SEARCH

SEARCH BY CITATION

Keywords:

  • microRNA;
  • human adipose tissue-derived mesenchymal stem cells;
  • osteogenic differentiation;
  • proliferation;
  • microRNA-196a

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The elucidation of the molecular mechanisms that govern the differentiation and proliferation of human adipose tissue-derived mesenchymal stem cells (hASCs) could improve hASC-based cell therapy. In this study, we examined the roles of microRNA (miRNA)-196a on hASC proliferation and osteogenic differentiation. Lentiviral overexpression of miR-196a decreased hASC proliferation and enhanced osteogenic differentiation, without affecting adipogenic differentiation. Overexpression of miR-196a decreased the protein and mRNA levels of HOXC8, a predicted target of miR-196a. HOXC8 expression was decreased during osteogenic differentiation of hASCs, and this decrease in HOXC8 expression was concomitant with an increase in the level of miR-196a. In contrast, inhibition of miR-196a with 2′-O-methyl-antisense RNA increased the protein levels of HOXC8 in treated hASCs and was accompanied by increased proliferation and decreased osteogenic differentiation. The activity of a luciferase construct containing the miR-196a target site from the HOXC8 3′UTR was lower in LV-miR196a-infected hASCs than in LV-miLacZ-infected cells. RNA interference-mediated downregulation of HOXC8 in hASCs increased their proliferation and decreased their differentiation into osteogenic cells, without affecting their adipogenic differentiation. Our data indicate that miR-196a plays a role in hASC osteogenic differentiation and proliferation, which may be mediated through its predicted target, HOXC8. This study provides us with a better knowledge of the molecular mechanisms that govern hASC differentiation and proliferation.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Micrornas (miRNAs) are endogenous 22-nucleotide RNAs, some of which play important regulatory roles in animals by regulating gene expression posttranscriptionally. Since the first miRNA was identified as a gene important for timing larval development in Caenorhabditis elegans,(1,2) nearly 1% of all predicted mammalian genes have been found to encode miRNAs.(1–3) They are first transcribed as primary miRNAs by RNA polymerase II, and then they are cut by an RNase III enzyme (Drosha) into ∼70-nucleotide precursors (premiRNAs) that are transported to the cytoplasm. Another enzyme, Dicer, converts premiRNAs to mature miRNAs, which are recruited into the RNA-induced silencing complex (RISC). Finally, these RISCs interfere with the translation and stability of the target mRNAs by either binding mRNA with exact complementarity, leading to RISC-mediated cleavage of the mRNA, or binding with partial complementarity, leading to translational repression. miRNAs have been implicated in many processes in invertebrates, including cell proliferation and apoptosis,(4,5) fat metabolism,(4) neuronal patterning,(6) and tumorigenesis.(7)

Like bone marrow, adipose tissue is a mesodermally derived organ with a stromal cell population that encompasses microvascular endothelial, smooth muscle, and stem cells.(8) These cells can be enzymatically digested out of adipose tissue and separated from buoyant adipocytes by centrifugation. This population, termed adipose tissue-derived mesenchymal stem cells (ASCs), shares many of the characteristics of its counterparts in bone marrow, including extensive proliferative potential and the ability to differentiate toward adipogenic, osteogenic, chondrogenic, and myogenic lineages.(9–11) Previous studies have shown the osteogenic potential of human ASCs (hASCs)(8–12) by showing that they possess an in vivo bone-forming capacity, but the molecular mechanisms that underlie hASC differentiation toward the osteoblastic phenotype remain elusive. Cell differentiation involves complex pathways that are regulated at both the transcriptional and post-transcriptional levels. Recent evidence has shown that small, noncoding miRNAs influence the complexity of the “stemness” of the cell by negatively regulating gene expression at the post-transcriptional level.(13) Only a few mammalian miRNAs have been assigned a functional role in developmental processes: miR-181 promotes B-cell development in mice,(14) and it targets the homeobox protein Hox-A11 during mammalian myoblast differentiation.(15) miR-196a regulates several Hox genes that encode a family of developmentally relevant transcription factors in animals.(16) The brain-specific miR-134 regulates dendritic spine development.(17) miR-1, miR-133, and miR-206 are specifically induced during myogenesis.(18,19) miR-143 increases adipocytic differentiation in preadipocytes,(20) and Luzi et al.(21) reported that miR-26a inhibited osteogenic differentiation in human adipose tissue stromal cells by targeting SMAD1.

In this study, we examined the role of miR-196a in the proliferation and osteogenic differentiation of mesenchymal stem cells (MSCs) derived from human adipose tissues (hASCs) and identified the molecular targets of miR-196a. Our data indicated that miR-196a, which is upregulated during osteogenic hASC differentiation, inhibits proliferation and enhances the differentiation process by binding to specific target sequences harbored in the 3′-untranslated region (UTR) of HOXC8 mRNA.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Cell culture

All protocols involving human subjects were approved by the Institutional Review Board of the Pusan National University. Leftover materials were obtained from individuals undergoing elective abdominoplasty after obtaining informed consent from each individual. The hASCs were isolated according to the methods described in the previous studies.(22)

Viral vector construction and transduction

The engineered premiRNA sequence is cloned into the cloning site of BLOCK-iT Pol II miR RNAi Expression vectors (Invitrogen) that is flanked on either side with sequences from hsa-miR-196a (hsa-miR-196a mature sequence: 5′-uagguaguuucauguuguuggg) to allow proper processing of the engineered premiRNA sequence. The construct pcDNATM6.2-GW/EmGFP-miLacZ (targeting β-galactosidase) was used as a control for the effects of any nonspecific RNAi. The pcDNATM6.2-GW/EmGFP-miR vector was recombined into pLenti6/V5 using LR clonase (Invitrogen), resulting in the generation of a pLenti6/V5-miR-196a plasmid. Replication-defective lentiviruses were produced through the transient transfection of 293FT cells using Lipofectamine Plus, lentivirus vectors, and a packaging mix (Invitrogen). Two samples of viruses were harvested at 48 and 72 h after transfection. The transduction of the hASCs was performed by exposing them to dilutions of the viral supernatant in the presence of polybrene (5 μg/ml) for 6 h.

Induction of differentiation

Adipogenic differentiation was induced by culturing MSCs for 7days in an adipogenic medium (10% FBS, 1 μM dexamethasone, 0.5 mM/ml 3-isobutyl-1-methylxanthine, and 200 μM indomethacin in αMEM) and assessed by the use of an Oil red O stain as an indicator of intracellular lipid accumulation. To obtain quantitative data, 1 ml isopropyl alcohol was added to the stained culture dish. Osteogenic differentiation was induced through the culturing of the cells for 10 days in osteogenic medium (OM; 10% FBS, 0.1 μM dexamethasone, 10 mM β-glycerophosphate, and 50 μM ascorbic acid in αMEM), and extracellular matrix calcification was estimated using Alizarin red S stain. Osteogenic differentiation was quantified through the measurement of the Alizarin red-stained area and density in 12-well dishes, using an image analysis program (Image Gauge ver 3.1; Fuji).

Evaluation of cell proliferation and cell viability

The cells were detached using Hank's balanced salt solution containing 0.05% trypsin and 0.02% EDTA to determine the rate of proliferation. The cells were plated in a 6-well plate at a density of 1 × 104 cells/well. After 3 days, the cells were trypsinized and stained with 0.4% trypan blue (Sigma, St. Louis, MO, USA). The total cell number and the proportion of dead cells were measured with a hemocytometer. Cell death was determined by the presence of cytoplasmic trypan blue. Sixty cells were transferred to a 100-mm plate to perform the colony-forming unit (CFU) assay. The cell numbers in each colony were counted.

RT-PCR analysis

The total cellular RNA was isolated from the hASCs and reverse transcribed using the conventional protocols. Primer sequences used in the experiment were as follows: GAPDH, 5′-TCCATGACAACTTTGGTATCG-3′ and 5′-TGTAGCCAAATTCGTTGTCA-3′; Runx2, 5′-CTCACTACCACACCTACCTG-3′ and 5′-TCAATATGGTCGCCAAACAGATTC-3′; osteopontin (OPN), 5′-TTGCAGTGATTTGCTTTTGC-3′ and 5′-ACACTATCACCTCGGCCATC-3′; BMP2, 5′-CCACCATGAAGAATCTTTGG-3′ and 5′-CCACGTACAAAGGGTGTCTC-3′; HOXC8, 5′-GAGCCTGCAGTCGCCTCTAA-3′ and 5′-CGGGCCCAACAGAATAGAAATC -3′; alkaline phosphatase (ALP), 5′-CCACGTCTTCACATTTGGTG-3′ and 5′-AGACTGCGCCTGGTAGTTGT-3′; osteocalcin, 5′-GTGCAGAGTCCAGCAAAGGT-3′ and 5′-TCAGCCAACTCGTCACAGTC-3′. All of the primer sequences were determined using established GenBank sequences.

Real-time PCR

Small RNA species-enriched RNA isolation was performed as per the manufacturer's instructions (mirVana miRNA isolation kit; Ambion). miRNA was reverse-transcribed using the Ncode miRNA first-strand cDNA synthesis kits (Invitrogen), according to the manufacturer's specified guidelines, and the forward primer sequences were designed as the corresponding mature miRNA sequences and used 5S rRNA as normalizing control. Real-time quantitation was predicated on the LightCycler assay, using a fluorogenic SYBR Green I reaction mixture for PCR with the LightCycler Instrument (Roche). Data analyses were according to the methods described in previous studies.(22)

Northern blot

Oligonucleotides complementary to mature miRNAs were end-labeled with T7 promoter (miR Vana miRNA probe construction kit; Ambion) and were used as probes. Probe sequences were as follows: miR-196a antisense, 5′-TAGGTAGTTTCATGTTGTTGGCCTGTCTC-3′; U6 antisense, GCAGGGGCCATGCTAATCTTC TCTGTATCGCCTGTCTC-3′. miRNAs were dissolved in Gel Loading Buffer II (Ambion), heated at 95°C for 3 min, loaded onto denaturing 15% TBE-Urea gels, and transferred onto Hybond-N nylon membranes (Amersham Pharmacia Biotech). Northern blots were prehybridized at 65°C for 1 h using Rapid Hybridization Buffer (Amersham Pharmacia Biotech) and incubated with 3′-DIG-labeled RNA probe (100 ng/ml; DIG RNA labeling kit; Roche) for 15 h at 65°C. CDP-Star (Roche), a chemiluminescent substrate for ALP, was used to detect hybridized probe.

Western blot analysis

Confluent hASCs were treated under the appropriate conditions and lysed, after which their protein contents were determined using a protein assay kit (Bio-Rad Laboratories). The proteins were loaded on 10% SDS polyacrylamide gels, electrotransferred to nitrocellulose membranes (Hybond-ECL; Amersham Pharmacia Biotech), and probed with monoclonal antibodies (anti-HOXC8; Novus Biologicals) and anti-β-actin antibody (Cell Signaling Technology). Immunoreactive bands were detected with anti-rabbit or anti-mouse peroxidase-conjugated secondary antibody (Amersham Pharmacia Biotech) and visualized using enhanced chemiluminescence (ECL detection kit; Amersham Pharmacia Biotech).

RNA transfection

Anti-miR miRNA inhibitors (anti-miRs) and scrambled RNA oligomer were purchased from Ambion. These were transfected into hASCs at a final concentration of 50 nM using DharmaFECT Transfection Reagent per the manufacturer's instructions. Small interfering RNA (siRNA) duplex oligo (on-TARGET plus SMART pool; Dharmacon) targeting HOXC8 mRNA or nontargeting duplex oligo as a negative control was transfected using DharmaFECT Transfection Reagent.

Reporter vectors and DNA constructs

A putative miRNA196a-recognition element (as single copy) from the HOXC8 gene was cloned in the 3′-UTR of the firefly luciferase reporter vector according to the manufacturer's specified guidelines. The oligonucleotide sequences were designed to carry the HindIII and SpeI sites at their extremities facilitating ligation into the HindIII and SpeI sites of pMIR-Report (Ambion). The oligonucleotides used in these studies were as follows: pMIR-WT HOXC8, 5′-CTAGTTAGGCAGTCTCAGTTGTTGGGA-3′ and 5′-AGCTTCCCAACAACTGAGACTGCCTAA-3′; pMIR-Mut HOXC8, 5′-CTAGTTAAGCGGGCTAAACTTTCGGTA-3′ and 5′-AGCTTACCGAAAGTTTAGCCCGCTTAA-3′.

Reporter gene assay

All transient transfections were conducted using Lipofectamine Plus Reagent (Invitrogen). The pMIR-report, pMIR-HOXC8, and pMIR-β-gal plasmids were used as reporter constructs. The cells were harvested 48 h after transfection in CCLR buffer and were subsequently assayed for their luciferase activity (Luciferase Assay System; Promega, Madison, WI, USA). The transfections were performed in duplicate, and all experiments were repeated several times. The luciferase assays were normalized according to their β-galactosidase activity.

Statistical analysis

All results are presented as means ± SE. Comparisons between groups were analyzed using t-tests (two-sided) or ANOVA for experiments with more than two subgroups. Posthoc range tests and pairwise multiple comparisons were conducted using the t-test (two-sided) with Bonferroni adjustments. Probability values of p < 0.05 were considered to be statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Effect of miR-196a lentivirus transduction on the differentiation and proliferation of hASCs

To examine the role of miR-196a in the osteogenic differentiation of hASCs, we determined the level of miR-196a expression during osteogenic differentiation by Northern blot and real-time PCR analysis. The results showed that miR-196a expression was increased 6 days after the induction of osteogenic differentiation of hASCs (Fig. 1).

thumbnail image

Figure Figure 1. miR-196a increases during osteogenic differentiation of hASCs. (A and B) Osteogenic differentiation of hASCs was induced for 10 days. miRNA were prepared at the indicated times, and Northern blotting (A) and real-time PCR (B) were performed. The relative quantities of the amplified products were determined with an image analyzer. The data represent the mean ± SE of the relative ratio of the miR-196a signal of the corresponding samples (n = 4). *p < 0.05 compared with control hASCs on the indicated days.

Download figure to PowerPoint

To further test the role of miR-196a in hASCs, we prepared a lentiviral construct for the overexpression of miR-196a. The miRNA-encoding oligonucleotides downstream of a polII promoter were inserted into a lentiviral expression vector, and the cells were infected with a lentivirus that was prepared from the constructs (LV-miR196a or the LV-miLacZ control) in 293FT cells. Most hASCs (>90%) expressed green fluorescent protein (GFP) and exhibited a morphology that was similar to that of naive hASCs or LV-miLacZ-infected hASCs (Fig. 2A). Real-time PCR analysis showed that transducing hASCs with the miR-196a lentivirus increased miR-196a expression by 5-fold (Fig. 2B). Northern blot analysis performed using miR-196a as a probe confirmed that LV-miR196a-transduced hASCs expressed higher levels of miR-196a (Fig. 2C).

thumbnail image

Figure Figure 2. Overexpression of miR-196a enhances osteogenic differentiation of hASCs. (A) Lentivirus transduction had no effect on the morphology of hASCs. A representative phase contrast image of each cell (magnification, ×200). (B and C) miRNAs were isolated from lentivirus-transduced hASCs, and real-time PCR (B) and Northern blotting (C) were performed. (D-G) Lentivirus-transduced hASCs were grown to confluence, and adipogenic or osteogenic differentiation was induced in differentiation media. (D) Adipogenic differentiation was determined by Oil red O staining to visualize intracellular lipid accumulation. (E) Osteogenic differentiation was determined by Alizarin red S staining to visualize calcification deposits within the cell monolayer. (F) Osteogenic and adipogenic differentiation was quantified by determining the density and area of Alizarin red S staining with an image analysis program (Multi Gauge V3.0; Fujifilm) or by measuring the optical density of Oil red O staining in isopropanol extracts, respectively. (G and H) RT-PCR analysis of the osteogenic genes BMP2, osteopontin (OPN), and Runx2 (G). Changes in expression of osteocalcin and alkaline phosphatase (ALP) genes during osteogenic differentiation (H). The relative quantities of amplified products were determined with an image analyzer. Data represent the mean ± SE of the relative ratio to the GAPDH signal of the corresponding samples (n = 4). *p < 0.05 compared with LV-miLacZ-transduced hASCs.

Download figure to PowerPoint

To study the impact of miR-196a overexpression on the efficiency of hASC differentiation, miR-196a-overexpressing hASCs were induced to differentiate along adipogenic or osteogenic lineages. Although miR-196a overexpression had no effect on adipogenesis (Figs. 2D and 2F), it significantly increased osteogenic differentiation, as indicated by Alizarin red S staining (Figs. 2E and 2F). We used real-time RT-PCR to determine whether miR196a overexpression increased the expression of genes involved in osteogenesis. The results showed that LV-miR196a-infected hASCs exhibited higher levels of bone morphogenetic protein 2 (BMP2), Runx2, and osteopontin (OPN) mRNA than control cells (Fig. 2G). We also determined changes in ALP and osteocalcin expression during differentiation. ALP expression was detected at 4 days after differentiation, and osteocalcin expression, a late marker of osteogenic differentiation,(23) was detected at 6 days after differentiation in LV-miLacZ-infected hASCs. LV-miR196a-infected hASCs showed earlier expression of ALP and osteocalcin genes than LV-miLacZ-infected cells (Fig. 2H).

Next, we determined the effect of miR-196a on hASC proliferation. After infecting the hASCs with LV-miR196a, we plated 60 infected cells on 100-mm culture plates and counted the number of colonies, as well as the number of cells in each colony, after 1 wk. The numbers of CFU and numbers of cells per colony in LV-miR196a-infected hASCs were significantly lower than those in LV-miLacZ-infected hASCs (Figs. 3A and 3C). Cell counting on the indicated days after plating 5 × 103 cells/well showed that LV-miR196a-infected cells had slower growth than LV-miLacZ-infected hASCs (Fig. 3D). To determine whether this reduction in CFU for LV-miR196a-infected hASCs was associated with a decreased efficiency in cell attachment mediated by a reduction of miR-196a expression, 5 × 103 hASCs transduced with LV-miLacZ or LV-miR196a were plated into each well of a 12-well plate, and the number of cells that had attached was counted after 2 h. The total numbers of attached LV-miR196a-infected hASCs were similar to the total numbers of attached LV-miLacZ-infected cells (Fig. 3E).

thumbnail image

Figure Figure 3. Overexpression of miR-196a decreases hASC proliferation. hASCs were infected with LV-miLacZ or LV- miR196a to assay proliferation. (A-C) The CFU assay was performed by plating 60 cells onto a 100-mm culture dish. The colonies and cell numbers were counted 7 days after plating, and the numbers of cells in each colony were counted. (C) Representative phase-contrast images of LV-miLacZ– or LV-miR196a-transduced hASCs (magnification, ×40). (D) hASC proliferation was determined by direct cell counting with a hemocytometer 1–4 days after lentiviral vector transduction. (E) To compare cell attachment of hASCs infected with lentiviruses, 5 × 103 cells were plated on each well of a 12-well plate, and the cell numbers were counted after 2 h. Data represent mean ± SE. *p < 0.05 compared with LV-miLacZ-transduced hASCs (n = 4).

Download figure to PowerPoint

Effect of an miR-196a inhibitor on the differentiation and proliferation of hASCs

Recent studies have used reverse-complement 2′-O-methyl sugar-modified RNA to block miRNA function in cell-based systems.(24) Herein, we determined the role of miR-196a by studying the effect of a specific miRNA inhibitor using oligo transfection. Real-time RT-PCR and Northern blot analysis showed that transfection of anti-miR-196a effectively inhibited miR-196 expression in hASCs (Figs. 4A and 4B), but parallel transfection with negative control anti-miRNA had no effect.

thumbnail image

Figure Figure 4. Inhibition of miR-196a decreases osteogenic differentiation of hASCs. (A and B) miR-196a levels were determined in control (anti-miR Cont) or miR-196a inhibitor (anti-miR196a) transfected hASCs using real-time PCR (A) and Northern blot analysis (B). (B and C) Oligonucleotide-transfected hASCs were grown to confluence, and osteogenic differentiation was induced for 10 days. (C) RT-PCR analysis of the osteogenic genes BMP2, Runx2, and osteopontin (OPN). The PCR products were quantified as in Fig. 2. *p < 0.05 compared with anti-miR Cont-transfected hASCs.

Download figure to PowerPoint

To study the effect of miR-196a inhibition on the efficiency of hASC differentiation, anti-miR-196a-transfected hASCs were induced to differentiate along adipogenic or osteogenic lineages. Alizarin red staining of miR-196a-transfected cells (n = 4, p < 0.05 compared with anti-miR Cont-transfected hASCs) and RT-PCR analysis of osteogenic marker genes clearly indicated that downregulation of miR-196a expression by the inhibitor decreased the osteogenic differentiation of hASCs without affecting adipogenesis (Figs. 4C and 4D).

In a CFU assay, anti-miR-196a-transfected hASCs showed higher colony numbers and cell numbers per colony than control oligonucleotide-transfected hASCs, without affecting cell attachment (Figs. 5A and 5D). Cell counting on the indicated days after plating 5 × 103 cells/well showed that the anti-miR-196a-transfected hASCs proliferated more than the control-transfected cells (Fig. 5E).

thumbnail image

Figure Figure 5. Inhibition of miR-196a increases hASC proliferation. hASCs were transfected with anti-miR Cont or 196a to assay proliferation. (A-C) anti-miR Cont and 196a-transfected hASCs were subjected to CFU assays: 60 cells were plated per 100-mm culture dish, and the numbers of colonies and cells in each colony were counted 7 days after plating. (C) Representative phase-contrast images of anti-miR Cont or anti-miR196a-transfected hASC (magnification, ×40). (D) To compare the efficiency of cell attachment between the transduced hASCs, 5 × 103 cells were plated in 12-well plates, and attached cells were counted after 2 h. (E) hASC proliferation was determined by direct cell counting with a hemocytometer 1–4 days after lentiviral vector transduction. Data represent the mean ± SE (n = 4). *p < 0.05 compared with anti-miR Cont-transfected hASCs.

Download figure to PowerPoint

miR-196a targets HOXC8 mRNA in the 3′UTR

Yekta et al.(16) found that miR-196a displayed extensive, evolutionarily conserved complementarity to HOXB8, HOXC8, and HOXD8 messages and that overexpression of mir-196a showed downregulation of HOXB8, HOXC8, HOXD8, and HOXA7 in HeLa S3 cells. We therefore used real-time PCR analysis to study their mRNA expression during osteogenic differentiation. HOXC8 mRNA levels gradually decreased during hASC osteogenic differentiation, whereas HOXA7, HOXB8, and HOXD8 mRNA levels did not change (Fig. 6A). Western blot analysis confirmed that HOXC8 markedly decreased during the osteogenic differentiation of hASCs (Fig. 6B). We determined whether forced expression of miR-196a and reduction of miR-196a by anti-miR-196a affected the expression of HOXC8 in hASCs. Western blot and real-time PCR analysis showed that HOXC8 expression was decreased in miR-196a-overexpressing hASCs but increased in anti-miR-196a-transfected hASCs (Figs. 6C and 6D, respectively).

thumbnail image

Figure Figure 6. miR-196a targets HOXC8 mRNA at 3′UTR. miR-196a targets HOXC mRNA at 3′UTR. (A) Osteogenic differentiation was induced in hASCs for 10 days. HOXA7, HOXB8, HOXC8, and HOXD8 expression in hASC osteogenic differentiation was analyzed by real-time PCR. (B) HOXC8 expression in hASC osteogenic differentiation was analyzed by Western blot, using β-actin expression as a loading control. HOXC8 expression levels were quantified with an image analysis program. *p < 0.05 compared with control hASCs on the indicated days. (C and D) HOXC8 expression in hASCs infected with LV or transfected with oligonucleotide was analyzed by Western blot (C) and real-time PCR (D). Data represent the mean ± SE. (E and F) Insertion of miR-196a target sequences within HOXC8 3′UTR leads to diminished luciferase reporter activity in the presence of miR-196a and increased activity in the presence of an miR-196a inhibitor. Empty, HOXC8-miR, or mutHOXC8-mir luciferase constructs were transfected into control or miR196a lentivirus-transduced hASCs (E) and anti-miR Cont or miR-196a-transfected hASCs (F). *p < 0.05 compared with LV-miLacZ-transduced hASCs; #p < 0.05 compared with anti-miR Cont-transfected hASCs.

Download figure to PowerPoint

A luciferase reporter assay was used to show that miR-196a directly decreased HOXC8 expression. We aligned the miR-196a sequence with the HOXC8 3′UTR insert and used the resulting construct to transfect hASCs. Transfection of LV-miR196a-infected hASCs with the parental luciferase construct (without the HOXC8 3′UTR) or mutant did not significantly alter the expression of the reporter. However, transfection with a luciferase construct in which the miR-196a target site from the HOXC8 3′UTR (pMIR-HOXC8) was inserted showed significantly less luciferase activity in LV-miR196a-infected hASCs than in control lentivirus-infected cells (Fig. 6E). Co-transfection of anti-miR196a oligo increased the luciferase activity of pMIR-HOXC8 in hASCs compared with co-transfection of the control oligo (Fig. 6F).

Effect of HOXC8 oligo transfection on differentiation and proliferation of hASCs

To determine the role of HOXC8 in the proliferation and differentiation of hASCs, we suppressed HOXC8 expression in hASCs with an RNA interference technique using oligo transfection. RT-PCR analysis confirmed that RNAi effectively inhibited HOXC8 expression in hASCs (Fig. 7A). To study the effect of HOXC8 downregulation on the efficiency of hASC differentiation, we induced osteogenic differentiation of the HOXC8 oligonucleotide-transfected hASCs. Alizarin red staining (n = 4, p < 0.05 compared with anti-miR Cont-transfected hASCs) and RT-PCR analysis of osteogenic marker genes clearly indicated that downregulation of HOXC8 by RNAi increased the osteogenic differentiation of hASCs (Figs. 7B and 7C). To determine the effect of HOXC8 oligo transfection on hASC proliferation, a CFU assay and total cell counting after cell plating were carried out. In the CFU assay, HOXC8 oligonucleotide-transfected hASCs displayed fewer colonies and fewer cells per colony than control oligonucleotide-transfected hASCs (Figs. 7D and 7F). Cell counting on the indicated days after plating 5 × 103 cells/well also showed that the HOXC8 oligonucleotide-transfected hASCs proliferated less than the control-transfected cells (Fig. 7G).

thumbnail image

Figure Figure 7. Effect of HOXC8 RNAi on hASC osteogenic differentiation and proliferation. HOXC8 gene silencing enhanced osteogenic differentiation and decreased hASC proliferation. (A) HOXC8 mRNA levels were determined in control- (Cont oligo) or HOXC8 oligonucleotide- (HOXC8 oligo) transfected hASCs using RT-PCR. (B and C) Oligonucleotide-transfected hASCs were grown to confluence, and osteogenic differentiation was induced for 10 days. (C) RT-PCR analysis of the osteogenic genes BMP2, Runx2, and osteopontin (OPN). The PCR products were quantified as in Fig. 2. (D-F) CFU assays were performed as in Figs. 5A and 5C. (G) Proliferation of hASCs was determined as in Fig. 2E. *p < 0.05 compared with control oligonucleotides-transfected hASCs.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

In this study, we investigated whether miR-196a was involved in the proliferation and osteogenic differentiation of hASCs. The levels of miR-196a expression increased during the osteogenic differentiation of hASCs, and miR-196a overexpression in hASCs inhibited proliferation and enhanced osteogenic differentiation. Furthermore, inhibition of miR-196a with 2′-O-methyl antisense oligonucleotides decreased osteogenic differentiation and increased proliferation. All of these results indicated that miR-196a positively regulated osteogenic differentiation and negatively regulated proliferation in hASCs.

The miR-196 miRNAs have a complementarity to sites in the 3′-UTRs of HOX genes representing each cluster.(16) Homeobox-containing proteins, such as HoxC8, can function as transcriptional repressors that are crucial for numerous developmental processes in animals.(25) Yueh et al.(26) showed that dose-dependent overexpression of a Hoxc8 transgene mediated cartilage defects, and Hox-binding elements (ATTA) are common in promoters of osteoblast differentiation marker genes, especially those that respond rapidly to BMP stimulation, such as osteoprotegerin and BMP-4.(27,28) Of the molecules that can induce osteoblastic differentiation, BMPs are some of the most potent osteotropic agents, because they are capable of inducing both osteoblast differentiation and bone formation. BMP signal transduction involves SMAD proteins, particularly SMAD1, which is the downstream BMP signaling effector that is phosphorylated by BMP type I receptors. SMAD1 phosphorylation induces its accumulation in the nucleus, where it regulates gene transcription, either by associating with a nuclear transcription factor or by binding directly to DNA.(29) SMAD1 interacts with the transcriptional repressor HOXC8, which disrupts its DNA binding and activates OPN gene transcription.(30)

In our studies, miR-196a overexpression downregulated the expression of HOXC8 at the protein and mRNA levels. Conversely, inhibition of miR-196a with complementary 2′-O-methyl RNA increased HOXC8 expression, enhanced the proliferation of hASCs, and inhibited their osteogenic differentiation. Furthermore, HOXC8 expression decreased during osteogenic differentiation of hASCs, and this decrease in HOXC8 expression was concomitant with the changes in miR-196a level (Figs. 6A and 6B). These findings suggested that HOXC8 is an excellent candidate as a miR-196 molecular target in hASCs. These data, collected with the use of a firefly luciferase reporter plasmid containing the HOXC8-predicted target gene sequences, showed that miR-196 overexpression decreased luciferase activity, and inhibition of miR-196 increased luciferase activity, confirming that HOXC8 is a direct target of endogenous miR-196a in hASCs.

Luzi et al.(21) showed that miR-26a expression was increased during hASC differentiation, whereas expression of SMAD1 was complementary to that of miR-26a. Theses results suggest the presence of a negative control mechanism in late osteogenic differentiation of hASCs. Our study showed the increase in miR-196a expression and concomitant decrease of HOXC8 expression, a negative regulator of SMAD1, during osteogenic differentiation. These findings indicated that decrease in miR196a-induced HOXC8 expression can overcome the negative control during osteogenic differentiation that resulted from miR-26a-induced inhibition of SMAD1 expression and that comprehensive understanding about complex interaction of miRNAs is needed for resolving the molecular mechanisms of osteogenic differentiation.

The role of miR-196a in the proliferation and differentiation of hASCs was further supported by determining the effect of HOXC8 downregulation on proliferation and osteogenic differentiation of hASCs. The data clearly showed that downregulation of HOXC8 using RNA interference increased the osteogenic differentiation of hASCs and inhibited cell proliferation (Figs. 7B and 7C). The possibility that Hoxc8 regulates cell proliferation has been suggested in various cancers. Hoxc8 expression is reportedly correlated with higher Gleason grades in prostate tumors,(31,32) and its downregulation inhibited the proliferation of prostate cancer cells in vitro.(33) Hoxc8 is selectively activated in cervical cancer cells(34) and expressed in esophageal squamous cell carcinoma tissue but not in adjacent noncancerous mucosa.(35) In this study, hASC proliferation was inhibited by miR-196a overexpression but enhanced by miR-196a inhibition.

Our data showing that miR196a regulates the differentiation and proliferation of hASC by modulating the levels of the HOXC8 transcription factor can provide mechanistic insights into the molecular processes of stem cell differentiation and proliferation.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

This study was supported by a grant (A080359) from the Ministry of Health and Welfare and the MRC Program of MOST/KOSEF (R13-2005-009).

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES