SEARCH

SEARCH BY CITATION

Keywords:

  • multipotential stromal cells from bone marrow;
  • osteogenesis;
  • microarray;
  • mesenchymal stem cells;
  • multipotential

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

In this study, we used multipotential MSCs and microarray assays to follow the changing patterns of gene expression as MSCs were differentiated to osteoblasts. We analyzed co-expressed gene groups to identify new targets for known transcription factor VDR during differentiation. The roles of two genes (histamine receptor H1 and dermatopontin) as downstream targets for the VDR were confirmed by gel electromotility shift, siRNA inhibition, and chromatin immunoprecipitation assays.

Introduction: Osteogenesis is stringently controlled by osteoblast-specific signaling proteins and transcription factors. Mesenchymal stem or multipotential stromal cells from bone marrow (MSCs) have been shown to differentiate into osteoblasts in the presence of vitamin D3.

Materials and Methods: We used MSCs and microarray assays to follow the changing patterns of gene expression as MSCs were differentiated to osteoblasts. The data were analyzed with a previously developed strategy to identify new downstream targets of the vitamin D receptor (VDR), known osteogenesis transcription factor. Hierarchical clustering of the data identified 15 distinct patterns of gene expression. Three genes were selected that expressed in the same time-dependent pattern as osteocalcin, a known target for the VDR: histamine receptor H1 (HRH1), Spondin 2 (SPN), and dermatopontin (DPT). RT-PCR, electromotility shift, siRNA inhibition assays, and chromatin immunoprecipitation assays were used to analyze the role of VDR in activation of DPT and HRH1 during differentiation.

Results and Conclusions: RT-PCR assays confirmed that the genes were expressed during differentiation of MSCs. The roles of two genes as downstream targets for the VDR were confirmed by gel electromotility shift and chromatin immunoprecipitation assays that showed the presence of VDR complex binding sequences. Overexpression of VDR in MG-63 osteosarcoma cells induced the expression of HRH1 and DPT. Inhibition studies with siRNA to DPT and HRH1 showed a decrease in MSC differentiation to osteogenic lineage. In addition, osteogenic differentiation of MSCs was inhibited by the HRH1 inhibitor mepyramine but not the HRH2 inhibitor ranitidine. In conclusion, we show that analysis of co-expressed gene groups is a good tool to identify new targets for known transcription factors.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Osteogenesis in higher animals involves a stringently regulated process involving numerous extracellular and intracellular factors. The genes regulating this process include a number of transcription factors such as the vitamin D receptor (VDR) and TWIST,(1,2) osteoblast-specific growth factors and signaling molecules that include BMPs, TGF-β, and smads,(3,4) and downstream differentiation specific proteins such as CBFA1 and osteocalcin.(5,6) Many model systems have been used to examine osteogenic differentiation; these include cultures of calvariae(7,8) and long bone explants,(9–11) continuously cultured osteosarcoma cell lines,(12,13) and primary cultures of osteoblastic cells.(14–16) Among the most convenient systems are the adult stem/progenitor cells from human bone marrow referred to as multipotential stromal cells (MSCs), because they can be isolated as relatively homogeneous cells and differentiated en masse to osteoblasts and other cellular phenotypes in culture. The advent of microarray assays has made it possible to generate rapidly a large amount of data on the expression of genes during differentiation. One strategy is to query the data for genes that are co-expressed to identify genes whose products may be functionally interactive.(17,18) A second strategy is to query the data for candidates for new downstream targets of transcription factors that were previously shown to drive the differentiation process by identifying genes that are co-expressed with known targets of the transcription factors. Recently, we used the second strategy to examine the time-course of chondrogenic and adipogenic differentiation of MSCs to identify candidates for new downstream targets of SOX9, SOX5, C/EBPα, and PPARγ.(19) Further experiments confirmed that several of the candidate genes were targets of the transcription factors.

In this study, we used the same strategy to examine osteogenesis of MSCs. Microarray assays were carried out on MSCs that were differentiated for 0–28 days. After hierarchical clustering of the data, 15 time-dependent patterns of gene expression were visually identified. We queried the data for genes that were co-expressed with osteocalcin, a known downstream target for the VDR transcription complex. Four candidates for new downstream targets of VDR were selected. Further experiments established that two of the candidates, histamine receptor H1 (HRH1) and dermatopontin (DPT), were in fact downstream targets of VDR.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Cell culture and differentiation assays

A vial of ∼1 million frozen passage 1 human MSCs(20–22) was obtained from Tulane Center for Preparation and Distribution of Adult Stem Cells (http://www.som.tulane.edu/gene_therapy/distribute.shtml). The cells were thawed and plated to recover on a 180-cm2 dish in 20 ml complete culture medium (CCM; αMEM [GIBCO BRL]; 20% FBS lot-selected for rapid growth of MSCs [Atlanta Biologicals]; 100 U/ml penicillin; 100 μg/ml streptomycin; and 2 mM l-glutamine [GIBCO BRL]). After 2 days of recovery, the cells were replated at 50 cells/cm2 in multiple 180-cm2 dishes in CCM. For the differentiation assays, the cells were incubated in CCM for 9 days, and the medium was changed to osteogenic medium containing 1α,25-dihydroxyvitamin D3 (10 nM vitamin D3, 10−8 M dexamethasone/0.2 mM ascorbic acid/10 mM β-glycerol-phosphate; Sigma, St Louis, MO, USA) for 0–28 days. The extent of differentiation was determined by staining 10% formalin fixed colonies with Alizarin red (Sigma).

MG-63 osteosarcoma cell lines were obtained from American Type Cell Culture (ATCC, Manassas, VA, USA) and cultured in CCM as described above. To obtain VDR overexpressing MG-63 cell lines, 10 μg of pAD-hVDR (kind gift from Dr Nancy Weigel, Baylor College of Medicine) was transiently transfected following the protocol of lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). As a negative control, cells transfected with empty vector were used. To obtain VDR expressing MG63 stable cell lines, 10 μg pAD-hVDR was co-transfected with pEGFPneo (Stratagene) at a ratio of 14:1, and the clones were selected with 50 μg/ml G418.(23) The cells were harvested by trypsinization and used for both RT-PCR and Western blot analysis of DPT and HRH1 upregulation in response to VDR overexpression.

Western blot

Cells were prepared as described above and lysed in buffer (Lysis Buffer; Roche Molecular Biochemicals) supplemented with protease inhibitor cocktail (Sigma Biochemicals), and protein concentration was determined (Micro BCA Kit; Pierce Biotechnology). The cell lysate (50–100 μg of protein) was fractionated by SDS-polyacrylamide gel electrophoresis (Novex 12% gels, Invitrogen). The sample was transferred to a filter (Immobilon P; Millipore) by electro-blotting (Immunoblotting Apparatus; Invitrogen). The filter was blocked for 30 min with PBS containing 5% nonfat dry milk and 0.1% Tween 20 and incubated for 1 h with the primary antibody. For detection of DPT, HRH1, and VDR, the filter was incubated with 1:500 dilution of DPT antibody (Abcam). As a control, β-actin was detected by incubating with a 1:1000 monoclonal antibody (Pharmingen). The filter was washed four times for 15 min each with PBS containing 0.1% Tween 20. Bound primary antibody was detected by incubating for 1 h with horseradish peroxidase goat anti-mouse IgG (Pharmingen) diluted 1:10,000 in PBS containing 5% nonfat dry milk. The filter was washed with PBS containing 0.1% Tween 20 and developed using a chemiluminescence assay (ECL-plus; Amersham).

Inhibitor studies

To determine the effect of histamine inhibitors on differentiation, MSCs were cultured in above osteogenic medium with 1 μM histamine, 1 μM N-(4-methoxyphenyl)methyl-N′,N′-dimethyl-N-(2-pyridinyl)-1,2-ethanediamine maleate salt (mepyramine), and 1 μM ranitidine (Sigma) for 10 days, and an alkaline phosphatase (ALP) assay was performed as described below.

siRNA studies

HRH1 and DPT duplex siRNA was synthesized by Ambion, based on the sequences and target exons presented below. Transient transfection of siRNA into MG-63-VDR cells was carried out using siPORT amine (Ambion, Austin, TX, USA), according to the manufacturer's protocol.

  • equation image

In brief, siRNA was transfected at 50 nM concentrations in 6-well plates and transfected with siPort Amine transfection reagent (Ambion).

ALP assay

Either MG-63-osteosarcoma cell line (ATCC, Manassas, VA, USA) or hMSCs were cultured as described above. ALP activity of the mineralizing cells was determined using the one-step para-nitrophenol phosphate (pNPP) assay kit according to manufacturer's protocol (Pierce, Rockford, IL, USA). The cells were washed with PBS buffer, and 0.1 ml para-nitrophenol phosphate in diethanolamine (DEA) buffer was added directly onto the monolayer. We monitored light absorbance at 405 nm by spectrophotometry (FLUOstar; BMG Labtech, Durham, NC, USA). The data were normalized to the concentration of DNA as determined by the CYQUANT DNA quantitation kit (Invitrogen).

Alizarin quantitation

The stained plates were washed with distilled water to remove nonspecific staining. The stained cells were incubated for 15 min with 10% (wt/vol) cetylpyridinium chloride in 10 mM sodium phosphate (pH 7.0).(24) The extracted stain was transferred to a 96-well plate, and the absorbance at 562 nm was measured using a microplate reader/spectrophotometer (BioRad, Hercules, CA, USA). The concentration of Alizarin red staining in the samples was determined by comparing the absorbance values with those obtained from Alizarin red standards.

Statistics

Experimental data for alizarin red and ALP assays were analyzed by Student's t-test, and the cut-off for significance was 0.05.

RNA isolation and RT-PCR

RNA was isolated from 0.5–2 × 106 cells (RNAesy RNA isolation kit; Qiagen). RNA was converted to cDNA and amplified (Titan One Tube RT-PCR System; Roche Molecular Biochemicals). RT was performed by a 30-min incubation at 50°C, followed by 2 min at 94°C to inactivate the RT. PCR amplification conditions for the resulting cDNA were 35 cycles of 94°C for 30 s, 58°C for 45 s, and 68°C for 45 s, in which the 68°C step was increased by 5 s every cycle after 10 cycles. The reaction products were resolved by electrophoresis on a 1% agarose gel and visualized with ethidium bromide.

PCR primers were as follows—DPT: 5′-acaattatgattactatatc-3′ and 5′-caggaagttggcattgcagt-3′; HRH1: 5′-atgtggccagcacagcgtcc-3′ and 5′-tgatgatggcagtcatgacc-3′; OCN: 5′-gtagtgaagagacccaggcg-3′ and 5′-tggagaggagcagaactggg-3′; GAPDH: 5′-accacagtccatgccatcac-3′ and 5′-tccaccaccctgttgctgta-3′.

Probe synthesis, hybridization, and scanning

Total RNA was isolated from cultured cells at day 0, day 1, day 7, day 14, day 21, and day 28 as described above. To synthesize double-stranded cDNA (Superscript Choice System; Invitrogen), 8 μg of total RNA was used. After synthesis, the cDNA was purified by phenol/chloroform extraction (Phase Lock Gel; Eppendorf Scientific) and concentrated by ethanol precipitation. In vitro transcription was used to produce biotin-labeled cRNA (BioArray HighYield RNA Transcription Labeling Kit; Enzo Diagnostics). The biotinylated cRNA was cleaned (RNAeasy Mini Kit; Qiagen), fragmented, and hybridized on the microarray chips (HG-U133A; Affymetrix) containing 22,215 probes representing 15,003 genes. After washing, individual microarray chips were stained with streptavidin-phycoerythrin (Invitrogen), amplified with biotinylated anti-streptavidin (Vector Laboratories), and scanned for fluorescence (GeneArray Scanner; Hewlett Packard) using the Microarray Suite 5.0 software (MAS 5.0; Affymetrix).(1)

Normalization and filtering

The scanned images, together with absolute calls for each gene (P = present, M = marginal, A = absent) were transferred to dChip 1.3+ program.(25,26) Chips were normalized against an array with a median overall intensity of 210 at probe intensity level. Expression values were calculated based on both perfect matches (PMs) and mismatches (MMs), and negative values were assigned a value of 1.

Differentially expressed genes were obtained in the experiment by searching for genes that (1) were scored P in at least one of the samples and (2) had a CV (SD of intensities divided by mean intensity across all time-points) >0.35. This criterion was chosen because it reduced the number of genes for clustering to a more manageable number. After Affymetrix control genes and redundant genes were removed, the number of genes was reduced from 15,003 genes on the chip to 2856.

Hierarchical clustering and gene otologies

Before hierarchical clustering, the dChip program standardized the intensities for each differentially expressed gene by linearly adjusting their values across all time-points to a mean of zero with an SD of one. The program was also used to perform hierarchical clustering of the samples.

Fifteen distinct patterns of gene expression were visually selected from the hierarchical clustering picture. The dChip program calculated p values for each gene ontology (GO, the GO project has developed three structured controlled vocabularies [otologies] that describe gene products in terms of their associated biological processes, cellular components, and molecular functions in a species-independent manner) term using an exact hypergeometric distribution to compare the frequencies of individual GO terms within the pattern to the frequencies of those terms on the entire microarray (p ≤ 0.01 was considered significant).(27)

Transcription factors were queried from the differentially expressed genes by searching for genes having a GO term “transcription factor activity.” Hierarchical clustering was carried out on these 128 genes, and eight patterns of expression were visually selected.

Identification of new targets for VDR

A known downstream target for VDR, osteocalcin, was identified from the clusters, and the genes co-expressed with it were subjected to linear regression analysis. Genes that showed significant linear regression (r2 ≥ 0.9) with osteocalcin were kept for further analysis. Next, the available sequence 10,000 bases upstream from the 5′-end of exon 1 was retrieved for the identified new targets and osteocalcin using the LocusLink (http://www.ncbi.nlm.nih.gov/LocusLink/) number and the Traser database (http://genome-www6.stanford.edu/cgi-bin/Traser/traser). Theupstream sequences were queried for putative binding sites for VDR, using the RXR-VDR (complex) function in the ConSite website (http://mordor.cgb.ki.se/cgi-bin/CONSITE/consite).

EMSA

Thirty-five-base pair promoter oligos (sequences shown below) spanning VDR binding sites were selected based on ConSite and radiolabeled using manufacturer-suggested protocol of Starfire (IDT DNA technologies) probe labeling kit and p32 dATP (Amersham Biosciences, Piscatway, NJ, USA). The radioactivity was measured by scintillation counter, and ∼100,000 counts were used per reaction. The binding assay was performed using manufacturer-suggested protocol of NuShift VDR (Active Motif). In short, the probes were incubated with nuclear extracts from the MG-63 cell line. Cold (unlabeled) oligo was added at a 1:10 ratio, and an antibody to VDR was used for supershift assay. After a 20-min incubation at room temperature, the reaction was run on 6% polyacrylamide gels with 2% glycerol in TBE, pH 8.5, and the gels were vacuum dried and exposed to X-ray films for varying times. Antibody to VDR used here is polyclonal, and the lanes with supershift bands were either merged from a different exposure of the same gel or digitally processed (Adobe Photoshop CS) to enhance view ability of existing bands on the same film. A densitometry analysis of the image was performed using ImageJ software (the boundaries of the lanes analyzed and the profile plots are represented).

Oligonucleotide sequences were as follows—OCN: TGGATCACCTGGGGCCAGGAGTTCAAGACCAGCCT; HRH1: GACCATCCATGGGTTACTGGGTTAAGAATTTTTGA; DPT: TTATGTTAGCGGTTCATAAGGTTCATCCATTTTGC.

Chromatin immunoprecipitation

Immunoprecipitation of DNA with associated modified histone was performed as protocol recommended by the manufacturer with minor changes (Upstate Biotechnology, Lake Placid, NY, USA). Briefly, 5 × 106 suspension culture cells were cross-linked with 1% formaldehyde for 15 min at 37°C, washed twice with cold PBS, and resuspended in 0.8 ml SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris.HCl, pH 8.1). Cells were sonicated to reduce the DNA fragment to 200–600 bp. Debris were removed, and the supernatant was diluted 1:10 in chromatin immunoprecipitation (ChIP) dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris.Cl, pH 8.1, 167 mM NaCl). The chromatin solution was divided into individual aliquots; each aliquot had 1 ml (∼0.5 × 106 cells). One aliquot was used as input DNA. For the others, each aliquot was precleared with 50 μl of salmon sperm DNA/protein A-agarose beads for 3 h at 4°C. The soluble fraction was collected; one aliquot was used as a no antibody control. For the others, 10 μl (1:100) of each of the antibodies that were specific for VDR (Active Motif) and transcription factor II B (TFIIB; Upstate Biotechnology) was added. After incubation at 4°C overnight, the immune complexes were collected by adding 60 μl of salmon sperm DNA/protein A-agarose beads for 3 h at 4°C. After the immune complexes-protein A-agarose beads were washed five times, the immune complexes were eluted in 500 μl elution buffer (1% SDS, 0.1 M NaHCO3), and cross-links were reversed by heating at 65°C for 4 h. DNA fragments were recovered by proteinase K digestion, phenol extraction, and ethanol precipitation and dissolved in 50 μl Tris EDTA buffer.

Semiquantitative PCR amplification

The immunoprecipitated (IP) DNA (5 μl) and input DNA (100 ng) were amplified with the Platinum PCR mix kit (Invitrogen). PCR amplification conditions were 30 cycles at 94°C for 30 s, 58°C for 45 s, and 68°C for 45 s. Ten microliters of the PCR products was size-fractionated on a 1% agarose gel containing 0.1 μg/ml ethidium bromide to determine the amplification and visualized in a BioRad Gel documentation unit (Bio-Rad, Hercules, CA, USA)—OCN: 5′-TCAGTCTCCCGAGTAGCTGG-3′ and 5′-ATGGCCAACTGATTGTCGGC-3′; HRH1: 5′-GTGAGGTGTGCTCACAATGG-3′ and 5′-CCCTAAGCAGCCATTCCATC-3′; DPT: 5′-GTCCATCAACTTGTAAATGG-3′ and 5′-TATGGATTTGTCTGTTCTGG-3′.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Differentiation of MSCs into mineralized cultures

Human MSCs were plated in 15-cm dishes, and one-half of the plates were incubated with mineralization media as described in the Materials and Methods section starting on day 8. The rest were left as control plates, and the medium was changed every 4 days. Cells were harvested on days 0, 1, 7, 14, 21, and 28 from the day the cells were incubated with osteogenic medium. One set of samples was used for further experiments, and a parallel set was stained with alizarin red to assay the time-dependent mineral deposition on MSCs (Fig. 1A). The extent of osteoblastic differentiation was determined by ALP assay and alizarin red quantitation (Figs. 1B and 1C). The alizarin red was extracted with cetyl pyridinium chloride from the stained plates (Fig. 1A) and quantitated as described in the Materials and Methods section (Fig. 1B). Both alizarin red deposition and ALP activity of the cells cultured in osteogenic media showed a time-dependent response to differentiation.

thumbnail image

Figure Figure 1. ALP activity and mineral deposition increases with the differentiation of MSCs in mineralizing media. (A) Alizarin red staining of MSCs cultured in mineralizing media (magnification, ×10). (B) ALP activity expressed in values normalized to amount of DNA. (C) Alizarin red S quantitation expressed normalized values to DNA.

Download figure to PowerPoint

Transcriptome analysis of mineralized samples

RNA extracted from the mineralized samples was used to analyze the gene expression by oligonucleotide microarrays. The data were filtered to identify genes that showed significant differences in expression. The expression data from all the samples were filtered and analyzed as described in the Materials and Methods section. The normalized values of the signal intensities of the differentially expressed genes were hierarchically clustered using the dChip 1.3+ program(28,29) (Figs. 2A and 2B). Fifteen distinct patterns of gene expression were visually selected from the hierarchical clustering picture. The dChip program calculated p values for each GO term using an exact hypergeometric distribution to compare the frequencies of individual GO terms within the pattern to the frequencies of those terms on the entire microarray (p ≤ 0.01 was considered significant).(27) The five most significant GO terms for the 15 clusters in a pattern are shown in Table 1. We found that VDR was clustered in group 8 and osteocalcin in cluster 10. Cluster 10 was further analyzed to identify co-regulated genes (Table 2). We analyzed both upregulated and downregulated transcription factor expression patterns by hierarchical clustering as shown in Supplementary Fig. 1.

Table Table 1.. Genes Co-Regulated With Osteocalcin
Thumbnail image of
Table Table 2.. Gene Ontology (GO) Terms for Selected Hierarchical Cluster Profile
Thumbnail image of
thumbnail image

Figure Figure 2. Hierarchical clustering of the filtered genes. (A) Sample clustering (x-axis: days of differentiation). (B) Gene clustering and graphical representation of expression profiles of the 15 clusters selected for analysis.

Download figure to PowerPoint

Genes co-regulated with osteocalcin

VDR is known to regulate osteocalcin gene expression during osteoblastic differentiation.(30–32) To test the hypothesis that genes co-clustered with known transcription factor downstream targets are regulated similarly, the known downstream target for VDR, osteocalcin, was identified from the clusters, and the genes co-expressed with it were subjected to linear regression analysis (Figs. 2A and 2B). Genes that showed significant linear regression (r2 ≥ 0.9) with osteocalcin were kept for further analysis.

The underlined genes were further tested based on the earlier reports of their potential role in osteogenesis(33–37) and whose expression values had a good correlation (r2 ≥ 0.9) with osteocalcin expression values and their VDR-TFBS (transcription factor binding site; %)(38) score was higher or equal. Histamine receptor H1 (HRH1), spondin 2 (SPN2), and dermatopontin (DPT) were tested for their role in VDR pathway.

Osteocalcin, HRHI, SPN2, and DPT exhibit similar expression profiles

To validate the microarray data that osteocalcin, HRH1, and DPT were candidates for new downstream targets of VDR, we used the ConSite program to search 10 kb of their promoter sequences for VDR binding sites. As indicated in Table 3, a large number of the selected new targets had binding sites in their promoters that had both a high relative score and a high absolute score based on the model used in the program (www.consite.com). Linear regression analysis of the hypothesized targets of VDR showed a very good correlation in the expression pattern. They expressed similar expression profiles as VDR and osteocalcin (Figs. 3A and 3B). Furthermore, RT-PCR analysis of the DPT and HRH1 genes in the mineralized cultures for the above genes corroborated the expression profile (Fig. 3C).

Table Table 3.. Sequences of VDR Binding Sites in DPT and HRH1 Promoter Regions
Thumbnail image of
thumbnail image

Figure Figure 3. Correlation analysis of OCN expression to HRH1 and DPT. (A) Linear regression analysis of hypothesized targets for VDR and OCN. (B) Expression profiles of mineralizing cultures were plotted based on their signal intensity. The expression patterns are similar to that observed by RT-PCR data. (C) RT-PCR showing differential expression of DPT, OCN, and HRH1 compared with GAPDH in hMSCs that have been placed in osteogenic media for indicated time-points.

Download figure to PowerPoint

Promoters of HRH1 and DPT bind to VDR

The next step was to determine if VDR binds to the promoter sequence of the candidate target genes. This was tested by EMSAs and ChIPs. The upstream sequences were queried for putative binding sites for VDR, using the RXR-VDR (complex) function in the ConSite website (http://mordor.cgb.ki.se/cgi-bin/CONSITE/consite). The locations of the top five VDR binding sites of DPT and HRH1 that scored higher than osteocalcin are listed in Table 3.

Nuclear extracts from cells known to express VDR (MG-63 osteosarcoma cell line) were incubated with the radio-labeled oligonucleotides containing VDR binding sequences (the top two VDR binding sites shown in Table 2) in the promoters of one known downstream target (OCN) and two candidate new downstream targets: HRH1 and DPT. The oligonucleotide representing the highest scored VDR binding site showed the supershift of the band in the presence of VDR antibody, suggesting that the binding is specific to VDR. As indicated in Fig. 4, the results established that the known downstream target and two candidate downstream targets had promoter sequences that specifically bound VDR. The profile plots of the band densities in EMSA images were obtained using ImageJ software (Fig. 4, insets). The oligosequence that gave a specific band shift in the presence of the VDR antibody was used to confirm the binding with CHIP assays (Fig. 4B). Immunoprecipitation of VDR-bound DNA followed by PCR analysis of promoter regions of HRH1 and DPT showed a binding to VDR antibody. The binding affinity was higher than IgG, confirming the specific binding of VDR antibody to the sequences.

thumbnail image

Figure Figure 4. VDR binds to DPT and HRH1 promoter regions. (A) EMSA: 35-bp promoter oligos spanning VDR binding sites were incubated with nuclear extracts from MG-63 osteoblast cell lines. Cold oligo was added at 1:10 ratio, and antibody to VDR was used for supershift assay. (Insets) Profile plots of the band densities obtained by image analysis using ImageJ software. (B) ChIP assay of MG-63-VDR cells using antibodies to VDR and polymerase II show VDR binding to DPT, OCN, and HRH1.

Download figure to PowerPoint

VDR induces DPT, osteocalcin, and HRH1 expression

With the data suggesting a presence of the VDR binding region in the promoter sequences of DPT and HRH1, the next logical step was to determine the activation of the genes in response to VDR overexpression. MG-63 osteosarcoma cells were transfected with VDR cDNA and tested for the induction of gene expression. RT-PCR analysis of DPT, VDR, and HRH1 showed an induction in the mRNA expression after transfection in medium containing vitamin D3 (Fig. 5A). Western blot analysis of VDR overexpressing cell lines using the VDR antibody and HRH1 showed an increase in protein levels (Fig. 5B).

thumbnail image

Figure Figure 5. Overexpression of VDR induces DPT, OCN, and HRH1 expression. (A) RT-PCR showing the differential expression of DPT, OCN, and HRH1 in both MG-63 (−) and MG-63-VDR (+) cells. (B) Western blot analysis of the same samples for DPT, HRH1, and VDR.

Download figure to PowerPoint

DPT and HRH1 inhibition decreases mineralization

To determine the role of DPT and HRH1 expression on osteogenic differentiation, osteoblastic tumor cell line (MG-63) and human MSCs were used. A stable cell line of VDR overexpressing MG-63 was transfected with siRNA to DPT and HRH1. Two different siRNA molecules were tested against DPT and HRH1, and a nonspecific siRNA transfection was used as a negative control. In the first experiment, MG-63-VDR cells were transfected with different concentrations of siRNA and were transferred to osteogenic medium. After 1 wk of incubation in osteogenic medium, the level of differentiation was tested by both ALP expression and by staining with alizarin red-S for mineral deposition. Both ALP and alizarin red-S assays showed a decrease in the mineralizing activity of the MG-63-VDR cells transfected with siRNA to DPT and HRH1 and not the nonspecific controls (Figs. 6A and 6B).

thumbnail image

Figure Figure 6. Inhibiting DPT and HRH1 decreases mineralization of MSCs. (A) ALP activity of MSCs transfected with siRNA targeting DPT and HRH1 (bars represent two different siRNA preparations and controls represent transfection with nonspecific siRNA). (B) Alizarin red S quantitation expressed in normalized values 10 days after siRNA transfection against DPT and HRH1. (C) Alizarin red S quantitation of MSCs treated with histamine receptor inhibitors. p values: *<0.05, **<0.005.

Download figure to PowerPoint

In another experiment to determine the specific activity of HRH1 in differentiation, histamine was used to induce HRH1 activity in human MSCs that were incubated in osteogenic media. The osteogenic cultures that were incubated with histamine were co-incubated with either mepyramine (HRH1 inhibitor) or ranitidine (HRH2 inhibitor), and the mineralizing activity was assayed by alizarin red-S quantitation (Fig. 6C). Alizarin red deposition was decreased in HRH1 inhibitor plates but was not affected in HRH2 inhibitor plates, suggesting the specificity of the HRH1 activity in mineralization.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

We previously showed that microarray assays on the time-courses of differentiation of MSCs can be used to identify candidates for new downstream targets for transcription factors that drive chondrogenesis and adipogenesis.(1) Here we used the same strategy to identify candidates for new downstream targets for transcription factors that are known to drive osteogenesis. To restrict our analysis to a manageable portion of the data, we focused on the transcription factor complex of VDR. We selected three genes as candidate targets based on the criterion that they were expressed in the same time-dependent pattern as osteocalcin, a known downstream target of VDR. Largely for technical reasons, we could not confirm a role as a downstream target for the candidate gene spondin 2. However, we were able to confirm the role of two of the candidate genes, DPT and HRH1, by showing that (1) RT-PCR analysis of their expression pattern corroborated the microarray data, the apparent decrease in the expression levels of osteocalcin could be because of the decreased RNA extraction efficiency with increased mineral deposition. (2) EMSA and ChIP assays showed that their promoter regions have VDR binding sequences, (3) overexpression of VDR induced expression of DPT and HRH1 in an osteosarcoma line, and (4) inhibitors of DPT and HRH1 decreased osteogenic differentiation of MSCs. Histamine did not enhance differentiation when added to the differentiation medium. Our reasoning for this phenomenon is that potent actions of osteogenic supplements in the media overrode the weak effect of histamine and histamine is a weak regulator for osteogenesis. Therefore, we confirmed that the strategy as applied to MSCs in culture is useful identifying new downstream targets for transcription factors known to drive differentiation. The same data can obviously be used to identify additional candidates for downstream targets for transcription factors known to drive osteogenesis.

Our study is, to our knowledge, the first to show that DPT and HRH1 are regulated by VDR during osteogenic differentiation of hMSCs. This was shown by both promoter binding and activity assays. DPT has been previously implicated in bone formation(39,40); however, this study implicates the role of VDR in DPT upregulation during osteogenesis. The role of HRH1 in bone metabolism has been the focus of several clinical and basic laboratory studies. The data presented here taken together with the published results indicate a possibility of reciprocal regulation between histamine and vitamin D actions on the decrease of BMD by histamine.(41) One study, in a synchronized resorption model, showed that histamine increases osteoclast activity and number through H1 and H2 receptors, respectively,(42) whereas other studies indicated that the histamine effects on bone resorption were indirect.(43,44) Increased histamine levels were also associated with normal or decreased parameters of bone formation,(45) although a direct effect of histamine on osteoblasts has not been reported. Osteotropic factors such as 1,25(OH)2D3, PTH, prostaglandin E (PGE)2, and interleukin (IL)-11 have been shown to stimulate the expression of RANKL as a membrane-associated factor in osteoblasts/stromal cells. RANKL expressed by osteoblasts/stromal cells also stimulates osteoclast function through cell-to-cell interaction.(45) HRH1 plays different roles in various cell types; the role of HRH1 upregulation in osteoblasts is not clearly known. Because vitamin D3 has different roles similar to a hormone, further studies are imperative to understand the role of HRH1 regulation by VDR in osteogenesis.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Human MSCs used in this work were provided by the Tulane Center for Gene Therapy through a grant from NCRR of the NIH, Grant P40RR017447. pCDNA VDR is kind gift from the Nancy Weigel laboratory at Baylor University, Houston, TX, USA. We thank Margaret Wolfe for the critical reading of the manuscript. This work was supported in part by NIH Grants AR 47796 and AR 48323, the Oberkotter Foundation, HCA the Healthcare Company, and the Louisiana Gene Therapy Research Consortium to DJP and NIH/NIAMS fellowship to RRP.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information
FilenameFormatSizeDescription
jbmr221338fsupp1.tif84KSupplementary Materials

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.