SEARCH

SEARCH BY CITATION

Keywords:

  • heterotopic ossification;
  • platelike osteoma cutis;
  • progressive osseous heteroplasia;
  • GNAS1;
  • Cbfa1/RUNX2

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

We evaluated a 7-year-old girl with severe platelike osteoma cutis (POC), a variant of progressive osseous heteroplasia (POH). The child had congenital heterotopic ossification of dermis and subcutaneous fat that progressed to involve deep skeletal muscles of the face, scalp, and eyes. Although involvement of skeletal muscle is a prominent feature of POH, heterotopic ossification has not been observed in the head, face, or extraocular muscles. The cutaneous ossification in this patient was suggestive of Albright hereditary osteodystrophy (AHO); however, none of the other characteristic features of AHO were expressed. Inactivating mutations of the GNAS1 gene, which encodes the α-subunit of the stimulatory G protein of adenylyl cyclase, is the cause of AHO. Mutational analysis of GNAS1 using genomic DNA of peripheral blood and of lesional and nonlesional tissue from our patient revealed a heterozygous 4-base pair (bp) deletion in exon 7, identical to mutations that have been found in some AHO patients. This 4-bp deletion in GNAS1 predicts a protein reading frameshift leading to 13 incorrect amino acids followed by a premature stop codon. To investigate pathways of osteogenesis by which GNAS1 may mediate its effects, we examined the expression of the obligate osteogenic transcription factor Cbfa1/RUNX2 in lesional and uninvolved dermal fibroblasts from our patient and discovered expression of bone-specific Cbfa1 messenger RNA (mRNA) in both cell types. These findings document severe heterotopic ossification in the absence of AHO features caused by an inactivating GNAS1 mutation and establish the GNAS1 gene as the leading candidate gene for POH.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

PLATELIKE OSTEOMA cutis (POC; Mendalian Inheritance in Man [MIM] 166350) is a disorder of heterotopic ossification of the dermis that is present at birth or appears within the first year of life and is characterized by the presence of at least one bony platelike lesion, although other areas of cutaneous ossification also may be present. POC is not associated with trauma, infection, or metabolic abnormalities. Recently, severe congenital POC affecting the scalp and face, and severe nonplatelike heterotopic ossification affecting extremities, sternal, and inguinal regions of a 7-year-old child was described.(5) In this report, we examine the molecular basis of the child's condition.

Primary cutaneous ossification with progressive involvement of subcutaneous fat and skeletal muscle is exceedingly rare. Postnatal heterotopic ossification of dermis and subcutaneous fat are common clinical features of Albright hereditary osteodystrophy (AHO). However, heterotopic ossification in AHO involves only cutaneous and subcutaneous tissues, unlike the condition of the patient described in this report, which progressed to involve deep connective tissues including skeletal muscles of the face, skull, and eyes. Progression of dermal ossification into deep connective tissue is the defining feature of progressive osseous heteroplasia (POH).(6) However, although involvement of skeletal muscle is a prominent feature of POH, it has never before been described in the face, scalp, or extraocular muscles.

The superficial clinical similarities to AHO in our patient suggested the possibility that an inactivating mutation might exist in the GNAS1 gene, which encodes the α-subunit of the stimulatory G protein of adenylyl cyclase (Gsα) and which has been identified as the underlying genetic cause of AHO.(7,8) Examination of the GNAS1 gene in our patient revealed a mutation that predicted a nonfunctional Gsα protein and a possible cause for the heterotopic ossification in this child. The identification of an inactivating mutation of GNAS1 in this patient with severe cutaneous ossification and progression into deep skeletal muscle is an unexpected finding and provides an opportunity to examine cellular events through which an inactivating mutation of GNAS1 mediates heterotopic bone formation.

Cbfa1/RUNX2 has been identified as an obligate osteogenic transcription factor.(1,9–13) In vivo forced expression of the Cbfa1 gene in nonosteoblastic cells induces the expression of osteoblast-specific genes,(4,11,12,14,15) and Cbfa1 binds cis-acting regulatory regions of genes that are regulated in osteoblast differentiation.(12,16,17) Homozygous deletion of Cbfa1 blocks osteoblastic differentiation and marrow formation, resulting in a profound defect in osteogenesis.(9,10) Mutations in Cbfa1 in humans are the cause of cleidocranial dysplasia (CCD).(1) To initiate studies to examine whether an inactivating GNAS1 mutation would influence, directly or indirectly, the expression of genes involved in osteogenesis, we investigated the expression of Cbfa1 in both lesional and nonlesional dermal fibroblasts from our POC patient and detected expression of bone-specific Cbfa1 messenger RNA (mRNA) in both cell types.

Our findings present the first example of a GNAS1 mutation in a child with severe POC and shows severe heterotopic ossification in the absence of AHO features that is caused by an inactivating GNAS1 mutation. This case also identifies downstream pathways of osteogenesis through which GNAS1 may act and establishes the GNAS1 gene as the leading candidate gene for POH.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Cell culture

Unless otherwise specified, all culture media and reagents were obtained from Life Technologies, Inc. (Gaithersburg, MD, U.S.A.). Human osteogenic sarcoma cell lines, TE 85 and U-2 OS were obtained from American Type Culture Collection (Rockville, MD, U.S.A.) and cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS; Hyclone Laboratories, Logan, UT, U.S.A.) and 100 U/ml pencillin/100 μg/ml streptomycin.

Primary cell lines were established from a lesional skin biopsy of the forehead and from uninvolved skin adjacent to the surgical margin from a 7-year-old female patient with severe POC. The tissue biopsy specimens were cultured in DMEM, 10–20% FBS, and 100 U/ml penicillin per 100 μg/ml streptomycin per 1.25 μg/ml amphotericin B. Under the culture conditions used, dermal fibroblasts are expected to outgrow any osteoblast cells that might be present.(18) Control dermal fibroblasts were isolated from normal human volunteers and grown under the identical conditions. Informed consent was obtained in accordance with the standards set by the institutional review boards of the participating institutions.

A primary osteoblast cell line was established from a surgical sample of normal human trabecular bone from the distal femur of a patient with osteoarthritis, as previously described.(18) Bone fragments were washed thoroughly in phosphate-buffered saline (PBS) and penicillin G/streptomycin/amphotericin B, treated with collagenase type 3 (Worthington, Freehold, NJ, U.S.A.), and then cultured in DMEM with 10% FBS. Proliferating-stage osteoblast RNA was isolated from the cultures at 80% confluence. At confluence, the cells were induced with 5 mg/ml ascorbic acid and 1 M β-glycerol phosphate (Sigma, St. Louis, MO, U.S.A.) to induce differentiation. This treatment was repeated every 3 days until mineralization was achieved. RNA was isolated from differentiation stage cells 6–8 weeks postconfluence and from mineralized cells at 3–4 months postconfluence.

RNA isolation

Total RNA was recovered from cells using Trizol Reagent (Life Technologies, Inc.), and poly(A)+ RNA was isolated using Micro-FastTrack reagents (Invitrogen, Carlsbad, CA, U.S.A.) according to recommended protocols. RNA was quantitated by spectrophotometry at A260/A280. The integrity of the RNA samples was verified by electrophoresis on a 1% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA, and 20 mM acetic acid).

Northern analysis

RNA samples (10 μg) were denatured at 65°C for 15 minutes and then electrophoresed through a 1% agarose gel containing 2.2 M formaldehyde in 3-(N-morpholino)propane sulfonic acid (MOPS) buffer, pH 7.0.(19) Molecular weights were estimated using RNA standards (0.28-6.58 kilobases [kb]; Promega, Madison, WI, U.S.A.). Fractionated RNA samples were transferred to Nytran Plus membranes (Schleicher and Schuell, Keene, NH, U.S.A.) and covalently UV cross-linked (Spectronics Corp., Westbury, NY, U.S.A.). Membranes were prehybridized at 42°C for 4 h in 2× Northern Pre-Hybridization Buffer and then hybridized overnight at 42°C with labeled probes (106 counts/ml) in 2× Hybridization Buffer (5Prime-3Prime, Boulder, CO, U.S.A.). Multiple tissue Northern blots (Clonetech, Palo Alto, CA, U.S.A.) were prehybridized for 90 minutes and hybridized for 1 h at 68°C in ExpressHyb solution (Clonetech). Complementary DNA probes were labeled with [α-32P]deoxycytosine triphosphate (dCTP) by random priming using Prime-It II reagents (Stragagene, La Jolla, CA, U.S.A.). Membranes were washed twice for 5 minutes at room temperature in 2× SSC (1× is 0.15 M sodium chloride; 0.15 M sodium citrate), twice at 55°C for 5–30 minutes in 2× SSC and 1% sodium dodecyl sulfate (SDS), and twice in 0.1× SSC at room temperature for 30 minutes. Blots were exposed to Phosphor Screens and analyzed on a Storm 820 PhosphorImager (Molecular Dynamics, Sunnyvale, CA, U.S.A.). Samples were normalized by probing all blots with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) complementary DNA (cDNA).

Northern probes for human elastin and alkaline phosphatase were constructed from polymerase chain reaction (PCR) products amplified from cDNA templates (primers were designed from published sequences: Genbank accession nos. X52896, ABO11406, and AF001443, respectively; Table 1) that were cloned in TA vector (Invitrogen). The cDNA clones for osteopontin and bone sialoprotein (received from M. Young, National Institutes of Health [NIH])(20,21) and GAPDH(22) have been described.

Table Table 1.. PCR Primers
Thumbnail image of

Reverse-transcription PCR

Reverse transcription (RT) was performed on 1 μg of total RNA using 12.5 μg/ml of oligo dT primer and 1 mg/ml RNasin (Promega), 5 U/ml SuperScript II reverse transcriptase and 1× PCR buffer (Life Technologies), 5 mM MgCl2, 10 mM dithiothreitol (DTT), and 1 mM deoxynucleoside triphosphates (dNTPs; Pharmacia, Piscataway, NJ, U.S.A.) in a final volume of 10 μl. Samples were incubated at 42°C for 1 h, followed by heat inactivation at 95°C for 10 minutes.

PCR amplification of 5 μl of each reverse-transcribed RNA sample was performed using 1× PCR buffer with 1.5 mM MgCl2 and 2.5 U of Amplitaq (Perkin Elmer, Norwalk, CT, U.S.A.) with 50 ng of each forward and reverse primer in a final volume of 20 μl. Primer pairs were designed using MacVector (Oxford Molecular, Campbell, CA, U.S.A.). Primer pairs for Cbfa1 exon 0, exon 1, and runt domain (designed from published sequences, GenBank accession nos. AF001443, AF001444, AF001445, AF001446, AF001447, AF001448, AF001449, and AF001450; Table 1) were used to amplify RT products for 40 cycles: 1 minute at 94°C, 1 minute at 64°C, and 1 minute at 74°C (PTC-200 thermal cycler; MJ Research, Watertown, MA, U.S.A.). Primer pairs (Table 1) for elastin, tissue nonspecific human alkaline phosphatase (TNSAP), osteocalcin, and osteopontin were used to amplify RT products for 34 cycles: 1 minute at 94°C, 1 minute at 60°C, and 1 minute at 72°C. Amplification of GNAS1 exon 7 used the same conditions and previously described primers.(23)

Genomic DNA analysis

Genomic DNA was recovered directly from blood or from cultured cells and purified by standard methods using proteinase K, SDS, and phenol.(19) Oligonucleotide primers that flank the exon-coding regions of the human GNAS1 gene were used to PCR-amplify genomic DNA templates using the recommended cycling conditions for each primer pair.(7,24) Each PCR reaction contained (in a final volume of 50 μl) 250 ng of genomic DNA, 0.5 μM of each primer, 0.1 mM dNTPs (Pharmacia), and 1× PCR buffer with 1.5 mM MgCl2 and 1.25 U of Taq polymerase (Life Technologies). After denaturation at 94°C for 4 minutes, the exon 7 mutation was detected in products amplified with 5′TGAGCCTGACCTTGTAGAGAGACACA and 5′GGTTATTCCAGAGGGACTGGGGTGAA for 40 cycles at 94°C for 1 minute, 67°C for 1 minute, and 72°C for 2 minutes (PTC-200 thermal cycler; MJ Research). After amplification, the PCR products were purified with Geneclean III (Bio101, La Jolla, CA, U.S.A.) and sequenced by the DNA Sequencing Core Facility of the University of Pennsylvania School of Veterinary Medicine.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Clinical evaluation of a patient with severe POC

A child was identified with severe POC of the scalp and face, a variant of POH.(5) The POC involved the forehead and preauricular and orbital regions and progressed during early childhood to involve the underlying skeletal muscle (Fig. 1). She also developed heterotopic ossification of subcutaneous tissue in her left hand, left foot, and sternal and inguinal regions bilaterally. Postnatal heterotopic ossification of dermis and subcutaneous fat often are seen in patients who have AHO. However, the child's condition progressed to involve skeletal muscle of the face, skull, and eyes, which are features not seen in AHO. No other morphological or endocrine features of AHO were present; the child's height and weight were normal, there was no brachydactyly, and the face was not round. The serum calcium, phosphorus, albumin, parathyroid hormone (PTH) level, and thyroid function tests were normal. There was no family history of ectopic ossification, short stature, obesity, brachydactyly, or hormone resistance.

thumbnail image

Figure Figure 1. Severe progressive POC in the forehead of a child. The heterotopic ossification was present in the patient (A) at birth and (B) progressed to involve the deep subcutaneous tissue and frontalis muscle, which was confirmed at the time of surgical removal at 7 years of age.

Download figure to PowerPoint

Histological analysis of POC lesional tissue and dermal fibroblasts

For aesthetic reasons, the patient underwent operative excision of the forehead lesion at 7 years of age with a 5-mm margin of clinically uninvolved skin and subcutaneous tissue.(5) Specimens taken from regions of heterotopic ossification (involved skin) of the surgical excision were examined under light microscopy (Fig. 2). The epidermis appeared normal and free of heterotopic ossification or calcification. Discrete areas of mature lamellar bone were identified in the reticular dermis and underlying frontalis muscle. There were no cartilaginous cells. No increased vascularity or inflammations were seen adjacent to the heterotopic bone or elsewhere within the dermis. Gross and microscopic examination of the margins of the surgical specimen (uninvolved skin) revealed normal epidermis and dermis, without any evidence of ossification.

thumbnail image

Figure Figure 2. Histology of the epidermis and dermis of the POC lesional area; hematoxylin and eosin staining. (A) The epidermis appeared normal and free of heterotopic bone formation or calcification; magnification, ×80. (B) Discrete areas of mature lamellar bone appear in the reticular dermis; magnification, ×250.

Download figure to PowerPoint

Primary fibroblast cell lines were established from the dermis of the involved and uninvolved skin. The fibroblasts cultured from these surgical specimens, as well as dermal fibroblasts from a normal control, were examined under light microscopy. The fibroblasts cultured from the patient's involved and uninvolved skin showed a similar uniformly fibroblastic appearance. Although similar to normal control skin fibroblasts, cells from both lesional and perilesional skin cell lines appeared to contain more cellular extensions than normal skin fibroblasts.

Mutational analysis of the GNAS1 gene

Genomic DNA from the patient was recovered from cultured lesional and uninvolved dermal fibroblasts and from peripheral blood lymphocytes. Genomic DNAs were amplified by PCR using primers to span GNAS1 exons 1–13, including splice junctions and some small introns, and the DNA sequence was determined. DNA from all tissues examined revealed heterozygosity for a 4-base pair (bp) deletion in exon 7 (Fig. 3A). This deletion causes a shift in the protein-coding reading frame and predicts a nonfunctional protein product containing 13 incorrect amino acids followed by a premature stop codon. RT-PCR analysis of RNA isolated from the patient's cultured lesional fibroblasts, using primers(23) that amplify the exon 7 region of the GNAS1 cDNA, showed that the mutated GNAS1 allele is not detected as mRNA (Fig. 3B). The same 4-bp deletion has been previously identified as an inactivating mutation of GNAS1 in some patients with AHO, and this mutation has been shown to cause haploinsufficiency of GNAS1 protein levels in heterozygotes.(23)

thumbnail image

Figure Figure 3. GNAS1 gene mutation in a patient with POC. (A) The normal DNA sequence of a segment of exon 7 of GNAS1 is shown with the amino acid translation below the corresponding nucleotide triplets (normal allele). Numbering corresponds to the codon number.(32) PCR amplification and DNA sequencing revealed a heterozygous 4-bp deletion in the POC patient. The DNA sequence and amino acid translation of the mutant allele are shown (with the deleted nucleotides indicated by dashes). (B) RNA from the patient's lesional fibroblasts was subjected to RT-PCR to amplify GNAS1 exon 7 and the PCR products were sequenced. The resulting chromatogram shows that only the sequence of the normal allele is detected. The four nucleotides that are deleted in the mutant allele are underlined.

Download figure to PowerPoint

Neither parent of the proband had evidence of dermal ossification. Genomic DNA was recovered from peripheral blood of both parents and analysis of the GNAS1 exon 7 DNA sequence did not reveal a 4-bp deletion, suggesting that the patient's mutation was spontaneous, although germ line mosaicism in one of the parents cannot be excluded.

Cbfa1 expression in POC dermal fibroblasts

The Cbfa1 gene encodes an essential transcription factor for bone formation and osteoblast differentiation.(1,9–13) To initiate an examination of the pathways through which GNAS1 may influence the induction of osteogenesis, Cbfa1 mRNA expression was evaluated. Total RNA was isolated from dermal fibroblasts obtained from the POC involved (POC-I) and POC uninvolved (POC-U) skin and from human control osteoblast and skin fibroblast lines. RT-PCR analysis using primers that amplify the Cbfa1 runt domain (the functional DNA binding domain of the Cbfa1 protein) showed that Cbfa1 mRNA is expressed in normal osteoblasts, POC involved and uninvolved dermal fibroblasts, and in control skin (Fig. 4, lanes 3, 6, 9, and 12).

thumbnail image

Figure Figure 4. Expression of Cbfa1 transcripts in cells from a patient with POC. Total RNA was isolated from cultured normal human osteoblasts (lanes 1–3), normal human skin fibroblasts (lanes 4–6), and from skin fibroblasts derived from the uninvolved (POC-U) (lanes 7–9) and involved (POC-I) (lanes 10–12) POC patient skin. RT-PCR was performed to detect specific domains of Cbfa1: exon 0 (lanes 1, 4, 7, and 10), exon 1 (lanes 2, 5, 8, and 11), or the runt domain (lanes 3, 6, 9, and 12). The primer pairs used for exon 0 and exon 1 domains will detect mutually exclusive transcripts. The runt domain is a region common to both Cbfa1 mRNA isoforms.

Download figure to PowerPoint

Expression of two forms of Cbfa1 transcripts with different first exons

Two forms of Cbfa1 mRNA that contain different first exons have previously been reported and suggested to have tissue-specific expression.(1,2) These Cbfa1 transcript isoforms were further characterized in order to examine their specific expression in POC dermal fibroblasts.

RT-PCR was performed on U-2 OS (human osteosarcoma) RNA using primer pairs to detect specifically the 5′ portions of two Cbfa1 mRNA isoforms (named for the first exon used by each transcript: exon 0 or exon 1). The DNA sequence of the PCR products from each reaction was determined, compared with published sequences, and found to be identical to the previously reported exon 0 and exon 1 isoforms.(2) The junction between exon 1 and exon 2 was sequenced and was the same for both the exon 0 and the exon 1 forms of Cbfa1. The splicing events predicted by the DNA sequences from the RT-PCR products are diagrammed in Fig. 5. The exon 0 isoform consists of exon 0 spliced within exon 1, excluding a 5′ segment of exon 1. The exon 1 isoform consists of the entire exon 1 spliced to exon 2. As has been noted previously,(1,2) the differences in the two Cbfa1 transcript isoforms predict that each will encode proteins that differ at their N-terminal ends; however, in vivo physiological significance of two different Cbfa1 proteins has not been determined.(4)

thumbnail image

Figure Figure 5. Splicing patterns of two alternate forms of human Cbfa1 transcripts. The splicing events shown are predicted by the DNA sequences of RT-PCR products. The top line of the schematic represents the genomic DNA of the first three reported exons of the human Cbfa1 gene, with exons shown as boxes and introns shown as lines between the exons. The bottom portion of the schematic represents the spliced transcripts. The exon 0 isoform consists of exon 0 spliced within exon 1, excluding a 5′ segment (hatched region) of exon 1. The exon 1 isoform consists of the entire exon 1 spliced to exon 2. The differences in the two Cbfa1 transcript isoforms predict(1,2) that each will encode proteins that differ at their N-terminal ends. (The described experiments only examined the 5′ segment of the Cbfa1 transcripts; no conclusions can be made regarding splicing events that occurred further downstream than the region depicted in this figure.)

Download figure to PowerPoint

The expression of the two Cbfa1 mRNA isoforms in normal osteoblasts and normal skin cells was examined by RT-PCR using primer pairs that specifically detect each isoform. The Cbfa1 exon 1 isoform was detected in both osteoblasts and skin (Fig. 4, lanes 2 and 5), whereas the exon 0 isoform was detected in osteoblasts but not skin (Fig. 4, lanes 1 and 4).

Tissue-specific expression of Cbfa1 was further examined by multiple tissue Northern blot analysis. We detected no Cbfa1 mRNA in heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas (data not shown), which is consistent with previous data reporting restricted tissue expression of Cbfa1.(11,12) Additionally, no expression of Cbfa1 exon 0 was detected by RT-PCR in RNAs from muscle, lung, and T lymphocytes.

These data show the expression of Cbfa1 in both bone and skin cells. However, although the exon 1 isoform was expressed in both of these cell types, the exon 0 isoform was detected specifically in cells with an osteoblastic phenotype.

Expression of a bone-specific form of Cbfa1 mRNA in POC dermal fibroblasts

To examine Cbfa1 expression in patient cells, RNAs from cultured lesional and uninvolved dermal fibroblasts were analyzed by RT-PCR for expression of the two Cbfa1 mRNA isoforms using primers specific for the Cbfa1 exon 0 and exon 1 mRNAs. The bone/skin-expressed Cbfa1 exon 1 form was detected in normal osteoblasts, POC-U and POC-I dermal fibroblasts, and control skin (Fig. 4; lanes 2, 5, 8, and 11). The bone-specific Cbfa1 exon 0 form was not detected in control skin but was expressed in normal osteoblasts, as well as in both POC-U and POC-I dermal fibroblasts (Fig. 4; lanes 1, 4, 7, and 10).

Phenotypic characterization of cultured POC skin cell lines

POC-U and POC-I skin-derived cell lines were examined for expression of mRNAs characteristic of bone or skin cells. Northern blot analysis was used to examine the expression of elastin, a marker of dermal fibroblasts,(25) and of several osteoblast transcripts: osteocalcin, osteopontin, alkaline phosphatase, and bone sialoprotein.(26) Both POC skin cell lines expressed elastin by Northern analysis (Fig. 6A). Results from RT-PCR using primers specific for elastin mRNA were consistent with these Northern analysis data and additionally confirmed the absence of elastin expression in control osteoblast cells (data not shown). Expression of osteocalcin mRNA, found in differentiated and mineralized osteoblasts,(26) could not be detected by RT-PCR in either the POC-I or POC-U cell lines (data not shown). However, both the POC-I and the POC-U cells expressed alkaline phosphatase, osteopontin, and bone sialoprotein transcripts, which are expressed by earlier proliferating stage osteoblasts.(26) These results were determined by Northern analysis (Fig. 6B) and confirmed by RT-PCR. Although these transcripts are not exclusive to bone cells,(20,21,27) the composite pattern of expression of alkaline phosphatase, osteopontin, and bone sialoprotein is characteristic of osteoblastic cells. Expression of both skin and early osteoblast markers is consistent with a hypothetical transition or multipotential state of these cells.

thumbnail image

Figure Figure 6. Northern analysis to examine expression of phenotypic markers for bone and skin cells in the POC patient cell lines. Poly(A)+ RNAs were isolated from cells cultured from the uninvolved skin of the POC patient (POC-U) and from skin involved in the POC lesion (POC-I). After electrophoresis and blotting, the RNAs were probed for expression of (A) elastin or (B) osteopontin, bone sialoprotein, and alkaline phosphatase. RNAs from several control human skin cell lines (two examples are shown in A) and from (B) cultured osteoblasts at proliferating, differentiating, and mineralizing stages also were examined with the indicated probes. Each blot was also probed for control GAPDH mRNA expression.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

This study strongly suggests that severe POC is caused by an inactivating mutation in the GNAS1 gene in the patient described. The identified heterozygous 4-bp deletion within exon 7 of the GNAS1 gene encodes a protein reading frameshift leading to 13 incorrect amino acids followed by a premature stop codon. RNA analysis showed that only GNAS1 mRNA expressed from the normal allele could be detected; the mutant GNAS1 mRNA presumably is not synthesized or rapidly degraded.(28) AHO (MIM 103580) is another disorder that is caused by inactivating mutations of the GNAS1 gene and by reduced levels of Gsα activity. However, AHO, unlike POC, is characterized by short stature, obesity, round face, brachydactyly, multiple hormone resistance, and dermal ossification that does not progress to deep connective tissues.(8,29) It is of interest to note that the same 4-bp deletion identified in the described POC patient also has been found to be a mutational “hot spot” in AHO.(23,30,31) This observation suggests that AHO and POC may be part of a phenotypic spectrum of clinical disorders that are caused by inactivating GNAS1 mutations.

The GNAS1 gene encodes the α-subunit of the stimulatory G protein of adenylyl cyclase (Gsα).(32) G proteins are heterotrimeric (α-, β-, and γ-subunits) guanine nucleotide binding proteins that interact with the cytoplasmic domains of extracellular receptors to mediate many signal transduction pathways.(8,29) Although the bone-specific pathways regulated by G-protein activation remain to be elucidated, several G-protein coupled receptor agonists that influence bone formation have been identified including PTH, PTH-related protein (PTHrP), prostaglandins, and sodium fluoride.(8,33) Indian hedgehog (Ihh) stimulation of PTHrP in the growth plate of developing long bones regulates the maturation of chondrocytes and ossification.(34,35) In McCune Albright syndrome (MAS; MIM 174800), somatic activating mutations of GNAS1, which result in overstimulation of Gsα activity, lead to an arrest of osteoblast maturation and result in fibrous dysplasia of bone in the normotopic skeleton.(36) In contrast, inactivating mutations of GNAS1 in patients with AHO and in our patient with POC lead to an understimulation of Gsα-activated pathways and result in heterotopic ossification of soft connective tissues (Table 2). Considered together, these findings suggest that GNAS1 may normally function as a negative regulator of osteoblast specification.

Table Table 2.. Osteogenic Features of G Protein-Related Disorders
Thumbnail image of

The identification of an inactivating mutation of GNAS1 in a patient with severe cutaneous ossification and progression into deep skeletal muscle provides an opportunity to examine cellular events through which an inactivating mutation of GNAS1 mediates heterotopic bone formation. Cbfa1/RUNX2 has been identified as an obligate transcription factor for osteoblast differentiation and osteogenesis.(1,9–13) Two variants (exon 0 and exon 1 isoforms) of Cbfa1 mRNA have been described in humans.(1,2) Each of these transcripts contains different first exons and appears to involve alternate splicing, predicting the synthesis of unique protein products that differ at their N-terminal ends. Alternate splicing involving other exons within the Cbfa1 gene also has been described(2,3); however, the pattern of this downstream splicing with respect to the exon 0 and exon 1 isoforms is not well characterized.

The importance of specific Cbfa1 isoforms to cell function and/or cellular differentiation is unknown. Studies using Cbfa1−/− mice have shown effects of Cbfa1 on the expression of genes associated with the osteoblastic phenotype, including alkaline phosphatase, osteopontin,(9,10) and osteocalcin.(11) Recent studies(4) report that different Cbfa1 isoforms can stimulate osteocalcin promoter activity; however, the physiological relevance remains to be established. In mice, the Cbfa1 transcripts containing exon 0 sequences were detected in bone but not in other tissues.(11) The exon 0 isoform is important in osteoblast development and plays an essential role in osteoblast differentiation. These observations are consistent with our data showing that expression of the Cbfa1 exon 0 transcript appears to be restricted to osteoblastic cells. Expression of the Cbfa1 exon 0 isoform in the POC patient's lesional and uninvolved fibroblasts and the composite pattern of expression of alkaline phosphatase, osteopontin, and bone sialoprotein in these cells also are consistent with an osteogenic phenotype. Because skin fibroblasts also have been reported to express at least some of these markers of differentiated bone cells,(20,21,27) one possible explanation of the dermal localization of heterotopic ossification in conditions such as POC, AHO, and POH is that dermal cells may be more susceptible than other cell types to differentiation to an osteoblastic phenotype. Alternatively, mesenchymal stem cells residing in the dermis or circulating marrow stromal cells deposited in the dermis may give rise to cells of an osteoblastic phenotype when derepressed by inactivating mutations in GNAS1 as in our patient or in those who have AHO. This hypothesis is supported by recent data that showed elevation of cyclic adenosine monophosphate (cAMP; which mediates PTH/G-protein signaling) inhibits osteoblast differentiation, including increased proteolysis and decreased DNA binding of Cbfa1.(37)

In situ hybridization of mouse embryos using a probe for the Cbfa1 runt domain (which detects both isoforms) showed Cbfa1 expression in skin.(9) Our data indicate that the Cbfa1 exon 1 transcript is expressed in both bone cells and skin cells; however, the in vivo function of the exon 1 isoform remains unknown. Several studies examining the ability of the Cbfa1 isoforms to regulate promoter activity have shown that both exon 0 and exon 1 isoforms are functionally active in vitro, although the exon 1 isoform may have a lower potential to activate osteoblast-specific genes compared with the exon 0 isoform.(4,14,15) The different amino terminal ends of the proteins predicted to be translated from each isoform could be expected to affect the cellular activities of the Cbfa1 protein. Alternatively, the production of multiple isoforms of Cbfa1 could be a mechanism to regulate Cbfa1 expression at the transcriptional level.

Our data suggest that reduced levels of GNAS1 expression influence downstream events leading to an osteoblast-competent phenotype. Expression of the bone-specific Cbfa1 exon 0 isoform may be a direct effect of decreased GNAS1 expression or a consequence of osteoblastic differentiation that is influenced by GNAS1 independently of Cbfa1. Moreover, this work suggests that GNAS1 encodes a negative regulator of osteogenic lineage determination. Inactivating GNAS1 mutations, such as found in AHO and in our patient with POC, are expected to produce reduced levels of Gsα protein that may be insufficient to maintain a brake on cellular induction to osteoblast differentiation at ectopic sites. Our finding of Cbfa1 exon 0 expression in uninvolved dermal fibroblasts of our POC patient further suggests that the misexpression of the Cbfa1 exon 0 isoform may be necessary but not sufficient to form bone at an ectopic site.

POC is a disorder in which mesenchymal stem cells differentiate into bone outside the context of the normal skeleton. The question of how multipotent stem cells differentiate into multiple lineages is one that arises not just in the context of mesenchymal tissues but also in neural crest and hematopoietic tissues. Whether mesenchymal differentiation occurs on an instructive or permissive basis(38) has yet to be determined, but our data suggest that GNAS1 pathways play an important role in lineage specification in cells of mesenchymal origin.

A recent study(39) reported the presence of inactivating GNAS1 mutations and/or decreased Gsα activity in 2 patients with features of both AHO and severe POH-like progressive dermal ossification. Although it is possible that these two phenotypes in these children are caused by mutations in different genes, the presence of deep and progressive heterotopic ossification in children with variable features of AHO suggests that a common molecular mechanism may be responsible for their heterotopic ossification. Here, we report the first identification of an inactivating mutation of GNAS1 in a POC patient with severe heterotopic ossification in the absence of any AHO features.

The two major findings of this study are the discovery of an inactivating mutation of GNAS1 in a child with severe POC (a clinical variant of POH) and the discovery of the altered expression in skin cells of a bone-specific isoform of Cbfa1, an obligate osteogenic transcription factor. These findings establish molecular landmarks in the transformation of soft connective tissue into heterotopic bone and strongly suggest that GNAS1 is the leading candidate gene for other forms of primary dermal ossification such as POH, a disorder for which progression of dermal ossification to deep connective tissue is the defining feature.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The authors thank members of our laboratory, Mei-qi Xu, Leota Terry, Bob Caron, and Andrea Tiglio, for their technical contributions to this work. The authors acknowledge the support of the POH Association, the International Fibrodysplasia Ossificans Progressiva Association, the New Jersey Association of Student Councils, the Ian Cali Fund, the NIH (2-RO1-AR41916-04 and 1-RO1-AR46831-01), and the Isaac & Rose Nassau Professorship of Orthopedic Molecular Medicine.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  • 1
    Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S, Lindhout D, Cole WG, Henn W, Knoll JHM, Owen MJ, Mertelsmann R, Zabel BU, Olsen BR 1997 Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 89:773779.
  • 2
    Xiao ZS, Thomas R, Hinson TK, Quarles LD 1998 Genomic structure and isoform expression of the mouse, rat and human Cbfa1/Osf2 transcription factor. Gene 214:187197.
  • 3
    Geoffroy V, Corral DA, Zhou L, Lee B, Karsenty G 1998 Genomic organization, expression of the human CBFA1 gene, and evidence for an alternative splicing event affecting protein function. Mamm Genome 9:5457.
  • 4
    Xiao ZS, Hinson TK, Quarles LD 1999 Cbfa1 isoform overexpression upregulates osteocalcin gene expression in non-osteoblastic and pre-osteoblastic cells. J Cell Biochem 74:596605.
  • 5
    Tresserra L, Tresserra F, Grases PJ, Badosa J, Tresserra M 1998 Congenital plate-like osteoma cutis of the forehead: An atypical presentation form. J Craniomaxillofac Surg 26:102106.
  • 6
    Kaplan FS, Craver R, MacEwen GD, Gannon FH, Finkel G, Hahn G, Tabas J, Gardner RJ, Zasloff MA 1994 Progressive osseous heteroplasia: A distinct developmental disorder of heterotopic ossification. Two new case reports and follow-up of three previously reported cases. J Bone Joint Surg Am 76:425436.
  • 7
    Miric A, Vechio JD, Levine MA 1993 Heterogeneous mutations in the gene encoding the alpha-subunit of the stimulatory G protein of adenylyl cyclase in Albright hereditary osteodystrophy. J Clin Endocrinol Metab 76:15601568.
  • 8
    Ringel MD, Schwindinger WF, Levine MA 1996 Clinical implications of genetic defects in G proteins. The molecular basis of McCune-Albright syndrome and Albright hereditary osteodystrophy. Medicine 75:171184.
  • 9
    Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao Y-H, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T 1997 Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89:755764.
  • 10
    Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GWH, Beddington RSP, Mundlos S, Olsen BR, Selby PB, Owen MJ 1997 Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89:765771.
  • 11
    Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G 1997 Osf2/Cbfa1: A transcriptional activator of osteoblast differentiation. Cell 89:747754.
  • 12
    Banerjee C, McCabe LR, Choi JY, Hiebert SW, Stein JL, Stein GS, Lian JB 1997 Runt homology domain proteins in osteoblast differentiation: AML3/CBFA1 is a major component of a bone-specific complex. J Cell Biochem 66:18.
  • 13
    Zhang Y-W, Bae S-C, Takahashi E, Ito Y 1997 The cDNA cloning of the transcripts of human PEBP2αA/CBFA1 mapped to 6p12.3-p21.1, the locus for cleidocranial dysplasia. Oncogene 15:367371.
  • 14
    Tsuji K, Ito Y, Noda M 1998 Expression of the PEBP2αA/AML3/CBFA1 gene is regulated by BMP4/7 heterodimer and its overexpression suppresses type I collagen and osteocalcin gene expression in osteoblastic and nonosteoblastic mesenchymal cells. Bone 22:8792.
  • 15
    Harada H, Tagashira S, Fujiwara M, Ogawa S, Katsumata T, Yamaguchi A, Komori T, Nakatsuka M 1999 Cbfa1 isoforms exert functional differences in osteoblast differentiation. J Biol Chem 274:69726978.
  • 16
    Geoffroy V, Ducy P, Karsenty G 1995 A PEBP2 alpha/AML-1-related factor increases osteocalcin promoter activity through its binding to an osteoblast-specific cis-acting element. J Biol Chem 270:3097330979.
  • 17
    Merriman HL, van Wijnen AJ, Hiebert S, Bidwell JP, Fey E, Lian J, Stein J, Stein GS 1995 The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/runt domain transcription factor family: Interactions with the osteocalcin gene promoter. Biochemistry 34:1312513132.
  • 18
    Robey PG, Termine JD 1985 Human bone cells in vitro. Calcif Tissue Int 37:453460.
  • 19
    Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, U.S.A.
  • 20
    Young MF, Kerr JM, Termine JD, Wewer UM, Wang MG, McBride OW, Fisher LW 1990 cDNA cloning, mRNA distribution and heterogeneity, chromosomal location, and RFLP analysis of human osteopontin (OPN). Genomics 7:491502.
  • 21
    Fisher LW, McBride OW, Termine JD, Young MF 1990 Human bone sialoprotein. Deduced protein sequence and chromosomal localization. J Biol Chem 265:23472351.
  • 22
    Hanauer A, Mandel JL 1984 The glyceraldehyde 3 phosphate dehydrogenase gene family: Structure of a human cDNA and of an X chromosome linked pseudogene; amazing complexity of the gene family in mouse. EMBO J 3:26272633.
  • 23
    Weinstein LS, Gejman PV, de Mazancourt P, American N, Spiegel AM 1992 A heterozygous 4-bp deletion mutation in the Gs alpha gene (GNAS1) in a patient with Albright hereditary osteodystrophy. Genomics 13:13191321.
  • 24
    Jan de Beur SM, Deng Z, Ding C, Levine MA 1998 Amplification of the GC-rich exon 1 of GNAS1 and identification of three novel nonsense mutations in Albright's hereditary osteodystrophy. Proceedings of the Endocrine Society Annual Meeting, Abstract 211, New Orleans, LA, U.S.A., p. 62.
  • 25
    Uitto J, Fazio M, Bashir M, Rosenbloom J 1991 Elastic fibers of the connective tissue. In: GoldsmithLA (ed.) Physiology, Biochemistry, and Molecular Biology of the Skin, 2nd Ed. Oxford University Press, New York, NY, U.S.A., pp. 530557.
  • 26
    Aubin JE, Liu F, Malaval L, Gupta AK 1995 Osteoblast and chondroblast differentiation. Bone 17:77S83S.
  • 27
    Fedde KN, Cole DE, Whyte MP 1990 Pseudohypophosphatasia: Aberrant localization and substrate specificity of alkaline phosphatase in cultured skin fibroblasts. Am J Hum Genet 47:776783.
  • 28
    Culbertson MR 1999 RNA surveillance: Unforeseen consequences for gene expression, inherited genetic disorders and cancer. Trends Genet 15:7480.
  • 29
    Farfel Z, Bourne HR, Iiri T 1999 The expanding spectrum of G protein diseases. N Engl J Med 340:10121020.
  • 30
    Yu S, Yu D, Hainline BE, Brener JL, Wilson KA, Wilson LC, Oude-Luttikhuis ME, Trembath RC, Weinstein LS 1995 A deletion hot-spot in exon 7 of the Gs alpha gene (GNAS1) in patients with Albright hereditary osteodystrophy. Hum Mol Genet 4:20012002.
  • 31
    Ahmed SF, Dixon PH, Bonthron DT, Stirling HF, Barr DGD, Kelnar CJH, Thakker RV 1998 GNAS1 mutational analysis in pseudohypoparathyroidism. Clin Endocrinol (Oxf) 49:525531.
  • 32
    Kozasa T, Itoh H, Tsukamoto T, Kaziro Y 1988 Isolation and characterization of the human Gs alpha gene. Proc Natl Acad Sci USA 85:20812085.
  • 33
    Quarles LD, Siddhanti SR 1996 Guanine nucleotide binding-protein coupled signaling pathway regulation of osteoblast-mediated bone formation. J Bone Miner Res 11:13751383.
  • 34
    Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ 1996 Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 273:613622.
  • 35
    Lanske B, Karaplis AC, Lee K, Luz A, Vortkamp A, Pirro A, Karperien M, Defize LHK, Ho C, Mulligan RC, Abou-Samra AB, Juppner H, Segre GV, Kronenberg HM 1996 PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth. Science 273:663666.
  • 36
    Bianco P, Cancedda FD, Riminucci M, Cancedda R 1998 Bone formation via cartilage models: The “borderline” chondrocyte. Matrix Biol 17:185192.
  • 37
    Tintut Y, Parham F, Le V, Karsenty G, Demer LL 1999 Inhibition of osteoblast-specific transcription factor Cbfa1 by the cAMP pathway in osteoblastic cells. J Biol Chem 274:2887528879.
  • 38
    Shah NM, Groves AK, Anderson DJ 1996 Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members. Cell 85:33143.
  • 39
    Eddy MC, Jan de Beur SM, Yandow SM, McAlister WH, Kaplan FS, Shore EM, Whyte MP, Levine MA 2000 Deficiency of the α-subunit of the stimulator G protein and severe extraskeletal ossification. J Bone Miner Res 15:20742083.