Identification of the Calcium-Sensing Receptor in the Developing Tooth Organ

Authors

  • Robert S. Mathias,

    Corresponding author
    1. Department of Pediatrics, Children's Renal Center, University of California, San Francisco, California, USA
    • Address reprint requests to: Robert Mathias, M.D., Children's Renal Center, 533 Parnassus Avenue, University of California San Francisco Medical Center, San Francisco, CA 94143–0748, USA
    Search for more papers by this author
  • Catharina H. E. Mathews,

    1. Department of Growth and Development, Division of Pediatric Dentistry, University of California, San Francisco, California, USA
    Search for more papers by this author
  • Cen Gao,

    1. Department of Growth and Development, Division of Pediatric Dentistry, University of California, San Francisco, California, USA
    Search for more papers by this author
  • Darren Machule,

    1. Department of Growth and Development, Division of Pediatric Dentistry, University of California, San Francisco, California, USA
    Search for more papers by this author
  • Wu Li,

    1. Department of Growth and Development, Division of Pediatric Dentistry, University of California, San Francisco, California, USA
    Search for more papers by this author
  • Pamela K. Denbesten

    1. Department of Growth and Development, Division of Pediatric Dentistry, University of California, San Francisco, California, USA
    Search for more papers by this author

Abstract

Calcium (Ca2+) is a critical component of tooth enamel, dentin, and the surrounding extracellular matrix. Ca2+ also may regulate tooth formation, although the mechanisms for such action are poorly understood. The Ca2+-sensing receptor (CaR) that is expressed in the parathyroid gland, kidney, bone, and cartilage has provided a mechanism by which extracellular Ca2+ can regulate cell function. Because these tissues play an important role in maintaining mineral homeostasis and because Ca2+ is hypothesized to play a crucial role in tooth formation, we determined whether the CaR was present in teeth. In this study, using immunohistochemistry, CaR protein was detected in developing porcine molars localized in the predentin (pD), early secretory-stage ameloblasts, maturation-stage smooth-ended ameloblasts (SA), and certain cells in the stratum intermedium. CaR protein and messenger RNA (mRNA) were detected also in an immortalized ameloblast-like cell line (PABSo-E) using immunofluorescence, reverse-transcription polymerase chain reaction (RT-PCR), and Northern analysis. Based on the observation that the CaR is expressed in cultured ameloblasts, we determined whether increments in medium Ca2+ concentration could activate the intracellular Ca2+ signal transduction pathway. In PABSo-E cells, increasing extracellular Ca2+ in the medium from 0 (baseline) to 2.5mM or 5.0 mM resulted in an increase in intracellular Ca2+ above baseline to 534 ± 69 nM and 838 ± 86 nM, respectively. Taken together, these results suggest that the CaR is expressed in developing teeth and may provide a mechanism by which these cells can respond to alterations in extracellular Ca2+ to regulate cell function and, ultimately, tooth formation.

INTRODUCTION

ENAMEL FORMATION requires the deposition of calcium (Ca2+) and other minerals into the extracellular matrix. Mature enamel, which is the most highly mineralized tissue in the body, is formed through a coordinated sequence of events under the control of the ameloblast.(1, 2) In the developing enamel organ, the inner enamel epithelium differentiates first into presecretory ameloblasts and then secretory ameloblasts and finally into mature ameloblasts. The ameloblast, a highly specialized multifunctional epithelial cell, regulates the production, resorption, and degradation of enamel matrix and the transport of Ca2+ into the extracellular matrix.(1, 3) During the secretory phase, the ameloblasts secrete multiple proteins into the enamel matrix.(2) Although Papagerakis et al. recently showed that 1,25-dihydroxyvitamin D3 administration to vitamin D-deficient rats up-regulated expression of the enamel-specific protein amelogenin,(4) the mechanisms that regulate ameloblast function are poorly understood.

Ca2+ is a major component of mature enamel matrix, and Ca2+ also may play a key role in the regulation of enamel formation.(5) The expression of intracellular proteins that bind ionic Ca2+ with high affinity such as calbindin D 9 kDa and calbindin D 28 kDa in the ameloblast suggests that intracellular Ca2+ may modulate cell function.(6) Ca2+ also has been found to accumulate along the distal ends of ruffle-ended ameloblasts (RAs)(7) and the cytoplasmic aspect of lateral plasma membranes of secretory and smooth-ended ameloblasts (SAs).(8) Similarly, local increases in extracellular Ca2+ concentrations adjacent to ameloblasts were associated with activation of the protein kinase C signal transduction pathway that may be involved in the early stages of enamel formation.(9) Moreover, the addition of Ca2+ to the medium promoted differentiation of cultured ameloblasts.(3) With the recent cloning of the G protein-coupled extracellular Ca2+-sensing receptor (CaR) in bovine parathyroid,(10) the ability of the ameloblast to respond to alterations in Ca2+ concentration in the surrounding microenvironment raises the possibility that this cell also may express the CaR.

The CaR has been identified in a number of different tissues11-13) including cartilage and bone.(14) In the cartilaginous growth plate, CaR expression follows a distinctive pattern with strong expression in hypertrophic chondrocytes.(14) The hypertrophic chondrocytes participate in the final steps that lead to the mineralization of cartilage as they synthesize and secrete type X collagen into the extracellular matrix and accumulate Ca2+ in their intracellular compartment.(15) Likewise, ameloblasts play an integral role in the secretion of proteins and in the transport of Ca2+ to the extracellular matrix during enamel formation. Most recently, the CaR was found in early secretory ameloblasts in the rat tooth.(16) Thus, expression of the CaR in the developing tooth could define a new regulatory role for Ca2+ in ameloblast differentiation and maturation during enamel development and biomineralization. In these studies, we determined whether the CaR was present in developing porcine molars and in an immortalized ameloblast-like cell line (PABSo-E) and whether alterations in extracellular Ca2+ modulate signal transduction in PABSo-E cells.

MATERIALS AND METHODS

Tooth isolation, fixation, and preparation

Unerupted mandibular molars from approximately 3-month-old pigs, made available through tissue sharing facilities within University of California, San Francisco (UCSF), were dissected from the jaw and then immerse-fixed in 10% neutral buffered formalin. In these pigs, the most posterior unerupted molar (fourth molar) is in the early secretory stage of enamel formation, whereas the more anterior of the two unerupted molars (third molar) is in the late secretory and early maturation stage of enamel formation. After fixation, the teeth were demineralized in 22% formic acid, 10% sodium citrate, dehydrated, embedded in paraffin, and sectioned. In the third molar, the maturation-stage enamel organs were separated from the surface of the mineralized enamel, embedded in paraffin, and sectioned.

Cell culture

PABSo-E cells(17) were grown in Earl's minimum essential media with a balanced salt solution containing 1% L-glutamine, 1% penicillin/streptomycin, and 10% fetal bovine serum (University of California Cell Culture Facility, San Francisco, CA, USA). These cells are SV40 transfected cells from the porcine enamel organ. The cells express ameloblast-specific enamel matrix proteins including amelogenin, matrix metalloproteinase 20 (MMP-20), and enamel matrix serine proteinase 1 (EMSP-1).(17)

Immunohistochemistry

Sections of demineralized teeth or mature tooth organs were deparaffinized, rehydrated, and treated with 3% H2O2 to block endogenous peroxidase activity. Then, the sections were blocked with 2% nonimmune goat serum followed by 0.5% casein and incubated in either preimmune serum or serum containing rabbit anti-CaR peptide antibody. This anti-CaR primary antibody (NPS Pharmaceuticals, Salt Lake City, UT, USA) was raised to a peptide corresponding to the deduced sequence of amino acids 215-237 of the extracellular domain of the bovine parathyroid CaR.(13) The peptide was localized by incubating sections with a biotinylated secondary antibody followed by a horseradish peroxidase conjugate (Vectastain Elite ABC Kit; Vector Laboratories, Burlingame, CA, USA) according to the manufacturer's directions. Slides were viewed using a Nikon Elipse 800 microscope (Melvyl, NY, USA).

Immunofluorescence

Cultured PABSo-E cells were washed three times with phosphate-buffered saline (PBS). The cells were fixed overnight in 2:3 acetone/methanol solution at −20°C. The cells were rehydrated with PBS for 60 minutes. The cells were incubated in either serum containing rabbit anti-CaR peptide antibody (1:100) or preimmune serum (1:100) at room temperature for 1 h. Cells were washed three times with PBS. The cells were incubated with a secondary antibody (goat anti-rabbit immunoglobulin G [IgG] fluorescein isothiocyanate [FITC], 1:40) at room temperature for 30 minutes. The cells were washed three times with PBS and then air-dried and viewed with light microscopy under epifluorescence.

RNA isolation and reverse-transcription polymerase chain reaction

Total RNA was isolated from the PABSo-E cells by first removing media from the culture dishes and replacing the media with 1 ml of stock buffer from a SNAP RNA isolation kit (Invitrogen, Carlsbad, CA, USA). Then, cells were scraped from the dishes with a sterile spatula and RNA was isolated according to the manufacturer's instructions. Equal amounts of RNA were used to convert messenger RNA (mRNA) to complementary DNA (cDNA) using Moloney strain of murine leukemia virus, reverse transcriptase (MML V-RT) with 0.2 mg oligo(dT) as a primer. An aliquot of the resulting cDNA was amplified with 1 U of Thermus aquaticus (Taq) polymerase (Perkin-Elmer Cetus, Norwalk, CT, USA) and primers homologous with human, bovine, and rat CaR sequences. The primers (TTCATCACCTTCAGCATGCTC and CTGGTAACAGTGCTTGCCTCC) were usedto amplify a 778-base pair (bp) fragment of the CaR intracellular domain. Expression of glucose-3-phosphate dehydrogenase (G3PDH), amelogenin, and MMP-20 was confirmed by reverse-transcription polymerase chain reaction (RT-PCR) using primers as previously described.(17)

Northern blot analysis

RNA was separated electrophoretically on 1% agarose glyoxal denaturing gels and then transferred to a Gene Screen Plus membrane (NEN-Du Pont, Wilmington, DE, USA) by capillary blot. The blot was hybridized with32P-labeled rat kidney CaR cDNA (1.2 kilobase [kb] pair PstI-SacI fragment from exon 7 of the rat kidney CaR gene(13)) using a random priming kit (Amersham, Chicago, IL, USA). After hybridization, the blot was washed under stringent conditions and exposed to X-ray film at −70°C for autoradiographic analysis.

Measurements of intracellular Ca2+

Cultured PABSo-E cells were plated at 500 cells/ml on a microscope coverglass (25-mm circle; Fisher Scientific, Pittsburgh, PA, USA) and grown to 70-80% confluence. The cells were changed to LHC-8e (LHC-8 with 0.5 μg/ml epinephrine; Biofluids, Bethesda, MD, USA), a serum-free, low Ca2+ (0.11 mM) media for 24 h. Then, the cells grown on coverslips were incubated with 5 mM Fura-2-AM (Molecular Probes, Eugene, OR, USA) in assay medium (140 mM of NaCl, 5 mM of KCl, 1 mM of MgCl4, 1 mM of CaCl2, 5 mM of glucose, and 20 mM of HEPES/NaOH [pH 7.2]) at room temperature for 1 h.(18) The cells were mounted on a temperature-controlled chamber at 31°C in assay medium. After three immediate washes with assay medium and a 15- to 20-minute acclimation period, responses in intracellular Ca2+ were measured after the addition of fresh media with varying concentrations of Ca2+ or the addition of neomycin in the presence of 1 mM of Ca2+. The final media concentration of Ca2+ ranged from 0 to 5 mM denoted by the bar line across the top of each figure. The “0” mM of Ca2+ medium represented solution without added CaCl2. Fura-2 fluorescence was measured using a Nikon epifluorescence inverted microscope fitted with a rotating holder for excitation filters (340 nm and 380 nm).(18) Signals were digitized using a Labmaster interface board (Scientific Solutions, Solon, OH, USA) and were recorded using the UMANS software package (BioRad, Richmond, CA, USA). To calibrate the fluorescence signals, the ratio of fluorescence at 340/380 nm was compared with ratios obtained at a maximal intracellular Ca2+ concentration achieved by the addition of 10 μm 4BR-A23187 AM (Molecular Probes) and 0 Ca2+ achieved by the addition of 20 mM ethylene glycol-bis(β-amino ethyl ether)-N,N,N′,N′-tetracetic acid (EGTA). Intracellular Ca2+ concentration was calculated using the formula of Grynkiewicz et al.(19)

Statistical analysis

Intracellular Ca2+ concentration measurements are expressed as mean ± SE and were compared by the Student's unpaired t-test. A value of p < 0.05 was considered statistically significant.

RESULTS

Expression of CaR protein in teeth

The CaR was localized by immunohistochemistry at several stages of enamel formation. At the initiation of enamel secretion during the early secretory stage (fourth molar), immunostaining for the CaR was present throughout the ameloblasts and overlying cells (Figs. 1A and 1B). The newly secreted enamel matrix immediately underlying the ameloblasts also stained positively for the CaR. In the late secretory stage (third molar), the ameloblasts no longer stained positively for the CaR, but a distinct layer of cells overlying the ameloblasts stained strongly (Figs. 1D and 1E). The predentin (pD) stained positively for the CaR throughout tooth development but the dentin matrix did not show positive staining (Fig. 1D). Similar sections processed with preimmune IgG showed no staining in all cell layers (Figs. 1C and 1F). Maturation-stage enamel organ (third molar) showed variable staining (Fig. 1G) with the SAs staining positively for the CaR (Fig. 1H) and no apparent immunostaining in the RAs (Fig. 1I). The cell layer was removed from the surface of the highly mineralized maturation enamel and embedded separately; thus, the dentin and pD layers are not seen.

Figure FIG. 1.

Immunohistochemistry on molars of 3-month-old pigs. Staining for CaR protein using an antibody to the extracellular domain in early secretory enamel (A) 10× and (B) 40×, late secretory enamel (D) 4× and (E) 40×, and mature enamel (G) 10×, (H) 40×, and (I) 40×. Negative controls (C and F) using a similar section processed with preimmune IgG. AM, ameloblasts; E, enamel matrix; D, dentin; pD, predentin; SA, smooth-ended ameloblasts; RA, ruffle-ended ameloblasts.

We next determined whether CaR protein was expressed in PABSo-E cells, a cultured cell line that has been shown previously by our laboratory to exhibit characteristics of ameloblast cells.(17) These cells have been shown previously to express extracellular matrix proteins such as amelogenin, MMP-20, and EMSP-1. Using immunofluorescence with the same anti-CaR antibody, we detected the presence of CaR in cultured cells (Fig. 2A). These cells showed the typical plasma membrane localization that has been observed in other cell types previously shown to express the CaR including calcitonin-secreting C cells,(13) bone marrow cells,(20) and growth plate cartilage cells.(14) Similar cultured cells processed with preimmune IgG showed no staining (Fig. 2B).

Figure FIG. 2.

Immunofluorescence in immortalized cultured cells derived from the porcine enamel organ. Staining for CaR protein was performed as described in the Materials and Methods section using an antibody to the extracellular domain of the (A) CaR and (B) preimmune IgG.

Expression of CaR mRNA in PABSo-E cells

RT-PCR analysis of PABSo-E cells with homologous human, bovine, and rat CaR-specific primers showed a single product of the expected size of 778 bp (Fig. 3, lane 5). Predicted products for G3PDH (Fig. 3, lane 2), amelogenin (Fig. 3, lane 3), and MMP-20 (Fig. 3, lane 4) as previously described were similarly seen.(17) Northern blot analysis was carried out using total RNA isolated from PABSo-E cells using a CaR-specific riboprobe corresponding to exon 7 of the rat CaR gene(13) and revealed a single transcript of ∼4.0 kb (Fig. 4, lane 2). A similar size transcript was observed in mRNA isolated from rat kidney (Fig. 4, lane 1).

Figure FIG. 3.

RT-PCR analysis using 5 μg of total RNA from porcine cultured PABSo-E cells was performed as described in Materials and Methods section. Amplified PCR products included G3PDH (452 bp), amelogenin (395 bp), MMP-20 (600 bp), and the CaR (778 bp).

Figure FIG. 4.

Northern blot analysis of CaR mRNA expression. The 10 μg of total RNA from rat kidney (lane 1) and porcine cultured PABSo-E cells (lane 2) was analyzed as described in the Materials and Methods section.

Intracellular Ca2+ measurements

In cells that are known to express the CaR, activation of CaRs elevates intracellular Ca2+ concentration.(21) Therefore, we tested whether the addition of known agonists (Ca2+ or neomycin) of the CaR modulated intracellular Ca2+ concentration in cultured single PABSo-E cells. When the medium concentration of extracellular Ca2+ was increased from 0 mM to either 5.0, 1.5, or 2.5 mM, intracellular Ca2+ concentrations increased above baseline in a dose-related fashion (Fig. 5A). The mean increase in intracellular Ca2+ was 398 ± 39 nM when the medium Ca2+ concentration was changed from 0 to 1.5 mM, 534 ± 69 nM when changed from 0 to 2.5 mM, and 838 ± 86 nM when changed from 0 to 5.0 mM. In most cells, high medium Ca2+ induced a rapid (within seconds) and transient peak increase (duration <60 s) in intracellular Ca2+ concentration. In a small percentage of cells, high extracellular Ca2+ in the medium induced a rapid peak followed by a smaller sustained increase above baseline (duration >5 minutes; Fig. 5B). When neomycin (300 nM) was added to the medium in the presence of 1 mM Ca2+ concentration, intracellular Ca2+ increased to 927 ± 121 nM from baseline (Fig. 5C).

Figure FIG. 5.

Effect of medium (extracellular) Ca2+ and neomycin on intracellular Ca2+ measurements in cultured PABSo-E cells as described in the Materials and Methods section. (A) Intracellular Ca2+ responses to changes in extracellular Ca2+ from 0 to 5.0 mM. (B) A prolonged intracellular Ca2+ response to changes in extracellular Ca2+ (5.0 mM). (C) Intracellular Ca2+ response to the addition of 300 nM neomycin in the presence of 1 mM Ca2+. Medium Ca2+ concentration was varied between 0 mM (——) and 5 mM of Ca2+ ([solid 2 pt. rule]). Tracings shown are representative of at least three to five independent experiments (*p < 0.05, for 5 mM vs. 1.5 mM or 2.5 mM and 1.5 mM vs. 2.5 mM).

DISCUSSION

Mature enamel is the most highly mineralized tissue in the body.(1) During tooth development, enamel formation requires the deposition of Ca2+ into the extracellular matrix to form a mineralized structure.(22) Enamel formation is under the complete cellular control of a highly specialized multifunctional cell (the ameloblast).(1, 2) In the developing enamel organ, the inner enamel epithelium differentiates first into presecretory ameloblasts and then secretory ameloblasts and, ultimately, into mature ameloblasts.(1, 2) The secretory ameloblast is involved both in the synthesis, secretion, and resorption of enamel proteins and in the active transport of Ca2+ into the extracellular matrix.(1) During the maturation process, ameloblast cells change their morphology in an alternating pattern from RAs and SAs. These mature ameloblasts act as regulatory and transporting cells and function to modulate the latter stages of the mineralization process.(2)

The cellular mechanisms that regulate the enamel maturation process are complex and poorly understood. Recent studies have shown that hypocalcemia either dietary-induced(23, 24) or experimentally induced(25) can cause enamel hypoplasia. Similarly, in vitro studies by Kukita and coworkers found that primary cultured rat ameloblasts responded to high concentrations of Ca2+ in the medium by changing their morphology.(3) Because ameloblasts express a Ca2+-ATPase pump(26, 27) and Ca2+-binding proteins (calbindin D9k and calbindin D28k),(6) one potential mechanism by which ameloblasts may regulate the enamel maturation process could be through the control of Ca2+ transport through ameloblasts into the matrix. Bawden and coworkers suggested that a second potential mechanism may be that ameloblasts could regulate enamel maturation by responding to localized changes in extracellular Ca2+ concentration.(9) In 5-day-old rat pups, Bawden et al. showed that there was an increase in the Ca2+ concentration in the area of ameloblasts before the beginning of enamel matrix deposition suggesting that extracellular Ca2+ may be a key inducer in the early stages of enamel formation.(9) This later observation raises the possibility that extracellular Ca2+ may regulate ameloblast function through the plasma membrane-bound CaR.

In this study, we have shown CaR expression in several cell types within the developing tooth organ. Using immunohistochemistry, we showed that CaR was expressed in ameloblasts in the early secretory stage. This finding is similar to the observations by Moran et al. who identified expression of the CaR in early secretory ameloblasts in 5-day-old rat pup molars.(16) During the secretory stage of enamel formation, matrix proteins are secreted and the matrix begins to mineralize. Thus, the expression of the CaR in ameloblasts suggests that extracellular Ca2+ may have a role in modulating the function of early secretory ameloblasts. This would be analogous to the potential role of the CaR in hypertrophic chondrocytes, in which extracellular Ca2+ modulates intracellular Ca2+,(28) and type X collagen, a matrix protein that plays an important role in cartilage mineralization and new bone formation.(29)

In contrast to the study by Moran et al. who specifically investigated CaR expression during the early secretory phase,(16) we determined whether the CaR was expressed throughout tooth development. In fact, in our study of the late secretory stage, CaR expression in the ameloblast was lost but was strongly expressed in a distinct cell layer within the stellate reticulum, which overlies the ameloblasts. This cell layer appears after secretion of the full width of the secretory matrix has occurred. The function of this layer of cells is unknown and further studies will be required to determine their role in tooth formation.

In the maturation stage, our study showed that CaR expression was identified in SAs but not RAs of porcine molars. In the maturation stage, ameloblasts change their morphology and function from secretory to regulatory and transporting cells as they alternate between an SA and an RA.(2, 30) The factors responsible for ameloblast modulation in the maturation stage are unknown. Given the localization of the CaR on the SAs but not RAs, it is possible that extracellular Ca2+ also will participate in the process by which ameloblasts alternate between RA and SA morphologies.

In immortalized ameloblasts with characteristics of early maturation ameloblasts,(17) CaR RNA and protein also were shown to be expressed. The localization of the CaR along the plasma membrane in these immortalized ameloblasts is similar to that observed in other cell types that express the CaR.(13, 14, 20) In addition, our studies with these cultured cells revealed patterns of intracellular Ca2+ response to increments in extracellular Ca2+ that were analogous to CaR-mediated Ca2+ mobilization in other systems.

In our study, the CaR also was expressed in the pD layer throughout tooth development. Dentin formation is modulated by odontoblasts and occurs by two simultaneous processes, the formation of pD and its subsequent mineralization.(31) The pD is a thin layer of unmineralized and acellular organic matrix, primarily collagenous in nature, that is between the odontoblasts and the mineralizing dentin tissue. Generally, the pD is considered to have a function as a template and to have a mineralization regulatory capacity. Odontoblasts secrete matrix proteins and have processes that penetrate the pD and dentin.(32)

The mechanisms that regulate dentin formation are poorly understood. Although Ca2+ is a major constituent of the dentin mineral, there are some studies to suggest that Ca2+ may regulate dentin formation. For example, in rats exposed to dietary-induced hypocalcemia, the uncalcified matrix formed by odontoblasts was reduced, which was associated with severe disruption of dentin mineralization and dentin matrices.(33) Moreover, increased levels of extracellular Ca2+ were noted in the rat incisor pD area(34, 35) and along the dentin mineralization front.(34) Taken together, these findings suggest that the localization of the CaR to the pD region and the local accumulation of extracellular Ca2+ may provide a mechanism by which Ca2+ can modulate odontoblast function and, ultimately, dentin mineralization. Further studies will need to be performed to further study the role of the CaR in dentin formation.

In conclusion, this study provides additional evidence for the expression of the CaR in the developing tooth. The variable presence of the CaR at different stages of tooth formation suggests that extracellular Ca2+ may play an important role in tooth maturation. The presence of the CaR in the ameloblast and potentially other cell types within the tooth organ adds to the lists of cells that express the CaR, which are involved in the formation of mineralizing matrix: chondrocytes,(14) osteoblasts,(36) and osteocytes.(14) Further studies will be needed to determine the role of the CaR in teeth and whether Ca2+ regulates matrix protein formation.

Acknowledgements

This work was supported by the UCSF Research Evaluation and Allocation Committee (REAC) Cox Fund (R.S.M.); the National Kidney Foundation of Northern California (R.S.M. and C.H.E.M.); the National Institutes of Health (NIH) grant MO1RRO1271, Pediatric Clinical Research Center (R.S.M.); and UCSF Academic Senate (P.K.D.).

Ancillary