SEARCH

SEARCH BY CITATION

Keywords:

  • osteoporosis;
  • bone mineralization;
  • nutrition;
  • polymorphism;
  • association

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. Reference

The MTHFR C677T polymorphism is associated with mildly elevated homocysteine levels when folate and/or riboflavin status is low. Furthermore, a mildly elevated homocysteine level is a risk factor for osteoporotic fractures. We studied whether dietary intake of riboflavin and folate modifies the effects of the MTHFR C677T variant on fracture risk in 5035 men and women from the Rotterdam Study. We found that the MTHFR C677T variant interacts with dietary riboflavin intake to influence fracture risk in women.

Introduction: The MTHFR C677T polymorphism is associated with mildly elevated homocysteine (Hcy) levels in the presence of low folate and/or riboflavin status. A mildly elevated Hcy level was recently identified as a modifiable risk factor for osteoporotic fracture. We studied whether dietary intake of riboflavin and folate modifies the effects of the MTHFR C677T polymorphism on BMD and fracture risk.

Materials and Methods: We studied 5035 individuals from the Rotterdam Study, ≥55 yr of age, who had data available on MTHFR, nutrient intake, and fracture risk. We performed analysis on Hcy levels in a total of 666 individuals, whereas BMD data were present for 4646 individuals (2692women).

Results: In the total population, neither the MTHFR C677T polymorphism nor low riboflavin intake was associated with fracture risk and BMD. However, in the lowest quartile of riboflavin intake, female 677-T homozygotes had a 1.8 (95% CI: 1.1-2.9, p = 0.01) times higher risk for incident osteoporotic fractures and a 2.6 (95% CI: 1.3-5.1, p = 0.01) times higher risk for fragility fractures compared with the 677-CC genotype (interaction, p = 0.0002). This effect was not seen for baseline BMD in both men and women. No significant influence was found for dietary folate intake on the association between the MTHFR C677T genotype and fracture risk or BMD. In the lowest quartile of dietary riboflavin intake, T-homozygous individuals (men and women combined) had higher (22.5%) Hcy levels compared with C-homozygotes (mean difference = 3.44 νM, p = 0. 01; trend, p = 0.02).

Conclusions: In this cohort of elderly whites, the MTHFR C677T variant interacts with dietary riboflavin intake to influence fracture risk in women.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. Reference

Osteoporosis is a condition characterized by low BMD and microarchitectural change in bone tissue, which leads to reduced bone strength and increased risk of fracture.(1) Genetic and environmental risk factors interact to influence BMD, bone loss,(2,3) and fracture risk.(4) We and others have described that mildly elevated circulating homocysteine (Hcy) level is a potentially modifiable risk factor for osteoporotic fracture.(5,6)

It is not yet clear whether the relationship between Hcy and fracture risk is causal. A small placebo-controlled trial in stroke patients showed reduced fracture risk in response to lowering Hcy levels, suggesting a causal link.(7) However, this trial needs replication in the general elderly population using an appropriate design and sufficient power to detect the differences in fracture risk.(8) Another way to show a causal relationship between increased Hcy and fracture risk is by studying genetic variants that determine Hcy levels.(9) The most well-known genetic determinant of Hcy levels in the general population is the common C677T polymorphism in the methylentetrahydrofolate reductase (MTHFR) gene.(10)

MTHFR is required for the formation of methyltetrahydrofolate, which in turn is necessary to convert Hcy to methionine. The MTHFR C677T variant is associated with increased Hcy levels and has been implicated in increased risk of a wide range of adverse health conditions throughout life, from birth defects(11) to cardiovascular disease,(12) cancer,(13) pregnancy complications,(14) psychiatry disorders,(15) and osteoporosis(16) in the elderly.

The MTHFR C677T polymorphism results in an alanine (Ala) to valine (Val) substitution at position 222 of the protein, giving rise to a thermolabile enzyme with reduced activity.(10) To be active, MTHFR needs to bind to a co-factor, flavin adenine dinucleotide (FAD), a derivative of riboflavin. The T677 allele affects the binding site for FAD, resulting in a lower affinity for FAD than the C677 allele.(17,18) This binding can be stabilized by the addition of folate or riboflavin.(17,18) Therefore, low riboflavin or folate status may reduce MTHFR activity, especially in individuals with the TT genotype, which results in increased Hcy levels. Indeed, riboflavin and folate levels were shown to be predictors of Hcy levels in individuals homozygous for the MTHFR T677, and it is thought that higher riboflavin and folate intake are required in T-homozygous individuals to maintain low Hcy levels.(17,19,20)

A number of studies found a relationship between this polymorphism and BMD(16,21,22) or fracture.(16) Some studies have investigated the association of the MTHFR C677T variant with BMD in relation to the four B vitamins (riboflavin [B2], pyridoxine [B6], folate [B11], and cobalamin [B12]) involved in Hcy metabolism,(22-24) but results are inconsistent. These inconsistencies could be caused by differences in nutrient intake across the populations studied, because it is well known that the phenotypic expression of the MTHFR C677T variant is dependent on folate and riboflavin status.

We examined the influence of riboflavin and/or folate status on the relation between the MTHFR C677T variant and risk of fracture and studied whether the dietary riboflavin and folate intake influence the relationship of MTHFR C677T variant with BMD, bone loss, and Hcy levels in a large population-based prospective cohort of elderly white of the Rotterdam Study.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. Reference

Study population

This study was embedded in the Rotterdam Study, a population-based cohort study of men and women in which all residents of the Rotterdam suburb Ommoord ≥55 yr of age were invited to take part. The design of the study has been described elsewhere.(25) Written informed consent was obtained from all participants, and the Medical Ethics Committee of the Erasmus Medical Center approved the study. Baseline data collection was conducted between January 1990 and June 1993, whereas the follow-up assessment of BMD was performed between July 1996 and December 1999. A total of 7983 men and women participated in the study (response rate, 78%), and for this analysis, we studied 5035 men and women who were genotyped for the MTHFR C677T variant and had available data on nutrient intake and fracture data. We performed analysis on Hcy levels in a total of 666 individuals, and BMD data were present for 4646 individuals.

Dietary intake

At baseline, participants completed a checklist at home that queried foods and drinks they had consumed at least twice a month during the preceding year and dietary habits, use of supplements, and prescribed diets. Next, during their visit to the research center, they underwent a standardized interview with a dietician based on the checklist, using a 170-item semiquantitative food frequency questionnaire. A validation study comparing this questionnaire with a 2-wk food diary showed reproducible and valid estimates.(26) These dietary data were converted to total energy intake and nutrient intake per day with the computerized Dutch Food Composition Table. Therefore, dietary habits were assessed using validated food intake data from a food frequency questionnaire and were available for 5035 men and women who have been genotyped. Dietary vitamin B intake was adjusted for energy intake as described elsewhere.(27)

Measurement of Hcy levels

Nonfasting blood samples from 666 subjects at baseline (250 men and 416 women) were immediately placed on ice and processed within 60 min. Serum samples were kept frozen until Hcy levels were measured. Total Hcy levels were determined as a fluorescence derivate with the use of high-pressure liquid chromatography and expressed as micromoles per liter (νM).(28,29)

Fracture follow-up

Fracture events were obtained from the computerized records of the general practitioners (GPs) in the research area. Research physicians regularly followed participant information in the GP's records outside the research area and made an independent review and encoding of all reported events. Subsequently, a medical expert in the field reviewed all coded events for the final classification of diseases, 10th revision (ICD-10).(30) Additional information on hip fractures was gathered through the Dutch National Hospital Registration system. Information on incident osteoporotic fractures was available for an average follow-up period of 7.4 ± 3.3 (SD) yr (n = 707 fractures). For studying incident fractures, all fractures that were considered not osteoporotic (fractures caused by cancer and all hand, foot, skull, and face fractures) were excluded. We considered separately fragility fractures occurring at the hip, pelvic, and proximal humerus (n = 269 fractures).(31)

Measurement of BMD

BMD (g/cm2) of the hip and lumbar spine (L2-L4) (LS) was measured by DXA using a Lunar DPX- densitometry apparatus (DPX-L; Lunar, Madison, WI, USA), under standard protocols. To increase the accuracy of BMD measurements on follow-up, the search and template tools in the comparison mode were used to position the femoral neck region of interest in scans of the same individual using DPX-IQ software. The rate of change in BMD (mg/cm2/yr) was calculated as the difference between baseline and follow-up BMD divided by the time (in years) elapsed between measurements (and multiplied by a factor of 1000 for scale convenience; mean, 6.5 ± 0.6 yr). The relative change of BMD from baseline was estimated as the difference in BMD between assessment periods divided by the BMD at baseline.

Anthropometric measurements

Height (cm) and weight (kg) were measured at the initial examination, in standing position wearing indoor clothes without shoes. Body mass index (BMI) was computed as weight in kilogram divided by height in meters squared.

Possible confounders

Possible confounders were taken from measures made at baseline. The presence of type II diabetes mellitus was defined by the current use of anti-diabetic medication or by a nonfasting or postload plasma glucose levels > 11.1 mM.(32) Dementia was diagnosed with the use of the Mini-Mental State Examination and the Geriatric Mental State Schedule.(33) The presence of myocardial infarction was assessed by questionnaires and by analysis the ECGs using the Modular Electrocardiogram Analysis System (MEANS).(34) The number of falls in the preceding year and current smoking status were assessed with the use of a questionnaire.

Genotyping

Genomic DNA was extracted from samples of peripheral venous blood according to standard procedures. One to two nanograms genomic DNA was dispensed into 384-well plates using a Caliper Sciclone ALH3000 pipetting robot (Caliper LS, Mountain View, CA, USA). Genotypes were determined using the Taqman allelic discrimination assay. The Assay-by-Design service (www.appliedbio-systems.com) was used to set up a Taqman allelic discrimination assay for the MTHFR C677T polymorphism (primers: forward, CCTCAAAGAAAAGCTGCGTGATG; reverse, GCACTTGAAGGAGAAGGTGTCT; probes: FAM-ATGAAATCGACTCCCGC and VIC-ATGAAATCGGCTCCCGC). The PCR reaction mixture included 1-2 ng of genomic DNA in a 2-νl volume and the following reagents: FAM and VIC probes (200 nM), primers (0.9 uM), and 2× Taqman PCR master mix (ABgene, Epsom, UK). Reagents were dispensed in a 384-well plate using the Deerac Equator NS808 (Deerac Fluidics, Dublin, Ireland). PCR cycling reaction was performed in 384-well PCR plates in an ABI 9700 PCR system (Applied Biosystems, Foster City, CA, USA) and consisted of initial denaturation for 15 min at 95°C and 40 cycles with denaturation of 15 s at 95°C, and annealing and extension for 60 s at 60°C. Results were analyzed by the ABI Taqman 7900HT using the sequence detection system 2.22 software (Applied Biosystems, Foster City, CA, USA). To confirm the accuracy of genotyping results, 332 (5%) randomly selected samples were regenotyped with the same method. No inconsistencies were observed.

Statistical analysis

Allele and genotype frequencies of the MTHFR C677T variant were tested for Hardy-Weinberg equilibrium proportions with χ2 test.

ANOVA was used to examine the associations between the MTHFR C677T variant with Hcy levels and BMD measurements across genotypes and quartiles of vitamin intake. Analysis of covariance (ANCOVA) was performed to adjust for possible confounders such as BMI, age, and comorbidity. In case of a consistent trend, shown as an allele dose effect, we performed a linear regression analysis to quantify the association.

Variables were log-transformed if they did not meet normality assumptions; this was the case for Hcy levels and dietary folate intake. Riboflavin and folate intake was analyzed as a categorical variable with quartile cut-off points. Quartiles have been made in a sex-specific manner and have been energy adjusted.

To estimate incident fracture risk, we used Cox proportional hazard models, thereby taking potential differences in follow-up time into account with adjustment for age. Further adjustments were also made for possible confounders, i.e., type II diabetes mellitus, dementia, current smoking status, and recent falls. We studied the possible interaction between dietary riboflavin intake and the MTHFR C677T genotype in relation to fracture by including a product term of the two main effects in a Cox regression model with fracture as the dependent variable.

Population attributable risks were calculated with the use of the formula {P(RR − 1)/[P(RR − 1) + 1]} × 100, where P is the percentage of the population exposed and RR is the relative risk of fracture.

A p value <0.05 was considered significant. All analyses were done using the SPSS package version 11.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. Reference

Allele and genotype frequencies were in Hardy Weinberg equilibrium proportions (p = 0.2), with a T allele frequency of 33%. The T allele frequency was similar in men and women and did not change with age. Table 1 shows general characteristics of the study population across MTHFR C677T genotypes. No significant differences in age, height, weight, and BMI were seen across the MTHFR C677T genotype groups in both sexes (Table 1). Serum plasma Hcy levels were 3.5 νM (23.9%) higher in male TT carriers and 1.1 νM (8.2%) higher in female TT carriers compared with the CC genotype, with evidence of an allele dose effect (p for trend < 0.001 in males and p for trend = 0.03 in females; Table 1). Overall, women were significantly older and had significantly lower dietary intake of nutrients compared with men.

Table Table 1.. Baseline characteristics by MTHFR genotype (C677T) in 2093 men and 2942 women of the Rotterdam Study
Thumbnail image of

Hcy levels

In a subset of individuals with Hcy level measurements, we studied the relationship between the MTHFR genotype and Hcy levels across quartiles of dietary riboflavin and folate intake. In the lowest quartile of dietary riboflavin intake, T-homozygous individuals (men and women combined) had 3.44 νM higher (22.5%) Hcy levels compared with C-homozygotes (p = 0. 01; p for interaction = 0.05; Fig. 1). For dietary folate intake, we found similar results, with Hcy levels being 4.77 νM higher in T-homozygous individuals compared with C-homozygotes (p = 0.001; p for interaction = 0.1). The results suggested a possible threshold effect in the lowest quartile of dietary riboflavin or folate intake. When we stratified according to sex, we only observed a significant effect in women, whereas in men, a similar trend was seen that did not reach significance. Further adjustments for all possible confounders and factors related to comorbidity did not alter the results.

thumbnail image

Figure Fig. 1.. Hcy levels by MTHFR genotype (C677T) in quartiles of dietary riboflavin intake in both men and women. Bars represents back-transformed means with SEs. Adjustments were done for sex, age, and BMI. Hcy levels in TT homozygous subjects in the lowest quartile of dietary riboflavin intake were compared with those with the TT genotype in the three remaining quartiles. N, numbers of subjects.

Download figure to PowerPoint

BMD and BMD-loss

No association was observed in men or women between the MTHFR C677T variant and baseline BMD (femoral neck and lumbar spine), BMD-loss at the femoral neck, and risk of fracture (Table 2).

Table Table 2.. Bone Parameters by MTHFR Genotype (C677T) in 2093 Men and 2942 Women of the Rotterdam Study
Thumbnail image of

We studied the effect of dietary riboflavin and folate intake on a possible relation between the MTHFR C677T genotype and baseline BMD. For this reason, we grouped individuals by quartiles of dietary riboflavin or folate intake and examined the relationship between MTHFR genotype and baseline BMD (femoral neck and lumbar spine) and bone loss. We observed no effect of the MTHFR genotype on baseline BMD across quartiles of dietary riboflavin or folate intake, eeither in FN or in LS (Table 3). However, in women, an effect of riboflavin on the relation between MTHFR genotype and BMD-loss was observed. Women with the TT genotype in the lowest quartile of dietary riboflavin intake had higher rate of BMD-loss compared with the CC genotype (1.4% versus 0.9% of baseline-year, p = 0.05). Adjustment for age, height, and weight did not affect the results. We were unable to study whether differences in Hcy levels explained the observed association with BMD-loss, because we had a small number of people available that had both baseline Hcy levels and bone loss data.

Table Table 3.. Bone Parameters by MTHFR Genotype (C677T) Within Quartiles of Dietary Riboflavin Intake in the Rotterdam Study
Thumbnail image of

In men, no effect was observed of dietary riboflavin intake on the relation between the C677T MTHFR genotype and baseline BMD (neither in FN nor in LS) or BMD-loss (Table 3).

Dietary folate intake did not influence the relationship between the MTHFR C677T genotype and bone parameters in both men and women.

Fracture incidence

We analyzed fracture risk according to quartiles of riboflavin and folate intake, and we did not observe an association (data not shown). We next examined the association between the MTHFR C677T genotype and incident fracture risk according to quartiles of energy-adjusted riboflavin or folate intake. In the lowest quartile of dietary riboflavin intake, T-homozygous women had an almost 2-fold higher risk for incident osteoporotic fracture compared with those with the CC genotype (RR = 1.8; 95% CI, 1.2-2.9; p = 0.01; p for interaction = 0.03; Fig. 2A). In men, we found no interaction between dietary riboflavin intake and the MTHFR C677T genotype with fracture risk (Fig. 2B). The effect of riboflavin intake was even more pronounced for fragility fracture (Fig. 3). TT homozygous women in the lowest quartile had a 2.6-fold higher risk of fragility fracture compared with those with the CC genotype (RR = 2.6; 95% CI, 1.3-5.1; p = 0.01). A highly significant interaction was observed between the MTHFR C677T polymorphism, dietary riboflavin intake, and fragility fracture risk (p = 0.0002; Fig. 3). Adjustment for femoral neck BMD and femoral neck bone loss did not alter these results. Additional correction for comorbidity factors (such as dementia, diabetes mellitus type II, prevalence of myocardial infarction, smoking status, and recent falls) did not affect the results. Similarly, we examined the association between the MTHFR C677T genotype and fracture risk according to quartiles of energy-adjusted dietary folate intake, but we did not observe any influence of dietary folate neither in women nor in men.

thumbnail image

Figure Fig. 2.. Incident osteoporotic fracture by MTHFR genotype (C677T) in quartiles of dietary riboflavin intake in women (A) and in men (B). Bars represents hazard ratios with 95% CIs. Adjustments were done for age and BMI.

Download figure to PowerPoint

thumbnail image

Figure Fig. 3.. Fragility fracture by MTHFR genotype (C677T) in quartiles of dietary riboflavin intake in women. Bars represents hazard ratios with 95% CIs. Adjustments were done for age and BMI.

Download figure to PowerPoint

In the women who had Hcy values available (n = 416), we tried to examine whether the riboflavin-intake dependent association between the MTHFR C677T genotype and fracture risk was dependent on Hcys levels. In this small and selected group, we observed an increased fracture risk for T-homozygous women in the lowest quartile of riboflavin intake, which did not reach significance (RR = 4.03; 95% CI, 0.61-26.60). Adjustment for baseline Hcy levels did not essentially change this risk estimate (RR = 3.75; 95% CI, 0.51-27.48).

Population attributable risk

For women in the lowest quartile of riboflavin intake, we calculated the population attributable risk (PAR) for the TT genotype. The risk of fragility fracture that was attributable to MTHFR TT genotype was estimated 17% in women that had low riboflavin intake. In the total population, the PAR for the MTHFR TT genotype in combination with low riboflavin intake was 5%. For all incident osteoporotic fractures, these PARs were 9% and 2.3%, respectively. Therefore, based on our results, one could argue that 5% of fragility fractures (or 2.3% of all incident osteoporotic fractures) in our female population would potentially be prevented if all women are supplemented with riboflavin. This is much higher in women with low riboflavin intake, where 17% of fragility and 9% of all incident osteoporotic fractures might be prevented.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. Reference

This study showed that there is a relationship between the MTHFR C677T genotype and fracture risk depending on dietary riboflavin (vitamin B2) intake. Women homozygous for the T allele had a higher Hcy level and increased risk for fracture than CC homozygotes but only when dietary riboflavin intake was low.

We recently identified elevated Hcy levels as a new risk factor for fracture.(5) This risk was independent of known risk factors for fracture, such as BMD. In this study, the increased fracture risk by MTHFR genotype was again independent of BMD or other known risk factors for fracture such as age, dementia, cardiovascular disease, and other measures of comorbidity. This suggests that an elevated Hcy level caused by the MTHFR 677TT genotype in combination with low dietary riboflavin intake is a risk factor predicting fracture independently of other known risk factors and supports the initial results in our observational study.(8)

Although we observed an effect on fracture, no association between the MTHFR C677T variant and BMD was seen. This is in line with one previous study(37) but is not consistent with other studies(16,21) that did show effects of this polymorphism on BMD. We cannot fully explain this difference; however, our study population is older than reported in previous studies. We therefore hypothesize that, at older age, perhaps other mechanisms than Hcy are important in determining BMD.

We did not find any effect of dietary folate intake on the relationship between the MTHFR and fracture risk in our cohort. It seems that, in our population, riboflavin intake is a more important determinant compared with folate intake for increased fracture risk in T-homozygous individuals. Our results are consistent with an earlier study that reported a significant effect of riboflavin intake but not folate intake on the MTHFR genotype in determining BMD.(22)

Previous research on the dietary regulation of increased Hcy concentrations has implicated both low folate and cobalamin intakes in elevated levels of Hcy. However, recent studies suggest that among individuals carrying the MTHFR 677 TT genotype, riboflavin status might be a more potent modulator of Hcy levels than folate status.(38) In the Framingham Study, an association between the TT genotype and Hcy was found to be dependent on low folate status.(19) Thus, riboflavin did not seem to be the limiting nutrient. The most likely explanation for the inconsistencies in the aforementioned studies is that mandatory fortification of flour with riboflavin has been in place since the 1940s in the United States. The impact of this policy in optimizing riboflavin status in the general U.S. population would reduce the extent to which riboflavin is found to be a limiting nutrient in determining Hcy levels in individuals with the TT genotype.

Several biological mechanisms could explain how elevated Hcy levels are related to fracture risk. It was suggested that Hcy concentrations may interfere with collagen cross-linking, resulting in poor quality of bone and increased susceptibility to fracture.(39) Recent evidence showed that higher levels of Hcy are correlated with excretion of higher levels of collagen cross-links.(40) In a pilot study of 100 individuals, we also found that high Hcy levels are not associated with lower levels of collagen cross-links per excreted collagen molecule, but instead found a tendency toward a higher number of collagen cross-links (unpublished data). However, these are bone resorption markers, and one expects the Hcy effect on bone (if real) to affect the quality of newly formed bone, something that is not monitored effectively by any of the markers studied thus far. In addition, no one knows the exact concentration of Hcy at the environment of the active osteoid and whether it is sufficient to interfere with collagen cross-links. Interestingly, Paschalis et al.(41) observed altered cross-links in fragile bone specifically in the microenvironment of the bone-forming surfaces, which would support this hypothesis. In addition, Saito et al.(42) recently showed that bone tissue of fracture cases had a lower amount of cross-links and increased Hcy levels compared with controls. An alternative hypotheses explaining the relationship between Hcy and fracture was recently suggested by showing that Hcy may have a direct effect on bone by stimulating osteoclast formation and osteoclast activity.(43) This is in line with our observation that women with the TT genotype had higher BMD loss (possibly reflecting higher osteoclast activity) when dietary riboflavin intake was low. However, this effect was only borderline significant and could not explain the increased risk of fracture seen in these same individuals. We cannot exclude that changes in BMD may occur after the initial fracture, making bone loss a secondary phenomenon rather than a causal factor.

Our results do not prove that elevated Hcy is the cause of the observed associations. In a subgroup for whom Hcy levels were available, adjustment of the increased fracture risk for Hcy levels did not affect the risk estimates. However, because data on Hcy levels were only available in a small number of individuals, it is difficult to draw any conclusion from this analysis. Nevertheless, it is possible that the higher risk of fracture is not caused by higher Hcy levels, but by other factors related to a higher Hcy level such as impaired DNA methylation.(35,36)

In men, no association was observed between the MTHFR C677T variant and risk of fracture by dietary riboflavin intake. An explanation for this noticeable difference in effect by sex is not immediately apparent; however, because of the lower incidence of fracture in men, lack of power to detect an association in men might contribute to this. For studying the effect of low dietary riboflavin intake together with the MTHFR genotype on risk of fracture, the sample size permitted us to detect a relative risk of 2.3 with 80% power for fragility fracture in women. In men, we had 80% power to detect a relative risk of 3.2 or more (for all incident fractures, the required relative risks are 1.9 in women and 2.5 in men). In addition, men might have a different threshold for dietary riboflavin intake, below which the effect of the MTHFR C677T genotype can become apparent, because in general, riboflavin intake was higher in men compared with women. Further studies are needed to elucidate the sex specificity of our findings.

Population stratification might be a confounder in genetic association studies. However, because our study has a population-based cohort design and consists of ethnically homogenous elderly Dutch white living in a stable area with little emigration/immigration, we believe that stratification is not a major concern in our study.

The strengths of this study lies within the size of our study population and validated dietary assessment with high response rate. The study has also some limitations. Only baseline dietary intakes were available and not vitamin levels, whereas a combination of dietary intake and vitamin levels might provide a better predictive power for vitamin effects on bone health than dietary vitamin intake alone. Although our study is large, it represents a single observation concerning this interaction. Replication of this finding in different populations is necessary to establish its consistency.

In conclusion, whereas the MTHFR C677T variant had no overall effect on fracture risk, it strongly interacts with dietary riboflavin intake to determine fracture risk in our cohort of elderly white women. A low dietary riboflavin status results in a higher fracture risk for TT genotype women. This suggests that riboflavin intake modifies the effect of the MTHFR C677T variant on fracture risk. This study highlights the importance of exploring gene-environment interaction in osteoporosis.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. Reference

This work was supported by the Netherlands Organization for Scientific Research (NWO) 014-93-015 and the European GENOMOS project QLK6-CT-2002-02629. The Rotterdam Study is supported by the Erasmus Medical Center and Erasmus University Rotterdam, the Netherlands Organization for Health Research and Development (ZonMw), the Research Institute for Diseases in the Elderly (RIDE), the Ministry of Education, Culture and Science, the Ministry of Health, Welfare and Sports, the European Commission (DG XII), and the Municipality of Rotterdam. The contributions of the general practitioners and pharmacists of the Ommoord district to the Rotterdam Study are greatly acknowledged.

Reference

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. Reference
  • 1
    Kanis JA, Melton LJ III, Christiansen C, Johnston CC, Khaltaev N 1994 The diagnosis of osteoporosis. J Bone Miner Res 9: 11371141.
  • 2
    Pocock NA, Eisman JA, Hopper JL, Yeates MG, Sambrook PN, Eberl S 1987 Genetic determinants of bone mass in adults. A twin study. J Clin Invest 80: 706710.
  • 3
    Ralston SH 2005 Genetic determinants of osteoporosis. Curr Opin Rheumatol 17: 475479.
  • 4
    Keen RW, Hart DJ, Arden NK, Doyle DV, Spector TD 1999 Family history of appendicular fracture and risk of osteoporosis: A population-based study. Osteoporos Int 10: 161166.
  • 5
    van Meurs JB, Dhonukshe-Rutten RA, Pluijm SM, van der Klift M, de Jonge R, Lindemans J, de Groot LC, Hofman A, Witteman JC, van Leeuwen JP, Breteler MM, Lips P, Pols HA, Uitterlinden AG 2004 Homocysteine levels and the risk of osteoporotic fracture. N Engl J Med 350: 20332041.
  • 6
    McLean RR, Jacques PF, Selhub J, Tucker KL, Samelson EJ, Broe KE, Hannan MT, Cupples LA, Kiel DP 2004 Homocysteine as a predictive factor for hip fracture in older persons. N Engl J Med 350: 20422049.
  • 7
    Sato Y, Honda Y, Iwamoto J, Kanoko T, Satoh K 2005 Effect of folate and mecobalamin on hip fractures in patients with stroke: A randomized controlled trial. JAMA 293: 10821088.
  • 8
    van Meurs JB, Uitterlinden AG 2005 Homocysteine and fracture prevention. JAMA 293: 11211122.
  • 9
    Davey Smith G, Ebrahim S 2003 ‘Mendelian randomization’: Can genetic epidemiology contribute to understanding environmental determinants of disease? Int J Epidemiol 32: 122.
  • 10
    Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, Boers GJ, den Heijer M, Kluijtmans LA, van den Heuvel LP, Rozen R 1995 A candidate genetic risk factor for vascular disease: A common mutation in methylenetetrahydrofolate reductase. Nat Genet 10: 111113.
  • 11
    Mills JL, Kirke PN, Molloy AM, Burke H, Conley MR, Lee YJ, Mayne PD, Weir DG, Scott JM 1999 Methylenetetrahydrofolate reductase thermolabile variant and oral clefts. Am J Med Genet 86: 7174.
  • 12
    Casas JP, Bautista LE, Smeeth L, Sharma P, Hingorani AD 2005 Homocysteine and stroke: Evidence on a causal link from mendelian randomisation. Lancet 365: 224232.
  • 13
    Ma J, Stampfer MJ, Giovannucci E, Artigas C, Hunter DJ, Fuchs C, Willett WC, Selhub J, Hennekens CH, Rozen R 1997 Methylenetetrahydrofolate reductase polymorphism, dietary interactions, and risk of colorectal cancer. Cancer Res 57: 10981102.
  • 14
    Powers RW, Minich LA, Lykins DL, Ness RB, Crombleholme WR, Roberts JM 1999 Methylenetetrahydrofolate reductase polymorphism, folate, and susceptibility to preeclampsia. J Soc Gynecol Investig 6: 7479.
  • 15
    Freeman JM, Finkelstein JD, Mudd SH 1975 Folate-responsive homocystinuria and “schizophrenia”. A defect in methylation due to deficient 5,10-methylenetetrahydrofolate reductase activity. N Engl J Med 292: 491496.
  • 16
    Abrahamsen B, Madsen JS, Tofteng CL, Stilgren L, Bladbjerg EM, Kristensen SR, Brixen K, Mosekilde L 2003 A common methylenetetrahydrofolate reductase (C677T) polymorphism is associated with low bone mineral density and increased fracture incidence after menopause: Longitudinal data from the Danish osteoporosis prevention study. J Bone Miner Res 18: 723729.
  • 17
    Hustad S, Ueland PM, Vollset SE, Zhang Y, Bjorke-Monsen AL, Schneede J 2000 Riboflavin as a determinant of plasma total homocysteine: Effect modification by the methylenetetrahydrofolate reductase C677T polymorphism. Clin Chem 46: 10651071.
  • 18
    Guenther BD, Sheppard CA, Tran P, Rozen R, Matthews RG, Ludwig ML 1999 The structure and properties of methylenetetrahydrofolate reductase from Escherichia coli suggest how folate ameliorates human hyperhomocysteinemia. Nat Struct Biol 6: 359365.
  • 19
    Jacques PF, Kalmbach R, Bagley PJ, Russo GT, Rogers G, Wilson PW, Rosenberg IH, Selhub J 2002 The relationship between riboflavin and plasma total homocysteine in the Framingham Offspring cohort is influenced by folate status and the C677T transition in the methylenetetrahydrofolate reductase gene. J Nutr 132: 283288.
  • 20
    McNulty H, McKinley MC, Wilson B, McPartlin J, Strain JJ, Weir DG, Scott JM 2002 Impaired functioning of thermolabile methylenetetrahydrofolate reductase is dependent on riboflavin status: Implications for riboflavin requirements. Am J Clin Nutr 76: 436441.
  • 21
    Miyao M, Morita H, Hosoi T, Kurihara H, Inoue S, Hoshino S, Shiraki M, Yazaki Y, Ouchi Y 2000 Association of methylenetetrahydrofolate reductase (MTHFR) polymorphism with bone mineral density in postmenopausal Japanese women. Calcif Tissue Int 66: 190194.
  • 22
    Macdonald HM, McGuigan FE, Fraser WD, New SA, Ralston SH, Reid DM 2004 Methylenetetrahydrofolate reductase polymorphism interacts with riboflavin intake to influence bone mineral density. Bone 35: 957964.
  • 23
    McLean RR, Karasik D, Selhub J, Tucker KL, Ordovas JM, Russo GT, Cupples LA, Jacques PF, Kiel DP 2004 Association of a common polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene with bone phenotypes depends on plasma folate status. J Bone Miner Res 19: 410418.
  • 24
    Abrahamsen B, Madsen JS, Tofteng CL, Stilgren L, Bladbjerg EM, Kristensen SR, Brixen K, Mosekilde L 2005 Are effects of MTHFR (C677T) genotype on BMD confined to women with low folate and riboflavin intake? Analysis of food records from the Danish osteoporosis prevention study. Bone 36: 577583.
  • 25
    Hofman A, Grobbee DE, de Jong PT, van den Ouweland FA 1991 Determinants of disease and disability in the elderly: The Rotterdam Elderly Study. Eur J Epidemiol 7: 403422.
  • 26
    Klipstein-Grobusch K, den Breeijen JH, Goldbohm RA, Geleijnse JM, Hofman A, Grobbee DE, Witteman JC 1998 Dietary assessment in the elderly: Validation of a semiquantitative food frequency questionnaire. Eur J Clin Nutr 52: 588596.
  • 27
    Willett WC, Howe GR, Kushi LH 1997 Adjustment for total energy intake in epidemiologic studies. Am J Clin Nutr 65: 1220S1228S.
  • 28
    Araki A, Sako Y 1987 Determination of free and total homocysteine in human plasma by high-performance liquid chromatography with fluorescence detection. J Chromatogr 422: 4352.
  • 29
    Ubbink JB, Hayward Vermaak WJ, Bissbort S 1991 Rapid high-performance liquid chromatographic assay for total homocysteine levels in human serum. J Chromatogr 565: 441446.
  • 30
    World Health Organization 1992 International Statistical Classification of Diseases and Related Health Problems, 10th ed. World Health Organization, Geneva, Switzerland.
  • 31
    Cooper C 1993 The epidemiology of fragility fractures: Is there a role for bone quality? Calcif Tissue Int 53: S23S26.
  • 32
    Alberti KG, Zimmet PZ 1998 Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: Diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 15: 539553.
  • 33
    Ott A, Breteler MM, van Harskamp F, Stijnen T, Hofman A 1998 Incidence and risk of dementia. The Rotterdam Study. Am J Epidemiol 147: 574580.
  • 34
    de Bruyne MC, Kors JA, Hoes AW, Kruijssen DA, Deckers JW, Grosfeld M, van Herpen G, Grobbee DE, van Bemmel JH 1997 Diagnostic interpretation of electrocardiograms in population-based research: Computer program research physicians, or cardiologists? J Clin Epidemiol 50: 947952.
  • 35
    Lathrop Stern L, Shane B, Bagley PJ, Nadeau M, Shih V, Selhub J 2003 Combined marginal folate and riboflavin status affect homocysteine methylation in cultured immortalized lymphocytes from persons homozygous for the MTHFR C677T mutation. J Nutr 133: 27162720.
  • 36
    Kimura M, Umegaki K, Higuchi M, Thomas P, Fenech M 2004 Methylenetetrahydrofolate reductase C677T polymorphism, folic acid and riboflavin are important determinants of genome stability in cultured human lymphocytes. J Nutr 134: 4856.
  • 37
    Jorgensen HL, Madsen JS, Madsen B, Saleh MM, Abrahamsen B, Fenger M, Lauritzen JB 2002 Association of a common allelic polymorphism (C677T) in the methylene tetrahydrofolate reductase gene with a reduced risk of osteoporotic fractures. A case control study in Danish postmenopausal women. Calcif Tissue Int 71: 386392.
  • 38
    McNulty H, Dowey le RC, Strain JJ, Dunne A, Ward M, Molloy AM, McAnena LB, Hughes JP, Hannon-Fletcher M, Scott JM 2006 Riboflavin lowers homocysteine in individuals homozygous for the MTHFR 677C->T polymorphism. Circulation 113: 7480.
  • 39
    McKusick VA 1966 Heritable Disorders of Connective Tissue, 3rd ed. C.V. Mosby, St Louis, MO, USA.
  • 40
    Dhonukshe-Rutten RA, Pluijm SM, de Groot LC, Lips P, Smit JH, van Staveren WA 2005 Homocysteine and vitamin B12 status relate to bone turnover markers, broadband ultrasound attenuation, and fractures in healthy elderly people. J Bone Miner Res 20: 921929.
  • 41
    Paschalis EP, Shane E, Lyritis G, Skarantavos G, Mendelsohn R, Boskey AL 2004 Bone fragility and collagen cross-links. J Bone Miner Res 19: 20002004.
    Direct Link:
  • 42
    Saito M, Fujii K, Marumo K 2006 Degree of mineralization-related collagen crosslinking in the femoral neck cancellous bone in cases of hip fracture and controls. Calcif Tissue Int 79: 160168.
  • 43
    Koh JM, Lee YS, Kim YS, Kim DJ, Kim HH, Park JY, Lee KU, Kim GS 2006 Homocysteine enhances bone resorption by stimulation of osteoclast formation and activity through increased intracellular ROS generation. J Bone Miner Res 21: 10031011.