMCL and C2XMCL showed no PTH-stimulated adenylyl cyclase activity. To determine if this loss of receptor functionality results from steric hindrance caused by the bulkier leucine replacing cysteine at position 217, we undertook another round of substitution of cysteine, this time with the smaller amino acid alanine. On functional characterization of the C217A-containing mutants, we observed similar results to the C217L mutation (i.e., a reduction in binding affinity and loss of biological activity).

The reduced functionality of the C217-substituted mutant receptors may be attributed to either a reduced expression of the receptors, impaired translocation to the cell surface, or alterations in receptor conformation leading to inability to shift to an active conformation. RT-PCR studies showed no discernible difference in receptor mRNA levels among the various constructs used in this study. Therefore, the results obtained with the C217-mutated receptors must result from effects at the translational or post-translational levels.

Figure Figure 6.

Fluorescence microscopy. Cos-7 cells were transfected with 4 μg wtPTHR1 or mutant PTHR1 receptor DNA. The transfected cells were permeabilized with Triton X-100 and incubated with polyclonal anti-PTHR1 followed by Alexa Fluor 488 dye labeled rabbit anti-goat IgG. Blank is untransfected cells, negative control. Images were obtained with a Zeiss Axiovert fluorescence microscope.

Figure Figure 7.

Confocal microscopy. Cos-7 cells were transfected with 4 μg wtPTHR1 or mutant PTHR1 receptor DNA. The transfected cells were permeabilized with Triton X-100 and incubated with polyclonal anti-PTHR1 followed by Alexa Fluor 488 dye labeled rabbit anti-goat IgG. Images were obtained with a Leica TCS SP2 instrument.

Introduction of mutations can result in misfolding of proteins, which interferes with protein trafficking. To study the cell surface and total expression of the various PTHR1 mutants we generated, we used ELISA and immunofluorescence techniques. ELISA for total receptor protein showed equivalent expression of receptors in cells transfected with wildtype or various mutant receptors. Therefore, the loss of binding and function seen with mutations in Cys217 is not attributable to decreased receptor protein expression or increased intracellular degradation. ELISA for cell surface expression showed slightly reduced expression for the XMCL and C568L-XMCL mutants compared with wtPTHR1. However, with C217L-XMCL and C2XMCL mutant receptors, the cell surface expression was negligible, indicating that almost all the expressed receptor was confined to an intracellular locale. Analysis of C217L-XMCL–transfected cells using confocal microscopy showed the immunofluorescence signal to be concentrated to the interior of the cells. This reduced cell surface expression may be attributed to misfolding of the protein. The resulting aberrant protein is retained inside the cell.(18)

Cysteines are frequently involved in disulfide bonds which stabilize protein structure. Although the reducing environment inside cells makes disulfide bond formation unlikely,(19) there are reported cases where disulfide bridges do form within other GPCRs.(20) We do not believe that Cys217 is involved in disulfide bond formation because mutation of Cys568 or deletion of Cys397, the only two cysteine residues with which Cys217 could possibly interact, does not significantly effect receptor function or cell surface expression. Nevertheless, cysteines are known to have a key structural role in the intracellular environment. Cysteines can function as the reactive center of enzymes(21) together with amino acids like histidine and asparagine.(19) There are histidines at positions 216, 223, and 225, flanking Cys217. In addition, there is an asparagine at position 220. A study looking at mutations in ICLs of another class II GPCR, calcitonin receptor-like receptor (CLR), has shown that mutation of cysteine in ICL1 (C149A) has no effect on cell surface expression or cAMP accumulation.(22) At the same time, an earlier study with another class II GPCR, glucagon-like polypeptide-1 receptor (tGLP-1R), showed that mutation of cysteine in ICL1 (C174A) resulted in significantly lower cell surface expression and cAMP activity.(23) Sequence alignment of areas in ICL1 showed 90% homology between PTHR1 and tGLP-1R and only 36% homology between CLR and PTHR1/tGLP-1R. This is suggestive of cysteine in ICL1 of PTHR1 and homologous receptors acting together with surrounding amino acid residues to influence the structure and ultimately biological function of the receptor.

ICL2 and ICL3 have been studied extensively for their role in GPCR downstream signaling, but little is known about ICL1. ICL1 has been shown to play a role in G protein interactions in some GPCRs.(24,25) Here, we show that mutating one amino acid residue, Cys217 in ICL1, is detrimental to expression of PTHR1 on the cell surface. It would be interesting to know the intrinsic activity of Cys217-substituted mutants, but it has not been feasible to study PTHR1 structure function relations outside the context of the cell membrane. We presume that Cys217 has a distinctive role in PTHR1 folding as part of the intracellular transport process. Disruption of the conformation normally promoted by endogenous Cys217 must prevent the PTHR1 from acquiring a conformation critical for transport. As a result, display of mutant receptor on the surface is reduced, with loss of receptor functionality. These results may extrapolate to class II GPCRs homologous to PTHR1 or may generalize to other GPCRs families.

Acknowledgements

We acknowledge the imaging core facility of Center for Neurosciences research at Tufts University for help with confocal microscopy studies. We also thank Dr Martin Beinborn at the Department of Pharmacology of the New England Medical Center for help with the ELISA. This work was supported by NIH Grant DK-47940 (to MR).

Ancillary