Activation of Renin-Angiotensin System Induces Osteoporosis Independently of Hypertension

Authors

  • Yutaro Asaba,

    1. Department of Bone and Joint Disease, Research Institute, National Center for Geriatrics and Gerontology, Obu, Aichi, Japan
    2. Department of Surgery, Nagoya University Graduate School of Medicine, Nagoya, Japan
    Search for more papers by this author
  • Masako Ito,

    1. Department of Radiology, Nagasaki University School of Medicine, Nagasaki, Japan
    Search for more papers by this author
  • Toshio Fumoto,

    1. Department of Bone and Joint Disease, Research Institute, National Center for Geriatrics and Gerontology, Obu, Aichi, Japan
    Search for more papers by this author
  • Ken Watanabe,

    1. Department of Bone and Joint Disease, Research Institute, National Center for Geriatrics and Gerontology, Obu, Aichi, Japan
    Search for more papers by this author
  • Ryoji Fukuhara,

    1. Department of Bone and Joint Disease, Research Institute, National Center for Geriatrics and Gerontology, Obu, Aichi, Japan
    Search for more papers by this author
  • Sunao Takeshita,

    1. Department of Bone and Joint Disease, Research Institute, National Center for Geriatrics and Gerontology, Obu, Aichi, Japan
    Search for more papers by this author
  • Yuji Nimura,

    1. Department of Surgery, Nagoya University Graduate School of Medicine, Nagoya, Japan
    Search for more papers by this author
  • Junji Ishida,

    1. Life Sciences and Bioengineering, Graduate School of Life and Environmental Sciences, University of Tsukuba, Ibaraki, Japan
    Search for more papers by this author
  • Akiyoshi Fukamizu,

    1. Life Sciences and Bioengineering, Graduate School of Life and Environmental Sciences, University of Tsukuba, Ibaraki, Japan
    2. Aspect of Functional Genomic Biology, Center for Tsukuba Advanced Research Alliance (TARA), University of Tsukuba, Ibaraki, Japan
    Search for more papers by this author
  • Kyoji Ikeda

    Corresponding author
    1. Department of Bone and Joint Disease, Research Institute, National Center for Geriatrics and Gerontology, Obu, Aichi, Japan
    • Address reprint requests to: Kyoji Ikeda, MD, Department of Bone and Joint Disease, National Center for Geriatrics and Gerontology, 36-3 Gengo, Morioka, Obu, Aichi 474-8522, Japan
    Search for more papers by this author

  • The authors state that they have no conflicts of interest.

Abstract

Hypertension and osteoporosis are two major age-related disorders; however, the underlying molecular mechanism for this comorbidity is not known. The renin-angiotensin system (RAS) plays a central role in the control of blood pressure and has been an important target of antihypertensive drugs. Using a chimeric RAS model of transgenic THM (Tsukuba hypertensive mouse) expressing both the human renin and human angiotensinogen genes, we showed in this study that activation of RAS induces high turnover osteoporosis with accelerated bone resorption. Transgenic mice that express only the human renin gene were normotensive and yet exhibited a low bone mass, suggesting that osteoporosis occurs independently of the development of hypertension per se. Ex vivo cultures showed that angiotensin II (AngII) acted on osteoblasts and not directly on osteoclast precursor cells and increased osteoclastogenesis-supporting cytokines, RANKL and vascular endothelial growth factor (VEGF), thereby stimulating the formation of osteoclasts. Knockdown of AT2 receptor inhibited the AngII activity, whereas silencing of the AT1 receptor paradoxically enhanced it, suggesting a functional interaction between the two AngII receptors on the osteoblastic cell surface. Finally, treatment of THM mice with an ACE inhibitor, enalapril, improved osteoporosis and hypertension, whereas treatment with losartan, an angiotensin receptor blockers specific for AT1, resulted in exacerbation of the low bone mass phenotype. Thus, blocking the synthesis of AngII may be an effective treatment of osteoporosis and hypertension, especially for those afflicted with both conditions.

INTRODUCTION

Hypertension and osteoporosis are two major age-related disorders, which together account for significant morbidity and mortality in the elderly by predisposing to cardiovascular diseases, fragility fractures, and their sequelae, respectively.math image Both hypertension and osteoporosis are multifactorial disorders, in which genetic and lifestyle factors contribute to the pathogenesis.math image,math image Epidemiological studies suggest a link between osteoporotic fractures and hypertension,math image stroke,math image or cardiovascular events.math image,math image High blood pressure is associated with increased bone loss at the femoral neck,math image and low BMD has been shown to be strongly associated with deaths from stroke.math image However, the cellular and molecular mechanisms underlying the comorbidity of hypertension and osteoporosis with aging are not known, and the two disorders have been treated separately and additively by antihypertensive and anti-osteoporosis drugs, respectively.

The renin-angiotensin system (RAS) is an endocrine system that governs body fluid and electrolyte balance and blood pressure.math image In the classic endocrine RAS, angiotensinogen produced in the liver is sequentially cleaved by peptidases to form the biologically active octapeptide angiotensin II (AngII). Renin produced by the juxtaglomerular apparatus of the kidney and secreted into the circulation cleaves angiotensinogen to the inactive decapeptide angiotensin I, which is cleaved by angiotensin-converting enzyme (ACE) to generate AngII. The initial reaction between the enzyme renin and the substrate angiotensinogen is the rate-limiting step of the RAS, for which strict species specificity exists. We have previously established transgenic THM (Tsukuba hypertensive mouse), which by expressing both human renin and human angiotensinogen genes and using endogenous murine ACE and AngII receptors, successfully reproduces a chimeric RAS cascade with increased AngII production and hypertension. THM not only showed that RAS plays an important role in the pathogenesis of hypertensionmath image but has been widely used for studying the role of RAS in various pathological conditions, such as pregnancy-associated hypertension.math image The RAS has been an important target of antihypertensive drugs,math image especially ACE inhibitorsmath image and angiotensin receptor blockers (ARBs).

In an attempt to explore the mechanistic link between hypertension and osteoporosis, we studied the skeletal phenotype of THM mice, focusing our study on the mechanism underlying the low bone mass phenotype, whether it is caused by osteoclast or osteoblast dysfunction, how RAS impinges on bone cell activities, whether it reflects systemic or local activation of RAS, and finally, from a therapeutic perspective, whether antihypertensive drugs that target RAS are potentially an effective remedy to treat osteoporosis simultaneously.

MATERIALS AND METHODS

Reagents

AngII was purchased from the Peptide Institute (Osaka, Japan), losartan potassium and enalapril were from LTK Laboratories (St Paul, MN, USA), and propranolol hydrochloride was from Sigma (St Louis, MO, USA). 1α,25-Dihydroxyvitamin D3 [1α,25(OH)2D3] was purchased from Nacalai Tesque (Kyoto, Japan). Mouse RANKL and macrophage-colony stimulating factor (M-CSF) were purchased from R&D Systems (Minneapolis, MN, USA).

Generation of THM and animal experiments

THM mice were produced by mating doubly transgenic mice expressing human angiotensinogen gene (ANG/ANG) and those expressing the human renin gene (RN/RN),math image which were all on the C57BL/6J genetic background. Age- and sex-matched C57BL/6J wildtype mice were used for controls. THM were also produced by mating single transgenic male mice expressing human angiotensinogen (ANG/+) and female transgenic mice expressing human renin gene (RN/+), because the mating of female ANG/+ and male RN/+ did not give birth to healthy offspring, because of pregnancy-associated hypertension caused by the combined action of maternal angiotensinogen and placenta-derived renin.math image In this case, nontransgenic littermates served as a control. The identification of four different genotypes (ANG/RN or THM, ANG/+, RN/+, +/+) was performed by Southern and PCR analyses of genomic DNA extracted from tail, using the following primers and probes: 5′-CTGCAGGCTTCTACTGCTC-3′ and 5′-GGGCCCCAGAACACAGTG-3′ for angiotensinogen; 5′-CACATCCACTCACTGTCCTTGTAC-3′ and 5′-GAGGGCAGGATGGTAATGCAGTC-3′ for renin, a 200-bp ApaI/PstI fragment that corresponds to a 5′-untranslated region of the angiotensinogen gene, and a 431-bp RsaI/EcoRI fragment within the renin gene coding sequence as cDNA probes, respectively.

Mice were raised under standard laboratory conditions at 24 ± 2°C and 50–60% humidity and allowed free access to tap water and commercial standard rodent chow (CE-2) containing 1.20% calcium, 1.08% phosphate, and 240 IU/100 g vitamin D3 (Clea Japan). Enarapril, losartan, and propranolol were dissolved in distilled water and administered to mice in drinking water at the concentrations of 5 mg/1.5 dl, 17 mg/dl, and 50 mg/dl for 4 wk. Blood pressure was measured by noninvasive tail-cuff method as described previously,math image using Model BP-98A (Softron, Tokyo, Japan). Urine was collected during the final 24 h, and blood samples were centrifuged to obtain the plasma and serum.

All experiments were performed in accordance with NCGG's ethical guidelines for animal care, and the experimental protocols were approved by the animal care committee of NCGG.

Blood and urine biochemistry

Serum and urinary calcium, phosphate, and creatinine concentrations were determined by an autoanalyzer (Hitachi 7170; Hitachi, Tokyo, Japan). Urinary deoxypyridinoline (DPD) was measured with a PYRILINKS-D assay kit (Metra Biosystems) and was corrected for creatinine. Plasma AngII and serum osteocalcin (OC) and intact PTH concentrations were measured using an RIA kit (Mitsubishi Chemical Medience, Tokyo, Japan), a mouse osteocalcin IRMA kit (Immutopics, San Clemente, CA, USA), and a mouse intact PTH ELISA kit (Immutopics), respectively.

Bone and histological analyses

μCT scanning was performed on proximal tibias using μCT-40 (SCANCO Medical) with a resolution of 12 μm, and microstructure parameters were calculated three dimensionally as described previously.math image Tibia were fixed in 4% paraformaldehyde for bone histomorphometry. Each sample was sectioned and stained for TRACP. Bone histomorphometry was performed on undecalcified sections, with calcein and tetracycline double labeling (administered subcutaneously at a 2-day interval), and histomorphometric parameters were measured at the Ito Bone Science Institute (Niigata, Japan).

Cell culture and ex vivo osteoclastogenesis assay

Bone marrow cells were isolated from the tibias and femurs of 8-wk-old male THM and nontransgenic control mice and cultured in αMEM supplemented with 10% FBS, 1% antibiotics (streptomycin and penicillin), and 10% CMG14–12 culture supernatant for 3 days, and adherent bone marrow macrophages (BMMs) were used as osteoclast precursors, also as previously described.math image BMMs were treated with M-CSF (50 ng/ml) and various concentrations of RANKL for 3 days, fixed in 4% paraformaldehyde, and stained for TRACP. The number of multinucleate (at least three nuclei), TRACP+ cells was counted as osteoclasts.

Osteoblasts were isolated from newborn mouse calvaria as described previously,math image and co-cultures with bone marrow cells were performed in the presence of 10−8 M 1α,25(OH)2D3, according to the established technique.math image The number of TRACP+ cells with more than three nuclei was counted under light microscopy.

RNA interference using a retrovirus vector

The expression of AT1 and AT2 receptors in primary osteoblastic cells was silenced by using specific hairpin siRNAs and the pSilencer 5.1 Retro System (Ambion, Austin, TX, USA). Short hairpin RNA sequences targeting the coding region of AT1a and AT2 were designed using the Target Finder and Design Tool (Ambion). Selected sequences did not show near-exact matches to any other known sequence on a BLAST search, confirming their sequence specificity. Synthetic duplexed-deprotected siRNAs were purchased from Sigma and cloned into a pSilencer 5.1-U6 vector. The 21-bp target sequences used for AT1a and AT2 were AATTCAAGATGACTGCCCCAG and AATGAGTCCGCCTTTAATTGC, respectively. The pSilencer 5.1-U6 Retro Scrambled (Ambion) was used as the control.

Retroviral vectors were transfected into GP2-293 packaging cells with pVSV-G (Clonthech Laboratories). Recombinant retrovirus was infected into primary osteoblasts isolated from newborn mouse calvaria for 24 h, and after 3 days of selection with puromycin (1.6 μg/ml), the cells were used for osteoclastogenesis assays in co-cultures with BMMs and also for RNA extraction.

RNA extraction and RT-PCR

Total RNA was isolated from various cells and bone with TRIzol Reagent (Invitrogen, San Diego, CA, USA), and gene expression was assessed by RT-PCR at 94°C, 30 s; 55°C for 1 min; and 72°C for 1 min with the following primer sets; 5′-GCATCATCTTTGTGGTGGG-3′ and 5′-GAAGAAAAGCACAATCGCC-3′ for AT1 (35 cycles); 5′-AGTGCAAACTGGCATGGG-3′ and 5′-AAAACGCCTGGAATCTGA-3′ for AT2 (35 cycles); 5′-TGAAGACACACTACCTGACT-3′ and 5′-AAGATAGTCTGTAGGTACGCTT-3′ for RANKL (27 cycles); 5′-GACTTCATGCCAGATTGCC-3′ and 5′-GGTGGCTTTAGGGTACAGG-3′ for M-CSF (22 cycles); 5′-CCACTCTTATACGGACAGCT-3′ and 5′- TCTCGGCATTCACTTTGGTC-3′ for OPG (28 cycles); 5′-TCGGTGTCCTCTTGCTGTCC-3′ and 5′-TGGCGGAGTGTCTTTATGCTG-3′ for SDF-1α (27 cycles); 5′-CCTCACCATCATCCTCACTG-3′ and 5′-CCACTTCTTCTCTGGGTTGG-3′ for CCL5 (27 cycles); 5′-AGGACGCTAGCCTTCACTCCAA-3′ and 5′-GTGTGAAGGTTCAAGGCTGCAGA-3′ for CCL8 (27 cycles); 5′-GGGATCCACCATGAACTTTCTGCTCTCT-3′ and 5′-TTGCGGCCGCTCACCGCCTTGGCTTGTCACA-3′ for VEGF (28 cycles); 5′-CCGATGAGTACTTGGACACCT-3′ and 5′-TTTCCAAGGAGGGTGCAGTT-3′ for RANK; 5′-ACTTTGTCAAGCTCATTTCC-3′ and 5′-TGCAGCGAACTTTATTGATG-3′ for GAPDH (22 cycles); 5′-CATCGTGGGCCGCTCTAGGCACCA-3′ and 5′-CGGTTGGCCTTAGGGTTCAGGGGG-3′ for β-actin (26 cycles).

For quantitative RT-PCR, total RNA was reverse transcribed using Superscript III (Invitrogen), and samples were analyzed using PowerSYBR Green PCR master mix and an ABI7300 real-time PCR system (Applied Biosystems). The sequences of the primers used for the real-time PCR were as follows: RANKL, 5′-AGGATGAAACAAGCCTTTCAG-3′ and 5′-ACCATGAGCCTTCCATCATAG-3′; GAPDH, 5′-ATTGTCAGCAATGCATCCTG-3′ and 5′-ATGGACTGTGGTCATGAGCC-3′. The amount of target mRNA was corrected by that of GAPDH mRNA.

Statistical analysis

Data are expressed as the mean ± SD. Statistical analysis was performed using unpaired Student's t-test or ANOVA followed by Dunnett's test or Student-Newman-Keuls test. Values were considered statistically significant at p < 0.05.

RESULTS

Activation of RAS induces osteopenia

THM mice were generated by mating doubly transgenic mice expressing the human angiotensinogen gene (ANG/ANG) and those expressing the human renin gene (RN/RN). THM (ANG/RN) mice, which produce human angiotensinogen and human renin in the same individual, exhibit elevated serum AngII concentrations and hypertension.math image To examine how activation of RAS affects bone metabolism in vivo, trabecular bone structure of THM mice was analyzed by μCT scanning of tibial metaphysis, using sex- and age-matched C57BL/6J wildtype mice as controls. Representative μCT images of the 6-mo-old male THM mouse shown in Fig. 1A revealed marked osteopenia with a substantial reduction in the 3D bone volume fraction (BV/TV), compared with an age- and sex-matched wildtype mouse. The decrease in bone volume in THM mice was more marked in males than in females (Fig. 1B).

Figure Figure 1.

Osteoporosis in THM mice expressing human renin and angiotensinogen genes. (A) Representative 3D images by μCT of trabecular bone at the proximal tibias of 6-mo-old wildtype (WT) and THM male mice. BV/TV, 3D bone volume fraction per tissue volume in percent. (B) Comparison of 3D bone volume fraction (BV/TV) between 6-mo-old WT and THM male and female mice. *p < 0.05, **p < 0.01 vs. WT (n = 8 each group). (C) Blood pressure (BP), plasma angiotensin II (AngII) concentrations, and 3D bone volume fraction (BV/TV) in four genotypes, nontransgenic control mice (C), ANG/+ (single transgenic mice expressing human angiotensinogen gene), RN/+ (single transgenic mice expressing human renin gene), and doubly transgenic THM male mice (3 mo old), which were generated by mating female ANG/+ and male RN/+. **p < 0.01 vs. control (n = 8 each group). (D) Microstructure analysis by μCT of trabecular bone at the proximal tibias of 3-mo-old nontransgenic control (C) and THM male mice. BV/TV, 3D bone volume fraction per tissue volume; Tb.N, trabecular number; Tb.Th, trabecular thickness; Conn-Dens, connectivity density; SMI, structure model index. *p < 0.05, **p < 0.01 (n = 6 each group).

To further confirm the low bone mass phenotype of THM mice, four different genotypes were generated by mating renin and angiotensinogen single-transgenic mice. As shown in Fig. 1C, THM mice exhibited markedly elevated plasma AngII concentrations and hypertension at the age of 3 mo, and the bone volume fraction at the proximal tibia was significantly reduced compared with nontransgenic littermates, whereas single transgenic mice expressing human angiotensinogen gene only (ANG/+) exhibited normal bone mass.

Interestingly and importantly, single transgenic mice that produce only human renin (RN/+) remained normotensive and yet exhibited significantly reduced bone mass, with marginally elevated AngII levels (Fig. 1C), suggesting that the presence of hypertension is not a prerequisite for the development of osteoporosis and that the activation of RAS induces low bone mass phenotype independently of hypertension.

Detailed microstructural analysis of the tibial metaphysis of THM mice showed that trabecular thickness decreased significantly, whereas the structure model index (SMI) increased (Fig. 1D), suggesting that the trabeculae of THM mice had become thinner and converted from a plate-like structure to a more fragile rod-like structure.

Osteopenia in THM mice is caused by high bone turnover

The cause(s) of osteopenia in THM mice was further explored at the tissue and cell levels by histological and biochemical analyses. TRACP staining of bone sections showed an increased number of TRACP+ osteoclasts (Fig. 2A), suggesting elevated bone resorption in THM. Detailed histomorphometric analysis at the proximal tibia showed that histological indices of bone resorption, the number of osteoclasts (N.Oc/BS), bone surface area covered by osteoclasts (Oc.S/BS), and eroded surface (ES/BS), were all significantly elevated in THM compared with nontransgenic control mice (Fig. 2B).

Figure Figure 2.

High bone turnover in THM mice. (A) Bone sections of THM mice exhibit more TRACP+ osteoclasts than nontransgenic control mice. (B) Results of histomorphometry at the tibial metaphysis. N.Oc, number of osteoclasts; Oc.S, osteoclast surface; ES, eroded surface; Ob.S, osteoblast surface; BFR, bone formation rate; MAR, mineral apposition rate. Data are normalized for the bone surface (BS). *p < 0.05, **p < 0.01 (n = 5 each group). (C) Urinary DPD excretion, corrected for creatinine (Cr), serum OC, and serum PTH concentrations. *p < 0.05, **p < 0.01 (n = 5 each group).

Bone formation rate (BFR) was also significantly increased in THM mice (Fig. 2B), which together with the results of accelerated bone resorption suggests that bone turnover is accelerated in THM mice. Whereas osteoblast surface (Ob.S/BS) remained unchanged, the mineral apposition rate (MAR) was significantly increased in THM mice (Fig. 2B), suggesting that the mineralizing function of mature osteoblasts was increased in THM mice, whereas the recruitment of new osteoblasts was not affected.

Biochemical analysis of urine and serum samples of THM mice indicated that both urinary excretion of DPD, a marker of bone resorption, and the serum osteocalcin (OC) concentration, a product of osteoblasts, were significantly higher in THM mice than in nontransgenic littermates (Fig. 2C), which is consistent with a high bone turnover state. Serum calcium and PTH levels did not differ between the THM and nontransgenic control mice (Fig. 2C and data not shown), suggesting that the activation of the RAS in THM mice affects bone remodeling locally but not as a secondary consequence of systemic alterations in calcium metabolism.

Osteoblasts as a target of AngII action in bone

As the first step to study the mechanism by which the activated RAS leads to a high bone turnover state with elevated osteoclastic and osteoblastic activities, the expression of AngII receptors, AT1 and AT2, was studied in osteoclast and osteoblast lineage cells. As shown in Fig. 3A, both AT1 and AT2 receptors were expressed in primary osteoblasts. The expression of AT1 mRNA seemed constitutive, whereas that of AT2 increased along with the stage of osteoblast differentiation. In contrast, osteoclast lineage cells, specifically BMMs and pre-osteoclasts (pOCs), only weakly expressed the AT1 receptor, whereas mRNA for AT2 receptor was not detected (Fig. 3A).

Figure Figure 3.

Angiotensin II acts on osteoblasts that express both AT1 and AT2 receptors. (A) Expression of AngII receptors, AT1 and AT2, was examined by RT-PCR using specific primer sets. β-actin was used as the loading control. RNA was extracted from primary osteoblasts (OB) from newborn mouse calvaria, BMMs, and pre-osteoclasts (pOC) and mature osteoclasts (mOC) generated from BMMs after treatment with M-CSF and RANKL for 2 and 4 days, respectively. RNA from brain and liver was used as positive controls of AT2 and AT1 mRNA, respectively. (B) BMMs derived from THM mice generated the same number of TRACP+ osteoclasts as from the bone marrow of nontransgenic control mice in response to increasing doses of RANKL. Ex vivo culture was performed in the presence of M-CSF (50 ng/ml) and the indicated concentrations of RANKL, and the number of TRACP+ cells with more than three nuclei was counted. (C) Ex vivo culture was performed in the presence of M-CSF (50 ng/ml), RANKL (25 ng/ml), and the indicated concentrations of AngII, and the number of TRACP+ cells with more than three nuclei was counted. Note that AngII itself (at 10−6 M) had no capacity to induce osteoclast differentiation and that AngII (at 10−10–10−6 M) did not potentiate osteoclast formation triggered by RANKL. (D) Co-cultures of mouse calvaria-derived osteoblasts and BMMs were performed in the presence of 10−8 M 1α,25(OH)2D3 and the indicated doses of AngII, and TRACP+ cells with more than three nuclei were quantified. *p < 0.05, **p < 0.01 (n = 5 each group).

We studied whether hematopoietic precursor cells in the bone marrow of THM and nontransgenic control mice differed in their potential to differentiate into osteoclasts. To this end, BMMs were isolated as osteoclast precursor cells from THM and nontransgenic littermates, and their differentiation potential in response to RANKL and M-CSF was assessed in ex vivo cultures. As shown in Fig. 3B, BMMs derived from THM and nontransgenic control mice exhibited the same dose-response curve in terms of the number of TRACP+ multinucleated cells generated in response to increasing doses of RANKL (Fig. 3B) or M-CSF (data not shown), suggesting that there was no functional difference in the hematopoietic “seed cells” for osteoclasts between control and THM.

We also examined the direct response of BMMs to exogenous AngII. As shown in Fig. 3C, AngII itself, between 10−10 and 10−6 M, had no activity of inducing osteoclast differentiation or exerted any stimulatory effect on osteoclastogenesis triggered by a lower (permissive) concentration of RANKL. In contrast, AngII stimulated the formation of osteoclasts in the co-culture of calvaria-derived primary osteoblasts and BMMs in a dose-dependent manner between 10−8 and 10−6 M (Fig. 3D). Taken together, these results suggest that AngII stimulates osteoclastogenesis by acting on osteoblastic cells (i.e., “the soil cells”) and not through a direct action on hematopoietic “seed cells.”

AngII increases RANKL and vascular endothelial growth factor in osteoblasts

Osteoblasts modulate osteoclast differentiation by producing both positive and negative regulators, most notably RANKL and osteoprotegerin (OPG), respectively.math image To gain further insight into the mechanism by which AngII, acting mainly on osteoblasts, stimulates osteoclast differentiation, the expression of osteoblast-derived regulators of osteoclastogenesis was investigated in primary osteoblasts. As shown in Fig. 4A, treatment with AngII, alone or in combination with 1α,25(OH)2D3, increased the expression of RANKL and vascular endothelial growth factor (VEGF) mRNA levels in osteoblasts, whereas the M-CSF, OPG, SDF-1, and CCL5 mRNA levels remained unaltered. The increase in RANKL mRNA by AngII was confirmed by quantitative RT-PCR (Fig. 4B). Thus, it is suggested that RANKL, and perhaps also VEGF, mediates the stimulation of osteoclastogenesis-supporting potential of osteoblastic cells by AngII.

Figure Figure 4.

Functional interaction between AT1 and AT2 receptors in osteoblasts. (A and B) Expression of molecules involved in the regulation of osteoclastogenesis by RT-PCR (A) and quantitative RT-PCR (B). RNA was extracted from calvaria-derived primary osteoblasts cultured in the presence or absence of AngII at 10−6 M and 1α,25(OH)2D3 at 10−8 M, and mRNA levels were analyzed by using specific primer sets. *p < 0.01, **p < 0.0001 (n = 3 each group). (C) Expression of the indicated regulators of osteoclast differentiation was examined by RT-PCR in the bone of nontransgenic control and THM mice (from three mice each). GAPDH was used as a positive control. (D) Knockdown of AT1 and AT2 mRNA by siRNA in primary osteoblasts derived from newborn mouse calvaria. (E) AT1- and AT2-knockdown osteoblasts were co-cultured with BMMs in the presence of 10−8 M 1α,25(OH)2D3 and 10−6 M AngII for 7 days, and TRACP staining was performed. Representative dishes are shown. (F) AT1- and AT2-knockdown osteoblasts were co-cultured with bone marrow cells in the presence of 10−8 M 1α,25(OH)2D3, with (closed bars) or without (open bars) 10−6 M AngII for 7 days, and the number of TRACP+ cells with more than three nuclei was counted. **p < 0.01 (n = 5 each group).

To further substantiate this concept, RNA was extracted from the bone of THM and nontransgenic control mice, and gene expression was examined by RT-PCR. The results indicate that RANKL expression in bone was substantially increased in THM mice compared with control mice, and VEGF expression also was increased modestly (Fig. 4C). It was evident that ACE mRNA was expressed in bone and was decreased in THM mice (Fig. 4C).

Functional interaction between AT1 and AT2 in osteoblasts

To examine whether functional interaction exists between AT1 and AT2 receptors and to determine the relative contribution of the two receptors for transducing the osteoclastogenesis-supporting function of AngII in osteoblasts, the expression of each of the receptors was knocked down with siRNA in primary osteoblasts in culture. As shown in Fig. 4D, the expression level of AT1 and AT2 receptor was reduced by 90% and 98%, respectively, by specific siRNA. In AT1-knockdown osteoblasts, the stimulatory effect of AngII on osteoclast formation was somewhat enhanced (Figs. 4E and 4F). In AT2-knockdown osteoblasts, in contrast, the osteoclastogenic potential was markedly attenuated (Figs. 4E and 4F).

Taken together, it is suggested that AT2 is the major transducing receptor for AngII in osteoblasts. In view of the findings that the inhibition of AT1 alone resulted in stimulation of osteoclastogenesis, it is conceivable that, under functional knockdown of the AT1 receptor, signaling through AT2 may be facilitated.

ACE inhibition improves but ARB exacerbates osteoporosis of THM mice

Because the AngII produced through activation of the RAS stimulates the expression of osteoclastogenic cytokines in osteoblasts, thereby leading to a high turnover osteoporosis, it is reasonable to hypothesize that blockade of the RAS may ameliorate osteoporosis and hypertension. To test this hypothesis, THM mice were treated orally for 4 wk with losartan, an ARB specific to AT1, and the effects on the low bone mass were determined by μCT scanning of proximal tibia. As expected, losartan was effective in treating hypertension. However, contrary to our expectations, the administration of losartan resulted in a further decrease in bone mass (Fig. 5A). Because osteoblasts express both AT1 and AT2 receptors (Fig. 3A), we considered the possibility that blockade of AT1 alone somehow activated signaling through AT2 receptor by the still high levels of circulating AngII.

Figure Figure 5.

Angiotensin receptor blockade exacerbates and ACE inhibition ameliorates osteoporosis in THM mice. Two-month-old male THM mice were treated orally with losartan (A), an angiotensin II receptor blocker specific for AT1, or enalapril (B), an angiotensin-converting enzyme blocker, for 4 wk, and arterial blood pressure and 3D bone volume fraction (BV/TV) at the proximal tibia were determined by the noninvasive tail-cuff method and μCT, respectively. Nontransgenic littermates served as control (C). *p < 0.05, **p < 0.01 (n = 5 each group). (C) The effects of propranolol, a β-blocker, were examined in 5-mo-old male THM and age- and sex-matched wildtype (WT) mice. *p < 0.05, **p < 0.01 (n = 3–5 each group).

To investigate this concept, we next treated THM mice with enalapril, an ACE inhibitor, which inhibits the conversion of AngI to the active hormone AngII, thereby inhibiting signaling through both AT1 and AT2. As shown in Fig. 5B, enalapril corrected the low bone mass phenotype and hypertension of THM mice. These results suggest that, to combat the deleterious effects of RAS in bone tissue, treatments that inhibit the synthesis of AngII are needed, because there is functional cross-talk between AT1 and AT2 receptors on the osteoblastic cell surface. Furthermore, the findings that the two antihypertensive agents, losartan and enalapril, had opposite effects on bone mass are consistent with our contention that the RAS is involved in the regulation of bone metabolism independently of its effect on blood pressure.

Finally, to address the involvement of the sympathetic nervous system in the low bone mass phenotype of THM, the effects of a β-adrenergic antagonist, propranolol, were examined. As shown in Fig. 5C, treatment with propranolol caused a marked elevation of blood pressure in THM but not in wildtype mice, and the bone volume tended to further decrease in THM, although not to the level of statistical significance.

DISCUSSION

We showed in this study that activation of RAS induces not only hypertension but also osteopenia with microstructural deterioration, reminiscent of osteoporosis, suggesting that aberrant activation of RAS may contribute to the co-occurrence of the hypertensive disorders and osteoporosis, which is often seen with advancing age.

Two lines of evidence, however, suggest that the presence of hypertension per se is not the determinant of the low bone mass phenotype. First, renin/+ single transgenic mice were normotensive and yet showed a significant reduction in bone volume compared with nontransgenic control mice. Although there is species specificity for the reaction between renin and angiotensinogen, human renin overproduced in renin/+ transgenic mice is thought to possess a residual capacity to cleave the endogenous, mouse angiotensinogen, which is evidenced by a modest but significant increase in circulating AngII concentrations in renin/+ transgenic mice (Fig. 1C). It may follow that the sensitivity of bone tissue to this marginally elevated AngII is higher than that of the pressor response. Alternatively, in light of the current understanding that, in addition to the classic, endocrine RAS, many tissues possess a local RAS that serves important physiological functionsmath image,math image and the findings that ACE is in fact expressed in bone, as shown in this study (Fig. 4C) and reported by others,math image,math image locally produced AngII may be sufficient to cause osteopenia. Second, treatment of THM with an ARB, losartan, improved hypertension and yet exacerbated the osteopenic phenotype. Thus, it is plausible that local RAS contributes to the development of osteoporosis, independently of its systemic effect on blood pressure.

Histomorphometric and biochemical analyses showed THM to be in a state of high bone turnover, which is likely to be responsible for the development of osteoporosis. Both the AT1 and AT2 receptors were expressed in osteoblasts, whereas BMMs and pre-osteoclasts showed only a weak expression of AT1, but not AT2, on RT-PCR analysis. There have been several reports on the effects of AngII on bone cell function in vitro, including inhibition of osteoblastic differentiation and mineralization,math image stimulation of proliferation and collagen synthesis in osteoblasts,math image and stimulation of osteoclastic bone resorption.math image Hatton et al.math image showed that, although AngII had no effect on osteoclast formation or bone resorption by isolated osteoclasts, it stimulated bone resorption in co-cultures with bone cells. In agreement with this study, we did not observe any effect of AngII on osteoclast precursor cells or mature osteoclasts. In fact, our results suggest that AngII acts on osteoblasts to increase the expression of RANKL and, by providing the pro-osteoclastogenic cytokine locally, stimulates the formation of osteoclasts indirectly. AngII also increased the expression of VEGF, which we have recently shown to stimulate osteoclastogenesis at least in part through the VEGF receptor 1 (Flt-1) expressed on hematopoietic cells.math image Chemokines produced by osteoblasts, such as SDF-1 and CCL5, have been known to regulate osteoclastogenesismath image,math image; however, we did not find any alteration in the expression of these chemokines by AngII. Further studies are needed to examine the involvement of vascular endothelial cells in bone, in relation to VEGF and RAS, in the osteoporotic phenotype of THM.

Because AngII is known to stimulate the release of norepinephrine from sympathetic nerve endings,math image and because sympathetic tone has been shown to be an important regulator of bone metabolism,math image we attempted to address the role of the sympathetic tone in the low bone mass phenotype of THM. Contrary to our expectations, treatment of THM with a β-adrenergic blocker, propranolol, resulted in a further elevation of blood pressure but not in wildtype mice. Although the reason is not clear, we suspect that the blockade of β1 and β2 adrenergic receptors by propranolol caused relative stimulation of the α1 receptor in the blood vessels, leading to increased vascular resistance and further elevation of blood pressure, specifically in the setting of the elevated AngII of THM. Under these circumstances, the osteopenia of THM did not improve, but rather, tended to worsen after treatment with propranolol. Further studies are needed to clarify the functional interaction between the RAS and sympathetic nervous system in the regulation of bone remodeling.

AngII binds to two G protein-coupled receptors: AT1 and AT2. Although the vasopressive and aldosterone-secreting actions of AngII are mainly mediated through AT1, AT2 serves important physiological roles, and functional interactions exist between the two receptors.math image,math image Knockdown experiments with siRNA are consistent with the notion that the AngII action on osteoblasts in terms of stimulating osteoclastogenesis is mainly mediated through the AT2 receptor, because suppression of AT2 expression markedly inhibited osteoclast formation by AngII. On the other hand, knockdown of AT1 resulted in a further increase in osteoclast formation by AngII, suggesting that AT1 may exert an inhibitory effect on AT2. The functions of AT1 and AT2 are in many cases counter-regulatory to each other, and these findings in osteoblasts are consistent with this notion. Further studies are needed to dissect the signaling pathways downstream of each receptor in osteoblasts and their interaction with sex steroids, in view of the substantial difference in the bone phenotype between male and female THM in this study (Fig. 1B) and of the known sex difference in AT2 expression.math image

The cross-talk between AT1 and AT2 receptors was also observed in pharmacological experiments in vivo. It is intriguing that treatment with losartan exacerbated osteoporosis despite the amelioration of hypertension and that inhibition of AngII synthesis with an ACE inhibitor was needed to correct the osteoporotic phenotype. It has recently been shown in myopathy model mice that losartan restores muscle regeneration by blocking TGF-β signaling in skeletal muscle,math image and the action of losartan of reducing bone volume may be related to the inhibition of TGF-β signaling in bone.

It has been proposed that inhibition of RAS with ACE inhibitors or ARBs has beneficial effects beyond those resulting from lowering blood pressure alone, such as renoprotective effects and cardiovascular outcomes.math image Epidemiological studies indicate that patients who have undergone stroke have an increased risk of hip fracture.math image,math image,math image Our results hint on the utility of RAS-based medicine in the management of elderly people in whom hypertension/cardiovascular events and osteoporosis/fragility fracture are the two most important comorbidities. It is to be noted that a cross-sectional study of Chinese population showed an association of ACE inhibitor use with higher BMD.math image

In conclusion, this study showed a common causal mechanism in the pathogenesis of hypertension and osteoporosis. Given the high prevalence of the two disorders in the aging population, RAS may provide a crucial target for therapeutic intervention.

During the course of preparing this manuscript, we noticed an online publication reporting that AngII stimulated RANKL expression in osteoblasts and thereby osteoclastogenesis and that infusion of AngII in ovariectomized rats increased bone resorption and decreased BMD,math image which supports our contention that AngII stimulates osteoclastogenesis through RANKL. In this study, the effects of AngII infusion to increase bone resorption and decrease BMD were shown only in the setting of ovariectomy in rats. In apparent contrast to our findings that losartan caused an exacerbation of the low bone mass phenotype of THM, they showed that treatment of ovariectomized spontaneously hypertensive rat (SHR) with olmesartan, another ARB, ameliorated the elevated bone resorption and reduced BMD.math image Further studies are thus needed to clarify the pathophysiological roles of the AT1 receptor in bone metabolism.

Acknowledgements

The authors thank Kumi Tsutsumi and Mie Suzuki for technical assistance, members of our Department (NCGG) for stimulating discussion, and Dr Shinji Fukada (National Hospital for Geriatric Medicine, NCGG) and Dr Toshiyuki Arai (Department of Surgery, Nagoya University School of Medicine) for encouragement and support throughout the study. This study was supported in part by a grant-in-aid for Longevity Science from the Ministry of Health, Labor and Welfare of Japan (to KI) and by a grant for the Promotion of Fundamental Studies in Health Sciences of the National Institute of Biomedical Innovation (NIBIO) of Japan (MF-14 and 06-31 to KI). Pacific Edit reviewed the manuscript before submission.

Ancillary