Osteopathia striata with cranial sclerosis owing to WTX gene defect

Abstract

Osteopathia striata with cranial sclerosis (OSCS) is an X-linked dominant condition marked by linear striations mainly affecting the metaphyseal region of the long bones and pelvis in combination with cranial sclerosis. Recently, the disease-causing gene was identified as the WTX gene (FAM123B), an inhibitor of WNT signaling. A correlation was suggested between the position of the mutation and male lethality. We performed genotype and phenotype studies using 18 patients from eight families with possible WTX gene defects and expanded the clinical spectrum of the affected females. All investigated families diagnosed with OSCS had WTX gene defects. One family had a WTX gene deletion; three of four point mutations were novel. The earlier reported WTX c.1072C>T was detected in four sporadic patients and appears to be a hotspot for mutations. Based on the nature of the mutation present in a surviving male patient, our data do not support the hypothesis raised by Jenkins et al. (2009) regarding a genotype-phenotype correlation for male lethality. The finding of a gene involved in WNT signaling as the cause of this sclerosing bone phenotype is not unexpected, but further functional studies are needed to explain the specific features. The WTX gene is mutated in different types of cancer, and it remains to be explained why osteopathia striata patients appear not to have an increased risk of cancer. Copyright © 2010 American Society for Bone and Mineral Research

Introduction

Sclerosing bone disorders are characterized by abnormally dense bones owing to a disturbed balance between formation by osteoblasts and resorption by osteoclasts, with increased bone formation or impaired bone resorption.1 Osteopathia striata with cranial sclerosis (OSCS; OMIM 166500) is marked by linear striations in the metaphyseal region of the long bones and pelvis in combination with cranial sclerosis owing to increased osteoblast activity.2–4 The condition is X-linked dominant with lethality in most affected males. Other common clinical findings of OSCS include macrocephaly, frontal bossing, ocular hypertelorism, a broad nasal bridge, hearing loss, and abnormalities of the palate. Rarely, cardiac malformations and developmental delay have been reported.4–7 Recently, Jenkins et al.4 were able to identify mutations in the gene encoding WTX (Wilms tumor on the X chromosome) (FAM123B), a repressor for WNT signaling, as the cause of X-linked OSCS. WNT signaling is a critical mediator of key cell-cell interactions during embryogenesis, in the regeneration of tissues in adult organisms, and in many other critical processes.8 It is known to play an anabolic role in bone formation by osteoblasts, and perturbation of this pathway is known to be involved in other sclerosing bone dysplasias such as Van Buchem disorder, sclerosteosis, and the high-bone-mass phenotype.9, 10 In addition to OSCS, WTX is known to be mutated in a significant percentage of Wilms tumors11, 12 and rarely in acute myeloid leukemia and colorectal cancer.13, 14

In this study, we analyzed a large set of families and patients and were able to confirm the causality of WTX mutations in all cases. However, we also had to reject the hypothesis explaining the lethality or survival of male patients based on the position of the WTX gene defect.

Materials and Methods

Patients and families

Patients were recruited in different clinical and genetic centers, and the diagnosis of OSCS was based on clinical and radiologic features. Informed consent was obtained from all patients. DNA isolation was performed on blood lymphocytes using standard procedures.

Mutation detection

Sequence analysis of the WTX gene was performed on DNA from patients. Polymerase chain reaction (PCR) fragments spanning the only exon and exon-intron boundaries were analyzed with the Big Dye Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems). The primers used were those suggested by Jenkins et al.4 The fragments were analyzed on an ABI3100 analyzer (Applied Biosystems).

Multiplex ligation-dependent probe amplification (MLPA)

MLPA was used to detect WTX genomic copy number imbalances in patient DNA quantitatively. DNA of healthy females was used as control. Two synthetic probes for the WTX open reading frame (ORF) were suggested by Jenkins et al.,4 and three additional control markers were constructed by Biolegio (Nijmegen, The Netherlands) (Table 1). Markers for two flanking genes, MTMR8 and ARHGEF9, were used to detect the extent of a possible deletion. The MLPA procedure proposed by MRC Holland was used.15 Fragments were separated and analyzed on an ABI3100 analyzer (Applied Biosystems). The intensities for each amplicon are compared with those of control samples. The dosage quotient is the ratio of the normalized peak intensity of the patient to the normalized peak intensity of a control. On the X chromosome, the normal female population has a dosage quotient of 1. A duplication was indicated if the peak intensity of the probe was 1.5 times higher than the intensity of the control peaks. A deletion was detected when a dosage quotient of 0.5 was reached.

Table 1. Probes Used in Multiplex Ligation-Dependent Probe Amplification (MLPA)

Size (in bp)	Position		Primer annealing sequence
108	WTX 1	L probe	gtgtccatgctggtctttgtcaccatttctca
		R probe	gattggggttggcccagtgcccttactcacaaat
116	WTX 2	L probe	gctgtgatcctgagaattcccagatgagactggtc
		R probe	cttggaggaccagtgaatgtggatagagaaggccaccta
101	ARGHGEF9 exon 1	L probe	ctagcatggtggctgtatggacagtctga
		R probe	cagaacagagactgacatctcccaatctgc
120	MTMR8 3'UTR	L probe	ccaagcatcagtgagttagttactcatcttccatgctaggt
		R probe	atacctacagcagctacaatgattcttgtcccagaga
80	Control CAB45 exon 4	L probe	caggaggccatggaggaga
		R probe	gcaagacacacttccgcgc
96	Control VIPR2 exon12	L probe	cgcgcccagtccttcctgcaaacggag
		R probe	acctcggtcatctagccccacccctgc
136	Control KIAA0056 exon8	L probe	tcagcaattatgccagcctgacctaccttcagatggcttgaaatggtt
		R probe	tactacagtctgcatcactatgtctgagacccttgtgttctccatcc

Results

Patients and families

Clinical information was collected from 18 patients from eight different families diagnosed with OSCS. The clinical data obtained are summarized in Table 2.

Table 2. WTX Gene Defects and Associated Clinical Data of Patients Diagnosed with OSCS

Patient	Sex	Age (years)	DNA	Protein	Sclerosis of bones	Striations of bone	Hearing impairment	Clefting	Facial dysmorphism	Macrocephaly	Cardiac anomaly	Developmental delay
Note: TP, terminated pregnancy; NIA, no information available.
1.4	F	75	1267 del C	L423fs+25X	+	+	+	−	+	+	−	−
1.9	F	39	1267 del C	L423fs+25X	+	+	+	−	+	+	−	−
1.12	M	41	1267 del C	L423fs+25X	+	+	+	+	+	+	−	+
2	F	29	337 del G	G113fs+58X	+	+	+	+	+	+	−	−
3.4	F	61	Deletion	No protein	+	+	+	+	+	+	−	−
3.7	F	43	Deletion	No protein	+	+	−	−	−	−	−	−
3.8	F	13	Deletion	No protein	+	+	+	+	+	+	+	−
3.9	F	TP	Deletion	No protein	+	−	NIA	+	+	−	−	NIA
4	F	29	1072 C>T	R358X	+	+	+	−	+	−	−	−
5	F	18	1072 C>T	R358X	+	+	+	−	+	+	−	−
6	F	3	1072 C>T	R358X	+	+	+	+	+	+	+	+
7	F	10	1072 C>T	R358X	+	+	+	−	+	+	−	+
8.3	F	67	811 C>T	Q271X	+	+	+	+	+	+	+	−
8.6	F	43	811 C>T	Q271X	+	+	−	−	+	+	−	−
8.7	F	41	811 C>T	Q271X	+	+	−	−	+	+	+	−
8.11	F	22	811 C>T	Q271X	+	NIA	−	−	−	+	−	+
8.12	M	20	811 C>T	Q271X	+	−	+	+	+	+	+	−
8.13	M	2	Unknown	Unknown	NIA	−	NIA	+	+	+	−	NIA

Family 1

The first family was described by Keymolen et al.16 about 10 years ago (Fig. 1A). A mother (see Fig. 1A: 1.4) was seen at the Department of Neurology because of gait disturbance and finger paresthesia owing to multiple sclerosis. She had polydactyly and suffered from chronic sinusitis. In addition to hypoesthesia on the palmar side of the first and second left fingers, paresis was present in the right leg with active tendon reflexes and a positive Babinski sign. She had macrocephaly, a large forehead, hypertelorism, and left palpebral ptosis. Skeletal survey revealed basal sclerosis of the skull and a thickened calvarium. There was spina bifida occulta at the S1 level and fine linear striations in the long bones. Hydrocephalus was diagnosed on a CT scan, and ENT examination demonstrated otosclerosis of the right ear. The diagnosis of OSCS was made incidentally during a complete neurologic investigation, but the woman did not seem to have suffered from the consequences of OSCS. The co-occurrence of OSCS and multiple sclerosis in this patient is coincidental according to Keymolen et al.16

Figure 1. Pedigrees of families 1 (A), 3 (B), and 8 (C). Pedigrees segregating OSCS in black, in which WTX gene defects were detected. Deceased persons are indicated with a diagonal line. Individuals expected to obligate WTX gene defect carriers without DNA investigation are hatched. Family numbers are indicated.

On examination, the daughter of 1.4 (see Fig. 1A: 1.9) had macrocephaly (>97th percentile), a flat nasal bridge, frontal bossing, and hypertelorism. Radiographs showed cranial thickening and striations of the femoral metaphyses. She had had recurrent otitis media during childhood and was found to have otosclerosis. She had a permanent bilateral hearing deficit. She also had irregular, malpositioned upper incisors and underwent an orthodontic treatment. In her thirties, she was diagnosed with an ovarian carcinoma that was treated by ovariectomy and hysterectomy.

The maternal cousin of patient 1.9 (see Fig. 1A: 1.12) was born prematurely. He had macrocephaly, severe stomach problems, cleft palate, impaired hearing, and delayed speech. Other features were frontal bossing, hypertelorism, bilateral epicanthic folds, high arched palate, and a small mouth. Radiographs showed thickened calvarium, increased density of the cranial base, and waveform striations in the body of the mandible. There were no linear striations in the femoral metaphyses. At 41 years of age, he led a normal active life despite his dysmorphism. His twin brother died a few hours after birth. Unfortunately, no details were available about his cause of death.

Individual 1.7 (see Fig. 1A) was reported to have no dysmorphic facial features, which, if correct, would imply that she represents a patient with nonpenetrance of OSCS because she is obligate carrier of the WTX gene defect. However, no DNA, clinical information, or radiologic survey was available. She died in a car accident around the age of 50.

Individuals 1.4 and 1.7 (see Fig. 1A) are likely to have inherited the WTX gene defect from their mother, given the lethality of the disease in most male patients. There are no reports of any dysmorphism in this individual (see Fig. 1A: 1.2). She died at an older age owing to leukaemia.

Family 2

This female patient (Fig. 2), her parents' third child, was born at 40 weeks' gestation, after a pregnancy complicated by polyhydramnios, with an Apgar score of 6/9 and a birth length of 51 cm (75th percentile), birth weight of 3990 g (75th percentile), and birth head circumference of 42 cm (6 cm >97th percentile). Sensorineural hearing loss was documented at age 1½ years. She had mild psychomotor developmental delay. Head control was delayed, presumably because of the weight of her head. She spoke her first words at age 2 years and walked at age 3 years. During childhood, she had chronic diarrhea because of intestinal malrotation.

Figure 2. (A) Clinical picture of patient 2 showing a prominent forehead and microretrognathia. (B) Plain radiograph of the skull (lateral view). There is marked sclerosis of the calvarium and skull base, which is most pronounced in the occipital and petrous temporal bones.

At age 3 years, a brain CT scan showed mild ventriculomegaly with widening of the basal cisterns and interhemispheric fissure, megacisterna magna, and cranial sclerosis. An EEG showed slow delta waves but no other abnormality.

Recurrent headaches (migraine) started at age 8 years, and from that time, she also complained of knee, elbow, and hand pain. Eruption of the secondary dentition was delayed. Facial dysmorphism includes macrocephaly with frontal bossing, dolichocephaly, deep-set small eyes, epicanthic folds, hypertelorism, broad nasal bridge, low-set ears, high arched narrow palate, and microretrognathia. She walked on tiptoe at the age of 18 years. Neurologic investigation was normal. Bilateral knee contractures (120 degree of extension was possible) were present. Skeletal survey at the ages of 4 and 18 years showed thick calvarium, cranial sclerosis, abnormal auditory ossicles, osteopathia striata of long bones, and mild thoracolumbar gibbus. Her pelvic bones were narrow and showed sclerosis. At age 19, she had a spontaneous abortion, and a bicornuate uterus was identified.

Family 3

This family was described by Savarirayan et al.17 as a family with OSCS with a highly variable phenotype. The family pedigree is illustrated in Fig. 1B. The proband (see Fig. 1B: 3.8), a girl, was the first child born to unrelated Caucasian parents at 34 weeks' gestation after a normal pregnancy. Macrocephaly with parietal bossing was detected in utero on ultrasound at 20 weeks. She had a cleft soft palate, anterior ectopic anus, cutaneous syndactyly of right middle and ring fingers, atrial and ventricular septal defects, left hydronephrosis with dilated left ureter, small right kidney (<3rd percentile), and increased skull base sclerosis and metaphyseal striations on radiography. Proximal osteolysis of the fibulae also was noted. A mild conductive hearing loss was observed.

The proband's mother (see Fig. 1B: 3.7) was normal on clinical examination, with a head circumference of 56 cm (75th percentile). Skeletal radiographs revealed sclerosis of the cranial base, mandible, and maxilla; thickening of the skull vault; and longitudinal striations in the metaphyseal regions of the long bones.

The proband's maternal grandmother (see Fig. 1B: 3.4) had a cleft palate repaired in infancy. Other clinical findings included macrocephaly with parietal bossing, short stature (<3rd percentile), midface hypoplasia, and conductive hearing loss. Skeletal radiographs showed sclerosis of the skull base and cranial vault and longitudinal striations in the metaphyseal regions of the long bones.

Antenatal ultrasound at 19 weeks into the proband's mother's second pregnancy demonstrated a fetus (see Fig. 1B: 3.9) with alobar holoprosencephaly, bilateral cleft lip and palate, and partial absence of the nose. The pregnancy was terminated. Autopsy documented bilateral absence of the olfactory nerves. Radiographs revealed abnormal sclerosis of the maxilla, mandible, and orbital roofs. No long bone striations were evident.

The proband's maternal great-grandmother (3.2) was normal on clinical examination, with a head circumference of 53 cm (25th percentile). She showed sclerosis of the skull base and thickening of the cranial vault, but the metaphyseal regions of the long bones had no striations.

Family 4

A 19-year-old female (4) was referred for the management of headache. She had a past history of recurrent otitis media, bilateral hearing loss, and progressive myopia. Her height was normal. She had frontal bossing, bitemporal narrowing, tooth malpositioning, hypotelorism, and moderate deafness. Intelligence and neurologic examination were normal. Skeletal radiographic evaluation demonstrated sclerosis of the cranial vault and skull base and linear striation in metaphyseal regions characteristic of OSCS (Fig. 3). Ophthalmologic evaluation showed myopia. The headaches disappeared after ocular correction.

Figure 3. (A) Plain radiograph of the skull (lateral view) shows uniform sclerosis of the calvarium, skull base, and facial bones. (B) Plain radiograph of the left knee (AP view) demonstrates dense linear striations at the diaphysis and metaphysis of the distal femur.

Her mother, aged 50 years, had similar craniofacial features and had had stapectomy for bilateral otosclerosis.

Family 5

This female (5) was born at term after a normal pregnancy. There were no neonatal complications. On examination, she had a relatively short stature (<25th percentile) and macrocephaly (head circumference 59.3 cm, >97th percentile). There was facial asymmetry, with the left side of her face more prominent; bony prominence of the left temporal region; and prominence of the forehead without a definite supraorbital ridge. She had epicanthic folds and a broad and high nasal bridge. A conductive hearing loss was detected. She underwent repair of tongue tie and required removal of her primary teeth because of slow and disordered growth of her secondary dentition. She has been noted to have sclerosis of her temporal bones and abnormal density of her jaw bones. Dense linear striations of the proximal diaphysis and metaphysis of the tibia and of the distal diaphysis of the radius were seen (Fig. 4). There was no relevant family history.

Figure 4. Radiographs of patient 5. (A) Plain radiograph of the left hand. Note the dense linear striations of the distal diaphysis of the radius. (B) Plain radiograph of the left lower leg. Typical dense linear striations of the proximal diaphysis and metaphysis of the tibia are seen.

Family 6

This patient (6) is her mother's seventh child and her father's third. Her mother has normal skull radiographs and no features of OSCS. She was delivered at 39 weeks by emergency cesarean section for fetal distress. The birth weight was 3.033 kg. She had a cleft palate, a ventral septal defect that closed, and a patent ductus arteriosus. She was hypotonic as a baby. She developed macrocephaly (97th percentile), frontal bossing with deep-set eyes, telecanthus, and a broad nasal bridge. She has significant hearing loss and wears hearing aids. Development was delayed; she sat at 12 months, pulled to stand at 2 years, and walked just after 2 years old. Her height was on the 0.4th centile.

Skeletal radiographic evaluation demonstrated sclerosis of the cranial vault and skull base and linear striations in metaphyseal regions characteristics of osteopathia striata with cranial sclerosis. In addition, the ribs were widened.

Family 7

This patient (7) is a young girl from a family with no history of OSCS (M Barbosa et al., manuscript in preparation). Polyhydramnios was detected during pregnancy. She was delivered prematurely at 32 weeks' gestation with normal weight, length, and head circumference. The clinical course in the first year of life was complicated by failure to thrive and global developmental delay. Laryngotracheomalacia was noted. A CT scan of the larynx performed at the age of 3 years revealed absence of the laryngeal cartilages and thickening of the epiglottis. The CT scan also suggested partial agenesis of the corpus callosum (data not shown). A conductive hearing loss was diagnosed. At 4 years of age, she had surgery for correction of microretrognathia. At 7 years of age, a skeletal survey showed thickening of the cranial vault and base, overt striations in the metaphyseal and diaphyseal areas of the long bones, and fanlike striations of the iliac bones. In addition, sclerotic mastoids, abnormal ossicular fixation, and stenosis of the otic foraminae were observed. At her last clinical evaluation at age 9 years, the patient showed short stature, macrocephaly, and borderline full-scale IQ of 77. Facial dysmorphism included prominent forehead with frontal bossing, low-set and posteriorly rotated ears, hypertelorism, epicanthic folds, depressed nasal bridge, high arched palate, and crowded teeth (Fig. 5). The patient had no history of headaches, chronic lower extremity pain, facial palsy, or vision impairment.

Figure 5. Facial dysmorphisms of patient 7: prominent forehead with frontal bossing, hypertelorism, epicanthal folds, and depressed nasal bridge.

Family 8

This family has an extensive history of OSCS, with six affected individuals in four generations, and was first described by Koenig et al.18 The pedigree is shown in Fig. 1C. The oldest patient (see Fig. 1C: 8.2) was said to have had a large head. Skeletal radiographic evaluation verified the diagnosis of OSCS.

Her daughter (8.3) had a midline cleft palate that was repaired at age 4 years. At 27 years, a hemodynamically insignificant combined mitral valve insufficiency/stenosis was noted. Examination at 54 years showed a woman with macrocephaly (>97th percentile), hypertelorism (>97th percentile), nasal speech, and pectus excavatum. Skeletal radiographs demonstrated sclerosis of the cranial base with hypoplasia of the left maxillary sinus and fine striation of the femur and tibia. She suffered from mild hearing loss and required hearing aids.

The younger daughter of 8.3 (see Fig. 1C: 8.7) was born after an uneventful pregnancy. The birth weight was 4,650 g, and length was 51 cm. She had an atrial septal defect (ASD) and patent ductus arteriosus (PDA). The ASD closed spontaneously, whereas the PDA was ligated at 2 years. Because of increasing head circumference, pneumencephalography was performed, demonstrating internal hydrocephalus. Skeletal radiographic evaluation demonstrated increased density of the cranial base and striations of the humeral head, ribs, and scapulae. In addition, the clavicles were long and straight, and the dorsal parts of the ribs were widened. She presented at the age of 14 with a head circumference of 61 cm (>97th percentile), hypertelorism, a broad nasal bridge, maxillary hypoplasia, prominent mandible, and apparent low-set, posteriorly angulated, “dysplastic” ears. At age 17 years, she suffered from right-sided peripheral facial palsy. Audiogram and visual field examination were normal.

The older daughter of 8.3 (see Fig. 1C: 8.6) had a head circumference of 62 cm (>97th percentile), a relatively flat face, hypertelorism, and a broad nasal bridge. Hearing and vision were normal on examination. Skeletal radiographic evaluation demonstrated sclerosis of the cranial base and thickened calvarium. Slight striated densities were present in the maxilla and in the ascending ramus of the mandible. Typical striations were presented in the epiphyses and metaphyses of the tibia and femur.

The daughter of 8.6 (see Fig. 1C: 8.11) was born after an uneventful pregnancy with normal weight and height. At the age of 7 years, the child showed moderate speech retardation. Hearing and vision were normal. At the age of 8½ years, her occipitofrontal circumference (OFC) was 56 cm (>97th percentile). Skeletal radiographic evaluation demonstrated increased density of the cranial base without striations.

The older son of 8.6 (see Fig. 1C: 8.12) was born at term. He had Pierre Robin sequence with submucous cleft palate and bronchoscopically verified tracheomalacia. Cranial CT scan showed ventricular dilatation without signs of increased pressure. Dolichocephaly, macrocephaly, frontal bossing, mild hypertelorism, broad nasal bridge, dental malformations, and mixed hearing loss were present. His ears were deep set and posteriorly rotated. His palpable clavicles were abnormally long with broad ends. Radiographs of the skull showed increased density, particularly in the cranial base and maxilla. Metaphyses of the femur and tibia were dense but without striations.

The younger son of 8.6 (see Fig. 1C: 8.13) had cleft palate, macrocephaly, frontal and occipital bossing, biparietally enlarged cranium, epicanthic folds, hypertelorism, depressed nasal bridge, and full lips. A malformation of the epiglottis (omega epiglottis) with recurrent obstructive sleep apnea requiring tracheostomia was observed. He had developmental dysplasia of the hip.

Analysis of the WTX gene

After the recent identification of WTX as the gene causing OSCS, we analyzed this gene for mutations in our patients. The data obtained are presented in Table 2. Mutation analysis of the single coding exon of WTX resulted in the identification of three novel mutations (c.1267delC, c.337delG, c.811C>T) and one known mutation (c.1072C>T) in WTX. Only members of the families diagnosed with OSCS had the mutation in their WTX gene. All these mutations lead to a truncated transcript (L423fs+25X, G113fs+58X, R358X, and Q271X). No mutation was found in patients from family 3. Therefore, we decided to look for a heterozygous deletion by multiplex ligation-dependent probe amplification (MLPA). The two synthetic probes of WTX show a peak intensity of approximately 0.5 in the patients of family 3, whereas the neighboring probes (ARGHGEF9 exon 1 and MTMR8 3' UTR) and the control markers have a peak intensity of approximately 1 (Fig. 6). These data clearly show that only the WTX gene, or at least a large part of it, is deleted in the affected members of family 3 and that the maximal extent of the deletion is 0.6 Mb (distance between the two flanking probes).

Figure 6. MLPA data of two female patients (3.9 and 3.7) from family 3 and five female control individuals. MLPA was used to detect genomic copy number imbalances in patients with OSCS. The two synthetic probes of WTX (WTX112 and WTX116) are deleted in the two patients, whereas the probes of the neighboring genes (ARHGEF9 101 and MTMR8 120) and the control markers (CONT 80, CONT 96, and CONT 136) are not.

Discussion

In line with a recent report from Jenkins et al.,4 we were able to identify mutations in the gene encoding WTX (Wilms tumor on the X chromosome), a repressor for WNT signaling, in patients with X-linked OSCS. All investigated families diagnosed with OSCS had WTX gene defects.

We collected clinical data and DNA from patients diagnosed with OSCS from eight different families. The identification of three new WTX gene defects and one known WTX gene defect confirms that this gene is associated with OSCS. Also, MLPA detected a deletion of the WTX gene in one family. These data confirm the involvement of aberrant WNT signaling in the pathogenesis of OSCS.

Osteopathia striata has been considered, until recently, a benign roentgenographic finding, marked by sclerosis of the bones and linear striations in the metaphyseal region of the long bones and pelvis. The identification of mutations in a WNT-signaling mediator, WTX, as the causative factor for OSCS explains why the clinical consequences are not limited to the bones but involve other systems. The WNT proteins form a family of highly conserved secreted signaling molecules that regulate cell-to-cell interactions during embryogenesis. The WTX protein is a component of the β-catenin destruction complex that contains APC and AXIN. This complex facilitates the phosphorylation of β-catenin by casein kinase 1 (CK1). This leads to the ubiquitination and proteosomal degradation of β-catenin and negatively regulates the WNT/β-catenin signaling pathway.19, 20 In the absence of functional WTX, β-catenin accumulates in the nucleus, where it functions as a transcriptional coactivator for members of the TCF-LEF family of transcription factors.21, 22 The pleiotropic clinical findings in patients diagnosed with OSCS clearly demonstrate the importance and widespread function of the WNT signaling during embryogenesis. WTX encodes a 1135-amino-acid protein that contains an acidic domain (AD) and three APC binding domains (APCBD1–3). At the N-terminus, a phospholipid binding [PtdIns (4,5)P₂] activity is localized. A β-catenin-binding domain is localized at Gly368 of the C-terminal.4WTX has two splice forms, WTX_S1 and the shorter WTX_S2, resulting from excluding residues 50–326. Both isoforms retain the ability to bind β-catenin, but only WTX_S1 is localized to the plasma membrane and therefore seems to be important for the suppression of WNT signaling in the context of development. This seems to be illustrated by the fact that the presence of intact WTX_S2 is not protective against the disease. The patients in families 2 and 8 have WTX gene defects (c.G113fs+58X and p. Q271X) that are located in the region lacking in WTX_S2, implicating that the patients both retain intact WTX_S2 but still develop OSCS (Fig. 7). There is also no indication of a milder clinical phenotype in these individuals.

Figure 7. The two spicing variants of WTX and their functional domains. WTX encodes a 1135-amino-acid protein that contains an acidic domain (AD) and three APC binding domains (APCBD1–3). At the N-terminus, a phospholipid-binding [PTDINS (4,5)P₂] activity is localized. A β-catenin-binding domain is localized at GLY368 of the C-terminal.4WTX has two splice forms, WTX_S1 and the shorter WTX_S2, resulting from excluding residues 50–326. The truncated proteins of each case are indicated. Note that the identified mutation in family 8 (q271x) results in a highly truncated protein without APCBD1, although this family contains affected surviving males.

The wide phenotypic spectrum and grade of penetrance of OSCS cannot be explained solely by the type of WTX gene defect, as illustrated with the clinical variation within families 1, 3, and 8. In family 3, a deletion of the entire WTX gene was detected in four individuals, whereas the expression of the disease is highly variable within the family. Some individuals are very mildly affected, which can complicate the diagnosis in other family members. For example, the great-grandmother in family 3 was diagnosed initially with OSCS based on radiographs showing sclerosis of the skull base and thickening of the cranial vault, but the familial deletion causing OSCS was not detected in this individual's blood lymphocytes.17 This indicates that somatic mosaicism of the WTX gene deletion could be present in her, explaining the absence of striations. Another possibility is that the cranial sclerosis in this individual has an other etiology, other than the familial WTX deletion. In family 1, there might be a case of nonpenetrance of the disease in individual 1.7 at least from a clinical point of view because no clinical features were reported. However, a radiologic survey was not available. In family 8, the two affected males show no striations on X-ray. This suggests that WTX mutations should be considered in cases of cranial sclerosis, even if striations are not present. Finally, several reports were made suggesting nonrandom X inactivation in OSCS.7, 23, 24 This phenomenon also could provide an explanation for the clinical variation, as seen in females. For example, unfavorable nonrandom X inactivation possibly could worsen the prognosis of female patients. This might have been the case in patient 3.9, a female fetus that was aborted because of severe clinical features detected in the early stage of the pregnancy. The high ratio of females (11:3) in this study compared with the expected 2:1 ratio in X-linked dominant diseases suggests that WTX gene defects lead to increased prenatal lethality or more severe syndromes being present in males. Jenkins et al.4 suggested a possible genotype-phenotype correlation that relates the position of the mutations in WTX with survival in males: Only mutations that produce a WTX_S1 with intact PtdIns (4,5)P₂ and APCBD1 domain result in survival of males. Our data indicate that this correlation is far less clear. The identified WTX gene defect in patient 8 (p.Q271X) results in a highly truncated protein with an intact PtdIns (4,5)P₂ domain but without the APCBD1 domain. Offspring within this family contains two affected but surviving males, one being already 20 years of age. It appears that one type of WTX mutation cannot be associated with a vast set of clinical features owing to unknown modifying factors (see Table 2).

The multiple occurrences of the WTX c.1072 C>T mutation in our set of patients (four isolated cases) and in the patients described by Jenkins et al. (33% of all families) suggests the presence of a hotspot for mutations owing a CpG dinucleotide. Spontaneous deamidation of methylated C (CpG hotspot effect) leads to enhanced frequency of mutation. CpG mutations account for a disproportionate amount of all coding human point mutation.

The sclerosing aspect of several bones is clearly the most prominent feature of this condition. This is in line with the fact that several other sclerosing bone phenotypes have been explained recently by increased WNT signaling causing increased bone formation. In contrast to these other disorders, sclerosis in OSCS is accompanied by striations in the bones, indicating variability in bone formation rate for which no explanation is currently available. Interestingly, otosclerosis was present in several OSCS patients, indicating increased bone formation in the otic capsule, a bone that in general shows almost complete absence of bone remodelling. Also, it is known that the WNT/β-catenin signaling pathway plays distinct, even opposing roles during various stages of cardiac development.25

WTX is known to be mutated in a significant percentage of Wilms tumors11, 12 and rarely in acute myeloid leukemia and colorectal cancer.13, 14WTX has been presented as a “single hit” tumor-suppressor gene in a “multihit” tumorigenesis process. In contrast, it appears that individuals with germ-line loss-of-function mutations in their WTX gene are not predisposed to cancer. X inactivation was excluded as a possible explanation by Jenkins et al.4 The low number of patients studied, the lethality of OSCS in males, the high variable penetrance of OSCS, and the low age of some of the patients are likely to influence the number of tumors detected within our group of patients. Currently, in our set of 18 patients, ovarian cancer was described in one patient and a putative carrier of a WTX defect (individual 1.2). She died at an older age owing to leukemia, but it is unclear whether these cancers were related to the constitutional WTX gene defect. Further studies are needed to reveal how mutation in this tumor-suppressor gene can explain the pathogenesis of the intriguing bone phenotype of OSCS without apparently increasing the risk for tumors.

Disclosures

All authors have no conflicts of interest.

Acknowledgements

This work was supported by grants from the “Fonds voor Wetenschappelijk Onderzoek” (FWO, G.0117.06), from the European Commission (FP7 program, Grant HEALTH-F2-2008-201099), and from the Special Research Funds (BOF) of the University of Antwerp, all to Wim Van Hul. Bram Perdu holds a PhD studentship from the European Calcified Tissue Society.