SEARCH

SEARCH BY CITATION

Keywords:

  • aryl hydrocarbon receptor;
  • 2,3,7,8-tetrachlorodibenzo -p -dioxin;
  • osteoblasts;
  • lead

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The AHR mediates many of the toxicological effects of aromatic hydrocarbons. We show that AHR expression in osteoblasts parallels the induction of early bone-specific genes involved in maturation. The AHR may not only mediate the effects of toxicants, but with an as yet unidentified ligand, be involved in the differentiation pathways of osteoblasts.

Introduction: Metabolic bone diseases arise as a result of an imbalance in bone cell activities. Recent evidence suggests that environmental toxicants may be contributing factors altering these activities. One candidate molecule implicated in mediating the toxic effects of exogenous compounds is the aryl hydrocarbon receptor (AHR).

Materials and Methods: Osteoblasts isolated from neonatal rat calvaria were analyzed for AHR expression by quantitative PCR, Western blot, and immunohistochemistry. In addition, AHR activation was evaluated by electromobility gel shift assay and fluorescence microscopy.

Results: Our findings showed AHR expression in mature osteoblasts in vivo. The pattern of AHR expression peaks after alkaline phosphatase and before induction of osteocalcin. We first show that AHR functions as a transactivating receptor in osteoblasts, as evidenced by its ligand-dependent migration to the nucleus and its association with known dioxin response elements. AHR activation by 2,3,7,8-tetrachlorodibenzo -p -dioxin (TCDD) mediated the induction of cytochrome p450 1A1 and cycloxygenase-2 protein levels. This effect could be inhibited by the potent AHR antagonist, 3′4 methoxynitroflavone. Furthermore, lead treatment of osteoblasts upregulates the expression of AHR mRNA and protein levels, supporting a novel mechanism whereby lead in the skeleton may increase the sensitivity of bone cells to toxicant exposure.

Conclusions: These data imply that the AHR mediates the effects of aromatic toxicants on bone and that AHR expression is regulated during osteoblast differentiation.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Osteoblast proliferation, differentiation, matrix synthesis, and mineralization comprise, an important series of events throughout the development and functioning of the skeleton. Osteoblasts are derived from mesenchymal stem cells and are responsible for synthesizing matrix proteins that subsequently become mineralized during the process of bone formation. Normal bone remodeling is a dynamic process that is characterized by a balance of bone resorption by osteoclasts and bone formation by osteoblasts.(1) Local cellular factors and hormones control the rate of remodeling, and an alteration in gene expression during osteoblast development may result in an imbalance in these processes.

Emerging evidence indicates that exposure to environmental toxicants influences osteoblast-specific functions. For example, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) decreases bone nodule formation by osteoblasts treated in vitro.(2) However, little is known about the mechanism by which TCDD inhibits osteoblast differentiation. These findings prompted us to study a possible role of the aryl hydrocarbon receptor (AHR) in osteoblast function. This transcription factor mediates the toxicity of persistent environmental contaminants such as polycyclic-aromatic hydrocarbons and congeners of dioxin/furan compounds. AHR ligands elicit toxic responses such as endocrine disruption, tumor promotion, immunosuppression, and interference with fatty acid metabolism and cell differentiation.(3–6) Notably, AHR ligands are also prevalent in tobacco smoke.(7–9) It is not known whether this may be related to the findings that smoking is a risk factor for bone loss and osteoporosis.

AHR transformation by a ligand is followed by loss of chaperone heat shock protein 90, nuclear translocation, and heterodimerization with the AHR nuclear translocator (ARNT; also known as HIF-β).(10) The heterodimer complex binds DNA responsive elements and regulates expression of a variety of genes including those involved in phase I and phase II drug metabolism.(11,12) Ligand binding seems to be a prerequisite step for AHR activation, and no endogenous ligand has yet been conclusively identified.

The AHR is part of the basic helix-loop-helix Per-Arnt-Sim family of proteins involved in organogenesis and cellular development, and this evolutionarily conserved family of transcription factors displays a unique pattern of developmental expression emerging as early as mouse embryonic day 9.5.(13) As such, some as yet unknown, normal functional role of the AHR has been hypothesized. Inactivating the AHR in mice by gene knockout has shown that this protein is necessary for normal development of several tissues including liver, immune system, heart, and vascular tissues, as well as for normal reproduction.(14–19) Here we present data indicating that the AHR is upregulated during osteoblast differentiation and further hypothesize that altered activation of the AHR signaling pathway by TCDD may mediate adverse effects on osteoblasts by modulating differentiation.

Another environmental toxicant, lead, also strongly influences the bone microenvironment. The diverse effects of lead on skeletal tissue include impaired collagen synthesis, reduced circulating osteocalcin levels, and altered endocrine system function.(20–22) Lead interferes with intracellular calcium signaling in a way that impairs the production of osteocalcin.(23,24) The potential for lead to increase the sensitivity of bone tissue to further toxicological insults has not been previously studied. However, recent evidence showed that lead can increase the expression of AHR-regulated genes in mouse hepatoma cells.(25) Therefore, we studied the ability of lead to influence AHR expression in osteoblasts. Herein we also report that AHR expression is upregulated in osteoblasts in response to treatment with lead.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Reagents

TCDD (Cambridge Isotopes, Cambridge, MA, USA) was dissolved in DMSO (10 μM) and diluted to working concentrations in culture media. 3′-methoxy-4′-nitroflavone (MNF; 5 mM; synthesized as previously described(26)) stock solutions were diluted to working concentrations in culture media. MNF was used at concentrations previously reported to antagonize AHR activation by TCDD.(27) One molar stock concentrations of lead acetate (Sigma, St Louis, MO, USA) were diluted to working concentrations in culture media.

Rat osteoblast isolation and culture conditions

Osteoblasts were isolated from neonatal rat calvaria as previously described(28) and were plated at a density of 2 × 105 cells/ml in low-glucose α-MEM medium (Invitrogen, Carlsbad, CA, USA) with 5% bovine serum, 10% Pen-Strep, and 50 μg/ml ascorbate. Osteoblasts were cultured in 6-well plates (volume of 2 ml) for 2 days to confluence and used for experimentation. Fresh media were added to the cells every 2 days. β-glycerol phosphate (BGP; 10 mM) was added to the media 2 days after plating to promote osteoblast differentiation and mineralization.(29) No toxicity was seen to osteoblasts when cultured with 5 and 10 nM TCDD or 0.5 and 1 μM MNF (data not shown). Cellular toxicity was assessed by the MTT assay and trypan blue exclusion.

Immunohistochemistry

Neonatal rat calvaria and calvaria from 4-wk-old wildtype and AHR knockout mice were harvested, fixed in 10% formalin, decalcified, and paraffin embedded. B6.129-Ahr tml Bra/J (AHR-KO) mice were obtained from The Jackson Laboratories (Bar Harbor, ME, USA) to initiate a breeding colony at our facilities. These animals have been back-crossed into the C57Bl/6 background for at least 20 generations. Sections (4 μm) were cut and stained with a polyclonal goat anti-mouse antibody specific for AHR (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or matched isotype control antibody. Visualization of the primary antibody was with a horseradish peroxidase (HRP)-conjugated rabbit anti-goat antibody (Jackson ImmunoResearch Laboratories, West Grove, PA, USA). Multiple calvaria sections were analyzed along with sections of mouse liver highly expressing AHR protein as a positive control. All sections were counterstained with eosin.

In vitro osteogenesis

Bone marrow cells were obtained from the femurs of 12- to 18-wk-old male wildtype and AHR knockout mice. Both femora were removed, and the soft tissues were detached aseptically. Bone marrow cells were collected by flushing the diaphysis with culture medium. A suspension of bone marrow cells was obtained by repeated aspiration of the cell preparation through a 22-gauge needle, and nucleated cells were counted with a hemocytometer. Bone marrow cells were incubated overnight and ascorbate supplemented medium was changed thereafter every 2 days for 1 wk. During the second week of culture, 10 mM BGP and 50 μg/ml ascorbate-supplemented medium was added to adherent cells to promote cell expansion and osteoblast differentiation. Nodule formation was assessed after 14 and 21 days in culture by alizarin red staining. Briefly, cells were washed with 2 ml of PBS and fixed with 10% formaldehyde at room temperature for 15 min. Cells were rinsed gently three times (5–10 min each) with an excess of distilled water. Cells were incubated with 1 ml of alizarin red solution (1% alizarin red/100% ethanol; Sigma) at room temperature for 20 min. Excess dye was removed, and cells were washed four times with deionized water. Differentiated cells containing mineral deposits were visualized on an Olympus BX51 microscope (Mellville, NY, USA).

RT-PCR

Total cellular RNA was harvested from cultured osteoblasts on days 1, 3, 5, 10, 15, and 20 after treatment with BGP. RNA was extracted using the Qiagen RNAeasy mini kit (Valencia, CA, USA) following the supplier's protocol. One microgram of RNA was used in a two-step approach: RT-PCR for first-strand cDNA synthesis using Clontech RT kit primed by an oligo(dt)primer (Mountain View, CA, USA). RNA (10 ng) was used in each cDNA amplification reaction. The following primers were used for real-time PCR amplification: GAPDH, 5′-accacagtcccatgccatcac-3′, tccaccaccctgttgctgta (400 bp); AHR, 5′-caaagggcagcagcttattattctggg-3′, aagcgtgcattggactggac (197 bp); alkaline phosphatase, 5′-tgatcactcccacgttttca-3′, ctgggcctggtagttgttgt (202 bp); osteocalcin, 5′-ctcctgcttggacatgaagg-3′, tagcagacaccatgaggacc (419 bp). No change in GAPDH mRNA levels was detected with culture conditions. GAPDH was used to normalize real-time RT-PCR reactions for purposes of quantitation. Quantitative PCR using CYBERGREEN master mix as the fluorescent DNA intercalating agent was analyzed using Rotorgene Software (Corbett Research, Sydney, Australia). Real-time PCR melt curve analysis showed the formation of single products that were electrophoresed on a 1.2% agarose gel. Identification of PCR products was confirmed by ABI sequencing.

SDS-PAGE and Western blot

Total cellular protein was collected from cultured osteoblasts on days 1, 3, 5, 10, 15, and 20 after treatment with BGP. Osteoblasts were lysed in protein isolation buffer (1% IGEPAL, 150 mM sodium chloride, 50 mM TRIS, 10% protease inhibitor cocktail) and quantified by a BCA protein assay kit (Pierce, Rockford, IL, USA). Ten to twenty micrograms of protein was fractionated by 7.5% SDS-PAGE and electrophoretically transferred onto nitrocellulose membranes. Membranes were blocked in 10% nonfat powdered milk in 1× PBS/0.1% Tween 20 and incubated with either a primary goat anti-mouse cyclooxygenase-2 (Cox-2; Cayman Chemical, Ann Arbor, MI, USA), a monoclonal anti-rat cytochrome p450 1A1 (CYP1A1; Xenotech, Kansas City, KS, USA), a polyclonal rabbit anti-mouse AHR (BioMol, Plymouth Meeting, PA, USA), an anti-mouse aryl hydrocarbon nuclear transporter (ARNT), or a mouse anti-actin (Oncogene Research Products, San Diego, CA, USA) antibody for 2 h at 20°C. After washing, membranes were incubated with secondary HRP-conjugated antibodies (Jackson Immunoresearch) for 1 h at 20°C. Bands were visualized with enhanced chemiluminescence (Amersham Biosciences, Piscataway, NJ, USA) and autoradiography film according to the manufacturer's protocol. The molecular weights for each protein detected were as follows: AHR, 99 kDa; ARNT, 87 kDa; actin, 45 kDa; Cox-2, 68–72 kDa; Cyp1A1, 55 kDa.

Immunofluorescence

Osteoblasts were cultured in the presence and absence of 10 nM TCDD for 60 min in 8-well chamber slides and analyzed for AHR nuclear localization by immunocytochemistry as previously described.(30) Cellular expression of AHR was detected in osteoblasts using rabbit polyclonal anti-AhR antibody (BioMol International) and visualized using Alexa-Fluor secondary antibody (Molecular Probes, Carlsbad, CA, USA). Incubation with secondary antibody alone was used as a control to assess nonspecific antibody binding. Nucleus was visualized by 4′,6′-diamidino-2-phenylindole (DAPI; Molecular Probes) staining. Cells were washed, lightly fixed in 2% paraformaldehyde (PFA) (5 min) and immediately visualized by fluorescence microscopy on an Axiovert 40 confocal microscope using an Axio camera.

EMSA

Osteoblasts cultured with BGP were treated with DMSO or TCDD for 15, 30, or 60 min. Nuclear extracts were collected at each time-point. Cells were lysed with buffer containing 10 mM HEPES-KOH, 1.5 mM MgCl2, and 10 mM KCl to retain a nuclear pellet. Nuclear pellets were dissolved in a buffer containing 20 mM HEPES-KOH, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, and 0.5 M EDTA. Five micrograms of nuclear protein was incubated in binding buffer [20 mM DTT, 25 mM HEPES, 10% glycerol, 1.5 mM EDTA, and 420 mM NaCl, and 0.05 mg/ml poly(dI:dC)] with a γ-32P end-labeled dioxin response element (DRE) oligonucleotide for 20 min. The sequence for DRE oligo was 5′-gatccggctcttctcacgcaactccgagctca-3′.(31) EMSA was performed at 60 V for 15 min and 140 V for 2.5–3 h. TCDD-treated liver lysate was used for a positive control for DRE binding, and untreated osteoblasts were a negative control.(10)

Alkaline phosphatase enzyme activity

Osteoblasts cultured for 5 days were treated with or without TCDD in the presence and absence of MNF for 24 h. Osteoblasts were washed three times in 0.9% NaCl and lysed with M-Per (Pierce). Twenty microliters of total lysate was added to 1 ml substrate p-nitrophenol phosphate dissolved in AMP buffer (BioRad, Hercules, CA, USA) at pH 10.5. After incubation at 37°C for 5 min, 0.5 ml stop solution (0.3 M Na3P04) was added, and alkaline phosphatase activity was measured at 410 nM on a Benchmark ELISA Plate reader (BioRad). Absorbance values were normalized to total protein levels that were quantified using a BCA kit (Pierce).

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

AHR expression by osteoblasts in vivo

Paraffin-embedded sections of neonatal rat calvarium were analyzed by immunohistochemistry to determine whether osteoblasts express AHR protein in vivo. Figure 1A shows AHR expression in osteoblasts from rat calvaria. Osteocytes do not express AHR protein in vivo. Figure 1B shows that AHR is expressed in adult mouse calvarial osteoblasts and that it is absent in AHR-deficient mice (Fig. 1C).

thumbnail image

Figure Figure 1. AHR expression by osteoblasts in vivo. AHR was expressed in the (A) cytoplasm of neonatal rat calvaria osteoblasts and (B) 4-wk-old mouse calvaria. (C) AHR expression was absent in AHR-deficient mice. Calvaria sections were stained in parallel with mouse liver as a positive control. Representative sections are shown (n = 3).

Download figure to PowerPoint

AHR upregulation during osteoblast differentiation

We next determined whether AHR expression was regulated in osteoblasts harvested from neonatal rat calvaria. Osteoblasts were induced to differentiate and form mineralized bone nodules in vitro with BGP and ascorbate.(29) To evaluate the AHR gene expression profile during this process, total RNA was harvested at different stages of osteoblast development and analyzed by RT-PCR. The data in Fig. 2A show that steady-state AHR mRNA levels were upregulated on days 3, 5, and 10 during osteoblast differentiation. The induction of steady-state alkaline phosphatase mRNA during differentiation and osteocalcin mRNA before mineralization are positive controls for the respective developmental stages of the tissue culture.(32) Further mRNA analysis using real-time RT-PCR showed a significant 4-fold induction of steady-state AHR mRNA levels on day 5 after BGP treatment (Fig. 2B). The peak 10-fold induction of AHR mRNA levels was detected on day 15 after BGP. The induction of AHR mRNA levels follows the increased alkaline phosphatase expression and precedes the induction of osteocalcin.

thumbnail image

Figure Figure 2. Regulation of AHR expression during osteoblast differentiation. Osteoblasts induced to differentiate with BGP plus ascorbate were harvested at different time-points to determine levels of AHR expression. (A) AHR mRNA levels increased on days 3, 5, and 10 after treatment with BGP and declined to near basal levels by days 15 and 20 as determined by RT-PCR. DNA products were electrophoresed on a 1.2% agarose gel. No changes in GAPDH mRNA levels were shown as a housekeeping gene control. (B) AHR mRNA levels were quantified during osteoblast differentiation using real-time RT-PCR. Cycle threshold values were generated for each sample using a standard curve for the target gene (AHR, alkaline phosphatase, or osteocalcin) and for the reference gene, GAPDH. After normalization to GAPDH levels, the target gene fold-induction on days 3, 5, 10, 15, and 20 over osteoblasts harvested on day 1 was calculated. aStatistical significance was determined by one-way ANOVA, p < 0.05. (C) Increased AHR protein expression on days 5 and 10 after treatment with BGP compared with days 1, 3, 15, and 20. Ten micrograms of total protein was loaded in each sample and β-actin was probed as a protein loading control. A representative experiment is shown (n = 3).

Download figure to PowerPoint

We next studied whether there was a concomitant upregulation of AHR protein during osteoblast differentiation as detected by Western blot. AHR protein was constitutively expressed in cultured osteoblasts and was elevated on days 5 and 10 after BGP treatment (Fig. 2C). These findings show that AHR protein expression was induced during differentiation and reduced to control levels during matrix maturation. An in vitro transcribed and translated AHR protein was used as a positive control and β-actin was used as a protein loading control. These findings of increased AHR mRNA and protein expression during critical stages of bone development may suggest a specific action for AHR in regulating skeletal development. Furthermore, these data also indicate that differentiating osteoblasts may be an important cellular target for the toxic AHR ligands.

Reduced in vitro osteogenesis by AHR-deficient compared with wildtype mice

The in vitro differentiation of bone marrow cells to mature osteoblasts with characteristics such as matrix maturation and eventual formation of multilayered nodules with a mineralized extracellular matrix was next evaluated in wildtype and AHR knockout mice. AHR knockout mice bone marrow cells showed a 70% reduction in bone nodule formation after 14 and 21 days of culture compared with wildtype (Fig. 3). Significant reductions in alkaline phosphatase activity were also measured in AHR knockout osteoblasts compared with wildtype. These findings showed that AHR is needed for optimal alkaline phosphatase activity in differentiating osteoblasts.

thumbnail image

Figure Figure 3. Reduced in vitro osteogenesis by AHR-deficient mice. Bone marrow cells from wildtype and AHR-deficient mice were induced to differentiate into mature osteoblasts that form nodules. AHR-deficient mice showed a significant 70% reduction in bone nodule formation after 14 days in culture compared with wildtype as visualized with alizarin red staining. Osteoblast alkaline phosphatase activity was also reduced in AHR-deficient osteoblasts. Replicates were presented as mean ± SE (n = 3).

Download figure to PowerPoint

Osteoblast AHR activation by TCDD

These findings indicating regulated AHR expression during osteoblast differentiation prompted us to evaluate whether AHR could migrate to the nucleus and bind DNA in response to TCDD, a potent AHR ligand. Osteoblasts were treated with vehicle (DMSO) or TCDD for 15, 30, and 60 min, and nuclear localization was determined by fluorescence microscopy. Figure 4A shows that, in untreated osteoblasts, AHR is present both in the cytosol and nucleus, but with TCDD exposure for 30 min, the receptor translocates entirely into the nucleus. These data confirmed ligand-dependent activation and nuclear localization of the AHR in osteoblasts. The ability of nuclear translocated AHR to bind to the DNA consensus sequence for the DRE was next determined by EMSA. Figure 4B shows increased DNA binding of the AHR after 30 and 60 min of TCDD treatment compared with vehicle-treated control cells. Liver cell lysate treated with TCDD was used as a positive control for DNA binding, and untreated osteoblasts represent the negative control. These data are consistent with the AHR being a functional transcription factor and a direct molecular target for TCDD in osteoblasts.

thumbnail image

Figure Figure 4. AHR transactivation in osteoblasts by TCDD. (A) Osteoblasts cultured in the presence and absence of TCDD were analyzed for AHR nuclear translocation as visualized by fluorescence microscopy. (B) TCDD-activated AHR binds to DNA consensus sequence after 60 minutes as detected by gel shift assay. Vehicle (DMSO)-treated cells were negative for AHR DNA binding activity, and TCDD-treated liver lysate was used as a positive control. Data are representative of three experiments.

Download figure to PowerPoint

TCDD-activated AHR induced CYP1A1 and Cox-2 protein expression

Given that the ligand-activated AHR in osteoblasts binds DNA, we investigated whether AHR could upregulate CYP1A1 protein levels, a conventional marker of AHR transcriptional activity.(33) As shown in Fig. 5A, exposure to 5 and 10 nM TCDD for 6 h increased CYP1A1 protein expression compared with vehicle-treated cells as detected by Western blot. A DRE was recently reported in the Cox-2 promoter,(34) and we therefore also examined Cox-2 expression after TCDD treatment in osteoblasts. Interestingly, a dramatic increase in Cox-2 expression by osteoblasts in response to AHR ligand compared with vehicle-treated osteoblasts was detected. The levels of AHR and ARNT remained relatively unchanged.

thumbnail image

Figure Figure 5. CYP1A1 and Cox-2 induction by TCDD-treated osteoblasts. (A) Osteoblasts treated with vehicle (DMSO) or TCDD for 6 h were analyzed for changes in CYP1A1 (55 kDa), Cox-2 (70 kDa), AHR (99 kDa), and ARNT (87 kDa) protein expression as detected by Western blot. β-actin was used as a loading control. (B) Osteoblasts co-incubated with the AHR antagonist, MNF, and exposed to TCDD for 24 h reduced the induction of CYP1A1 and Cox-2 protein levels (arrows) compared with TCDD alone. Data are representative of three experiments.

Download figure to PowerPoint

To determine whether the induction of CYP1A1 and Cox-2 protein by TCDD was mediated by AHR activation, we incubated osteoblasts with the AHR antagonist, MNF, in the presence and absence of TCDD for 6 h. As shown in Fig. 5B, the CYP1A1 and Cox-2 induction by 10 nM TCDD was substantially reduced by treatment with 0.5 or 1 μM MNF. These findings indicate that AHR activation by TCDD was responsible for increased CYP1A1 and Cox-2 protein levels.

TCDD reduced osteoblast alkaline phosphatase activity through an AHR-dependent mechanism

Increased alkaline phosphatase activity is a marker of osteoblast differentiation.(32) Alkaline phosphatase activity was measured in these studies to determine whether TCDD altered an osteoblast-specific function. Osteoblasts cultured with BGP were treated for 24 h with DMSO or increasing concentrations of TCDD. TCDD (2.5 and 5 nM) significantly reduced alkaline phosphatase enzymatic activity after 24 h. A statistically significant dose-dependent decrease in enzymatic activity was seen after 48 h with 1 and 2.5 nM TCDD (Fig. 6A). We determined that TCDD did not affect cell viability and was not directly inhibiting alkaline phosphatase enzyme activity (data not shown), and therefore, we next investigated whether this reduction occurred by an AHR-dependent mechanism. Osteoblasts were pretreated with the AHR antagonist, MNF, for 20 min and incubated in the presence and absence of TCDD for 24 h. The data in Fig. 6B show that the dose-dependent reduction in alkaline phosphatase activity by TCDD was completely reversed in osteoblasts treated with 1 μM MNF. These data support that TCDD reduced alkaline phosphatase activity in an AHR-dependent manner during osteoblast differentiation.

thumbnail image

Figure Figure 6. AHR antagonism restores TCDD-mediated reduction in osteoblast alkaline phosphatase activity. (A) TCDD exposure to osteoblasts resulted in a significant dose-dependent decrease in alkaline phosphatase activity after 24 and 48 h. Data are shown as mean ± SD (n = 4). (B) AHR antagonist, MNF, dose-dependently increased the TCDD-mediated decrease in alkaline phosphatase activity after 24 h. Data are shown as mean ± SD (n = 3). aStatistical significance was determined by one-way ANOVA, p < 0.05.

Download figure to PowerPoint

Lead induced upregulation of osteoblast AHR expression

Because bone is a storage depot for lead in the body, recent evidence confirmed that there are chronic adverse effects of lead on skeletal metabolism.(35–37) We studied whether lead modulates AHR expression. We first examined changes in steady-state AHR mRNA levels in response to increasing doses of lead as detected by real-time RT-PCR. Figure 7A shows that lead-treated osteoblasts increased steady-state AHR mRNA levels compared with untreated osteoblasts after 24 h. There was a significant 4-fold induction of AHR mRNA levels with 0.1 μM lead and an 8-fold induction in osteoblasts treated with 0.5 μM lead compared with untreated cells. The effect seemed to be biphasic in nature, because higher concentrations of lead did not evoke the same level of induction. We next determined whether the elevated AHR mRNA levels resulted in increased AHR protein expression. Consistent with the lead-induced AHR mRNA levels, a significant increase in AHR protein expression was detected in the 0.5 μM lead-treated osteoblasts compared with vehicle control (Fig. 7B). These data reveal a novel mechanism by which lead can influence bone tissue and implicate this heavy metal as an enhancer of the effects of toxic AHR ligands.

thumbnail image

Figure Figure 7. Lead induces AHR expression in cultured osteoblasts. Osteoblasts were cultured for 2 days to confluence and treated with increasing concentrations of lead acetate for 24 h and analyzed for changes in AHR expression. (A) AHR mRNA levels in lead-treated osteoblasts were quantified by real-time RT-PCR. Cycle threshold values were normalized to GAPDH and fold induction was calculated over control (vehicle) cells. Data are shown as means ± SD (n = 3). aStatistical significance was determined by one-way ANOVA, p < 0.05 (B) Lead (0.5 μM) induces AHR protein expression compared with control osteoblasts cultured for 24 h. A biphasic response is seen as higher doses of lead reduced AHR expression. Data are representative of three experiments.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The data in this report showed a functional AHR signaling pathway in osteoblasts that may mediate both toxic and physiological responses during osteoblast development. AHR protein expression was clearly shown in neonatal rat calvarium in vivo (Fig. 1). Steady-state AHR mRNA levels and protein expression were regulated in osteoblasts that were induced to differentiate (Fig. 2). The pattern of AHR expression peaks after alkaline phosphatase and before induction of osteocalcin. Furthermore, AHR-deficient mouse bone marrow cells showed reduced differentiation to mature nodule forming osteoblasts compared with wildtype mice (Fig. 3). Together these data, along with ligand-activated AHR nuclear localization and binding to the DRE, support a possible novel function for this transcription factor in osteoblasts (Fig. 4). Our data showed that stimulation of AHR by TCDD decreases osteoblast alkaline phosphatase activity and suggests that this family of transcription factors modulates expression and/or activity of differentiation molecules in bone tissue. Moreover, the reduction in alkaline phosphatase activity by differentiating AHR-deficient osteoblasts indicates that a delicate balance of AHR activity is needed for nodule formation. Recent evidence supports a role for the AHR in osteoclastogenesis, because another AHR ligand, 3-methylcholanthrene, inhibited RANKL expression by osteoblastic cells.(38) Future studies that address whether the ligand-activated AHR alters other aspects of osteoblast differentiation (e.g., cell cycle progression, cytokine production) will enhance our understanding of the mechanisms by which AHR ligands influence the bone microenvironment. However, at present, it is not clear how possible endogenous AHR ligands influence the cellular growth and differentiation of osteoblasts compared with the toxic ligands.

Given that AHR expression peaks during osteoblast differentiation, this critical stage of bone development should be considered a susceptible target for toxic ligands to disrupt normal bone formation processes. AHR ligands may alter the normal processes of bone formation by inducing changes in gene expression. AHR transactivation by TCDD increased CYP1A1 and Cox-2 protein expression (Fig. 5). Although endogenous regulation of CYP1A1 and Cox-2 augment bone formation,(39) inappropriate upregulation of these enzymes by toxicants may exert adverse effects on the bone microenvironment.(40,41) Seidel et al.(42) reported activation of the AHR signaling pathway by prostaglandins in mouse hepatoma cells, suggesting a role for the AHR in mediating the effects of prostaglandins. However, our data revealed that AHR ligands may promote prostaglandin production at an inappropriate time in bone development and thus influence bone formation in ways that are not yet fully appreciated. Similarly, altered regulation of CYP1A1 drug-metabolizing activity could contribute to the overproduction of toxic metabolites and reactive oxygen species, thus interfering with tightly regulated bone formation processes. Moreover, we found that 1 μM MNF treatment alone increased Cox-2 levels (Fig. 5B), contrary to the ability of this AHR antagonist to completely reduce the TCDD-mediated upregulation of Cox-2. These findings support previous reports suggesting that MNF has low AHR agonist activity.(43)

Inappropriate activation of the AHR by TCDD during osteoblast differentiation not only influenced gene expression but also mediated significant reductions in alkaline phosphatase enzymatic activity (Fig. 6). We show that the reduction in alkaline phosphatase activity by TCDD was mediated through the AHR, because pretreatment with the AHR antagonist, MNF, dose-dependently restored osteoblast alkaline phosphatase activity. Future studies evaluating the potent AHR antagonist in osteoblasts and particularly the influence on their differentiation will provide more insight into the effects of TCDD that are AHR dependent and may guide the discovery of the role of AHR in bone physiology. These findings reported herein suggest that other bone-specific activities may be altered by TCDD exposure and warrant further study of the effects of AHR ligands on bone tissue in vivo.

In contrast to reports of AHR degradation after activation within isolated cells,(44) Franc et al.(45) reported in vivo upregulation of the AHR in rat liver in response to dioxin. The in vivo phenomenon suggests the possibility for continuous sensitization of the cells to the effects of persistent environmental chemicals. We report that lead upregulated AHR mRNA and protein expression in cultured osteoblasts, suggesting a similar mechanism by which osteoblasts may be more susceptible to insults by other toxic AHR ligands. The ability of lead to actively alter bone processes immediately after it becomes sequestered in the skeleton and throughout the life of an organism is appreciated, but still not yet well understood. A recent study showed differential effects of heavy metals on the constitutive and inducible expression of AHR-regulated genes in cultured hepatoma cells.(25) We postulate that lead-induced AHR expression influences endogenous AHR transactivation during osteoblast differentiation, and that exposure to exogenous ligands may only exacerbate the adverse effects of lead. Furthermore, the likelihood of successive and continuous exposure to organic and inorganic compounds in human populations supports the need for future studies to address the effects of mixtures, particularly because bone tissue is a reservoir for lead. Our finding of increased AHR expression by lead may have important implications for further increased sensitivity of bone to a variety of persistent environmental chemicals (e.g., dioxin, cigarette smoke, polychlorinated biphenyls) and warrants the active study of mixtures in vivo.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The authors thank Barbara Stroyer for assistance with the histology and immunohistochemistry. The work in this manuscript was supported by NIH Grants T32 ES07026, P30 ES01247, R01 ES09430, R25 CA102618, and P01 ES 11845.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  • 1
    Ducy P, Schinke T, Karsenty G 2000 The osteoblast: A sophisticated fibroblast under central surveillance. Science 289: 15011504.
  • 2
    Gierthy JF, Silkworth JB, Tassinari M, Stein GS, Lian JB 1994 2,3,7,8-Tetrachlorodibenzo-p-dioxin inhibits differentiation of normal diploid rat osteoblasts in vitro. J Cell Biochem 54: 231238.
  • 3
    Safe S 2001 Molecular biology of the Ah receptor and its role in carcinogenesis. Toxicol Lett 120: 17.
  • 4
    Willey JJ, Stripp BR, Baggs RB, Gasiewicz TA 1998 Aryl hydrocarbon receptor activation in genital tubercle, palate, and other embryonic tissues in 2,3,7, 8-tetrachlorodibenzo-p-dioxin-responsive lacZ mice. Toxicol Appl Pharmacol 151: 3344.
  • 5
    White TE, Gasiewicz TA 1993 The human estrogen receptor structural gene contains a DNA sequence that binds activated mouse and human Ah receptors: A possible mechanism of estrogen receptor regulation by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Biochem Biophys Res Commun 193: 956962.
  • 6
    Iwano S, Nukaya M, Saito T, Asanuma F, Kamataki T 2005 A possible mechanism for atherosclerosis induced by polycyclic aromatic hydrocarbons. Biochem Biophys Res Commun 335: 220226.
  • 7
    Dertinger SD, Nazarenko DA, Silverstone AE, Gasiewicz TA 2001 Aryl hydrocarbon receptor signaling plays a significant role in mediating benzo[a]pyrene- and cigarette smoke condensate-induced cytogenetic damage in vivo. Carcinogenesis 22: 171177.
  • 8
    Dertinger SD, Silverstone AE, Gasiewicz TA 1998 Influence of aromatic hydrocarbon receptor-mediated events on the genotoxicity of cigarette smoke condensate. Carcinogenesis 19: 20372042.
  • 9
    Gebremichael A, Tullis K, Denison MS, Cheek JM, Pinkerton KE 1996 Ah-receptor-dependent modulation of gene expression by aged and diluted sidestream cigarette smoke. Toxicol Appl Pharmacol 141: 7683.
  • 10
    Henry EC, Gasiewicz TA 1993 Transformation of the aryl hydrocarbon receptor to a DNA-binding form is accompanied by release of the 90 kDa heat-shock protein and increased affinity for 2,3,7,8-tetrachlorodibenzo-p-dioxin. Biochem J 294: 95101.
  • 11
    Xu C, Li CY, Kong AN 2005 Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch Pharm Res 28: 249268.
  • 12
    Schrenk D 1998 Impact of dioxin-type induction of drug-metabolizing enzymes on the metabolism of endo- and xenobiotics. Biochem Pharmacol 55: 11551162.
  • 13
    Jain S, Maltepe E, Lu MM, Simon C, Bradfield CA 1998 Expression of ARNT, ARNT2, HIF1 alpha, HIF2 alpha and Ah receptor mRNAs in the developing mouse. Mech Dev 73: 117123.
  • 14
    Abbott BD, Schmid JE, Pitt JA, Buckalew AR, Wood CR, Held GA, Diliberto JJ 1999 Adverse reproductive outcomes in the transgenic Ah receptor-deficient mouse. Toxicol Appl Pharmacol 155: 6270.
  • 15
    Fernandez-Salguero P, Pineau T, Hilbert DM, McPhail T, Lee SS, Kimura S, Nebert DW, Rudikoff S, Ward JM, Gonzalez FJ 1995 Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science 268: 722726.
  • 16
    Fernandez-Salguero PM, Ward JM, Sundberg JP, Gonzalez FJ 1997 Lesions of aryl-hydrocarbon receptor-deficient mice. Vet Pathol 34: 605614.
  • 17
    Lahvis GP, Lindell SL, Thomas RS, McCuskey RS, Murphy C, Glover E, Bentz M, Southard J, Bradfield CA 2000 Portosystemic shunting and persistent fetal vascular structures in aryl hydrocarbon receptor-deficient mice. Proc Natl Acad Sci USA 97: 1044210447.
  • 18
    Schmidt JV, Su GH, Reddy JK, Simon MC, Bradfield CA 1996 Characterization of a murine Ahr null allele: Involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci USA 93: 67316736.
  • 19
    Thackaberry EA, Bedrick EJ, Goens MB, Danielson L, Lund AK, Gabaldon D, Smith SM, Walker MK 2003 Insulin regulation in AhR-null mice: Embryonic cardiac enlargement, neonatal macrosomia, and altered insulin regulation and response in pregnant and aging AhR-null females. Toxicol Sci 76: 407417.
  • 20
    Klein RF, Wiren KM 1993 Regulation of osteoblastic gene expression by lead. Endocrinology 132: 25312537.
  • 21
    Pounds JG, Long GJ, Rosen JF 1991 Cellular and molecular toxicity of lead in bone. Environ Health Perspect 91: 1732.
  • 22
    Ronis MJ, Badger TM, Shema SJ, Roberson PK, Shaikh F 1998 Effects on pubertal growth and reproduction in rats exposed to lead perinatally or continuously throughout development. J Toxicol Environ Health A 53: 327341.
  • 23
    Carmouche JJ, Puzas JE, Zhang X, Tiyapatanaputi P, Cory-Slechta DA, Gelein R, Zuscik M, Rosier RN, Boyce BF, O'Keefe RJ, Schwarz EM 2005 Lead exposure inhibits fracture healing and is associated with increased chondrogenesis, delay in cartilage mineralization, and a decrease in osteoprogenitor frequency. Environ Health Perspect 113: 749755.
  • 24
    Schanne FA, Dowd TL, Gupta RK, Rosen JF 1989 Lead increases free Ca2+ concentration in cultured osteoblastic bone cells: Simultaneous detection of intracellular free Pb2+ by 19F NMR. Proc Natl Acad Sci USA 86: 51335135.
  • 25
    Korashy HM, El-Kadi AO 2004 Differential effects of mercury, lead and copper on the constitutive and inducible expression of aryl hydrocarbon receptor (AHR)-regulated genes in cultured hepatoma Hepa 1c1c7 cells. Toxicology 201: 153172.
  • 26
    Gasiewicz TA, Kende AS, Rucci G, Whitney B, Willey JJ 1996 Analysis of structural requirements for Ah receptor antagonist activity: Ellipticines, flavones, and related compounds. Biochem Pharmacol 52: 17871803.
  • 27
    Zhou JG, Henry EC, Palermo CM, Dertinger SD, Gasiewicz TA 2003 Species-specific transcriptional activity of synthetic flavonoids in guinea pig and mouse cells as a result of differential activation of the aryl hydrocarbon receptor to interact with dioxin-responsive elements. Mol Pharmacol 63: 915924.
  • 28
    Declercq H, Van den Vreken N, De Maeyer E, Verbeeck R, Schacht E, De Ridder L, Cornelissen M 2004 Isolation, proliferation and differentiation of osteoblastic cells to study cell/biomaterial interactions: Comparison of different isolation techniques and source. Biomaterials 25: 757768.
  • 29
    Aronow MA, Gerstenfeld LC, Owen TA, Tassinari MS, Stein GS, Lian JB 1990 Factors that promote progressive development of the osteoblast phenotype in cultured fetal rat calvaria cells. J Cell Physiol 143: 213221.
  • 30
    Filbrandt CR, Wu Z, Zlokovic B, Opanashuk L, Gasiewicz TA 2004 Presence and functional activity of the aryl hydrocarbon receptor in isolated murine cerebral vascular endothelial cells and astrocytes. Neurotoxicology 25: 605616.
  • 31
    Henry EC, Rucci G, Gasiewicz TA 1994 Purification to homogeneity of the heteromeric DNA-binding form of the aryl hydrocarbon receptor from rat liver. Mol Pharmacol 46: 10221027.
  • 32
    Bronckers AL, Gay S, Finkelman RD, Butler WT 1987 Developmental appearance of Gla proteins (osteocalcin) and alkaline phosphatase in tooth germs and bones of the rat. Bone Miner 2: 361373.
  • 33
    Li W, Harper PA, Tang BK, Okey AB 1998 Regulation of cytochrome P450 enzymes by aryl hydrocarbon receptor in human cells: CYP1A2 expression in the LS180 colon carcinoma cell line after treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin or 3-methylcholanthrene. Biochem Pharmacol 56: 599612.
  • 34
    Puga A, Hoffer A, Zhou S, Bohm JM, Leikauf GD, Shertzer HG 1997 Sustained increase in intracellular free calcium and activation of cyclooxygenase-2 expression in mouse hepatoma cells treated with dioxin. Biochem Pharmacol 54: 12871296.
  • 35
    Puzas JE, Sickel MJ, Felter ME 1992 Osteoblasts and chondrocytes are important target cells for the toxic effects of lead. Neurotoxicology 13: 783788.
  • 36
    Steenhout A 1982 Kinetics of lead storage in teeth and bones: An epidemiologic approach. Arch Environ Health 37: 224231.
  • 37
    Campbell JR, Rosier RN, Novotny L, Puzas JE 2004 The association between environmental lead exposure and bone density in children. Environ Health Perspect 112: 12001203.
  • 38
    Naruse M, Otsuka E, Naruse M, Ishihara Y, Miyagawa-Tomita S, Hagiwara H 2004 Inhibition of osteoclast formation by 3-methylcholanthrene, a ligand for arylhydrocarbon receptor: Suppression of osteoclast differentiation factor in osteogenic cells. Biochem Pharmacol 67: 119127.
  • 39
    Tang CH, Yang RS, Huang TH, Lu DY, Chuang WJ, Huang TF, Fu WM 2006 Ultrasound stimulates cyclooxygenase-2 expression and increases bone formation through integrin, focal adhesion kinase, phosphatidylinositol 3-kinase, and Akt pathway in osteoblasts. Mol Pharmacol 69: 20472057.
  • 40
    Aydin-Sayitoglu M, Hatirnaz O, Erensoy N, Ozbek U 2006 Role of CYP2D6, CYP1A1, CYP2E1, GSTT1, and GSTM1 genes in the susceptibility to acute leukemias. Am J Hematol 81: 162170.
  • 41
    Napoli N, Villareal DT, Mumm S, Halstead L, Sheikh S, Cagaanan M, Rini GB, Armamento-Villareal R 2005 Effect of CYP1A1 gene polymorphisms on estrogen metabolism and bone density. J Bone Miner Res 20: 232239.
  • 42
    Seidel SD, Winters GM, Rogers WJ, Ziccardi MH, Li V, Keser B, Denison MS 2001 Activation of the Ah receptor signaling pathway by prostaglandins. J Biochem Mol Toxicol 15: 187196.
  • 43
    Zhou J, Gasiewicz TA 2003 3′-methoxy-4'-nitroflavone, a reported aryl hydrocarbon receptor antagonist, enhances Cyp1a1 transcription by a dioxin responsive element-dependent mechanism. Arch Biochem Biophys 416: 6880.
  • 44
    Pollenz RS 2002 The mechanism of AH receptor protein down-regulation (degradation) and its impact on AH receptor-mediated gene regulation. Chem Biol Interact 141: 4161.
  • 45
    Franc MA, Pohjanvirta R, Tuomisto J, Okey AB 2001 In vivo up-regulation of aryl hydrocarbon receptor expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in a dioxin-resistant rat model. Biochem Pharmacol 62: 15651578.