SEARCH

SEARCH BY CITATION

Keywords:

  • replicative senescence;
  • osteoporosis;
  • telomerase reverse transcriptase;
  • population doubling;
  • osteoblast

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. REFERENCES

The rate of bone formation is largely determined by the number of osteoblasts, which in turn is determined by the rate of replication of progenitors and the life span of mature cells, reflecting the timing of death by apoptosis. However, the exact age-dependent changes of the cellular activity, replicative potential, and life span of osteoblasts have not been investigated to date. Here, we present evidence that the cellular activity, telomere lengths, and replicative life span of osteoblastic cells obtained from juxta-articular bone marrow gradually decrease with the advance of donor age. Recently, telomerase reverse transcriptase (hTERT) has been identified as a human telomerase catalytic subunit. We transfected the gene encoding hTERT into telomerase-negative human osteoblastic cells from donors and osteoblastic cell strain NHOst 54881 cells and showed that expression of hTERT induces telomerase activity in these osteoblastic cells. In contrast to telomerase-negative control cells, which exhibited telomere shortening and senescence after 10-15 population doublings, telomerase-expressing osteoblastic cells had elongated telomere lengths and showed continued alkaline phosphatase activity and procollagen I C-terminal propeptide (PICP) secretion for more than 30 population doublings. These results indicate that osteoblasts with forced expression of hTERT may be used in cell-based therapies such as ex vivo gene therapy, tissue engineering, and transplantation of osteoblasts to correct bone loss or osteopenia in age-related osteoporotic diseases.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. REFERENCES

NORMAL SOMATIC cells undergo a finite number of cumulative cell divisions and then enter a nondividing state called replicative senescence.(1–3) Several normal human cells cultured from old donors such as skin fibroblasts and peripheral blood lymphocytes tend to senesce after fewer population doublings than cells from younger donors.(4–7) Furthermore, cells from humans with hereditary premature aging syndromes senesce more rapidly than age-matched controls.(8–10) These findings suggest that cellular replicative senescence is implicated in aging and age-related pathologies.

Telomeres, the terminal guanine-rich sequences of chromosomes, are structures that function in the stabilization of the chromosome during replication by protecting the chromosome end against exonucleases.(11) Telomeres are reduced in length during each cell division.(12) The gradual decrease in telomere length may function as a timing mechanism that, when reaching a critical length, signals a cell to stop dividing and to enter cellular senescence.(13–15) A clear correlation is seen between replicative capacity and the initial telomere length in normal somatic cells.(12, 16) Human telomeres, which consist of repeats of the sequence TTAGGG at the chromosome ends, are elongated by the ribonucleoprotein enzyme telomerase.(17, 18) Telomerase is preferentially expressed in germline cells, immortalized cells, and in most tumor cells.(18, 19) Thus, in these cells, telomerase apparently balances the telomere loss with de novo synthesis of telomeric DNA. In contrast, telomerase is not expressed in most human somatic cells, and the cells become senescent when progressive telomere shortening during each cell division reaches a threshold telomere length.(20–22) Cells in regenerative tissues such as skin and bone also could decrease their telomere length and replicative capacity with aging, because their progenitors also divide and decrease their telomere length throughout the life span of cells. Thus, during aging, the cumulative numbers of senescent progenitor or mature cells in renewable tissue may contribute to disorders in tissue repair or remodeling, resulting in organismic senescence.

Telomerase uses an RNA template that exists as a subunit of the telomerase holoenzyme. Recently, three components, human telomerase reverse transcriptase (hTERT),(23–27) the human telomerase RNA (hTR) component,(28) and the human telomerase-associated protein (hTP1),(29) have been identified that are associated with telomerase activity.(30–32) hTERT has been found to be expressed in a majority of cancer cells but not in normal somatic cells regardless of hTR and hTP1 expression. hTERT is activated when transformed cells overcome crisis and become telomerase positive.(24) These findings suggest that hTERT plays a key role in the activation of telomerase expression. More recently, it has been established that the transient expression of hTERT, using hTERT complementary DNA (cDNA), induces telomerase activity and expands the cellular life span of normal human somatic cells, skin fibroblasts, and retinal pigment epithelial cells.(3, 30, 31) The ability to extend the cellular life span may have important implications in biological research and in the development of novel therapeutic strategies against age-related diseases.

With advancing age, a progressive and age-dependent bone loss can be observed in patients with systemic or localized bone diseases.(33–35) This bone loss may be caused by, at least in part, a reduced bone mass that most likely results from inadequate bone formation by osteoblasts.(36–38) The rate of bone formation is largely determined by the number of osteoblasts, which in turn is determined by the rate of replication of progenitors and the life span of mature cells.(39–43) Changes in either the replicative potential or the life span of osteoblasts may alter the rate of bone formation. However, the exact age-related changes in the cellular activity and the replicative life span of osteoblasts have not been investigated to date.

Based on the properties of cellular senescence mentioned previously, we postulate that an expansion of the life span of osteoblasts and their maintenance as differentiated bone matrix-producing cells may allow for autologous or allogenic cell and gene therapy in bone and joint diseases including osteoporosis. Here, we examine the age-related changes in the cellular activity, replicative potential, and the life span of osteoblasts isolated from periarticular bone fragments of adult donors. Furthermore, to clarify our hypothesis, we transfected human osteoblasts with a vector expressing hTERT cDNA, and investigated whether the replicative life span can be expanded by the introduction of telomerase in human osteoblasts.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. REFERENCES

Cells and cell culture

After obtaining informed consent from donors, bone samples were obtained from juxta-articular bone marrow in 18 patients with osteoarthritis (OA; 6 males and 12 females; age range, 46-72 years; mean age ± SD, 61.9 ± 9.8 years) who underwent arthroplastic knee surgery. These subjects had no clinical symptoms or history of bone metabolic disorders. To avoid the influence of steroid-induced osteoporosis, the patients who had previously taken prednisolone or intra-articular injection therapy of corticosteroid were excluded. In addition, the patients receiving therapy against osteoporosis also were excluded. Osteoblastic cells were isolated from the outgrowths of juxta-articular bone samples, as described previously.(42–44) In brief, each bone sample was minced into 1 mm3 pieces and washed extensively with phosphate-buffered saline (PBS) to remove adherent bone marrow cells. The fragments were seeded onto culture dishes (60-mm dish; Becton Dickinson Labware, Franklin Lakes, NJ, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco BRL, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS), 100 U/ml of penicillin, and 100 μg/ml of streptomycin in a humidified atmosphere supplemented with 5% CO2. Osteoblastic cells were isolated further by immunomagnetic sorting using biotin-labeled antiparathyroid hormone (anti-PTH) receptor antibody and antibiotin magnetic beads according to the manufacturer's instructions (Milteny Biotec GmbH, Bergisch Gladbach, Germany). Anti-PTH receptor antibody was purchased from Funakoshi Co. (Tokyo, Japan). Culture medium was changed twice weekly until subconfluence (3-4 weeks). Subconfluent cells were washed with PBS and detached with 0.5 ml of 10% trypsin in PBS. Eighteen osteoblastic cell populations were obtained from the bone fragments of the 18 patients with OA. In parallel cultures, we examined the expression using these cells of various osteoblastic features such as alkaline phosphatase (ALP) activity, procollagen I C-terminal propeptide (PICP), osteocalcin secretion, and PTH-stimulated cyclic adenosine monophosphate (cAMP) production.

The human osteoblastic cell strain NHOst 54881 (provided by BioWhittaker, Inc., Walkersville, MD, USA) was cultured in DMEM supplemented with 10% FBS.

ALP activity, osteocalcin, PICP secretion, and cAMP response to PTH of human osteoblasts

ALP activity was determined in six different dishes (60-mm dish) derived from each culture after extraction with 0.1% Triton X-100 by hydrolysis of p-nitrophenyl-phosphatase phosphate to p-nitrophenol, as described previously.(45)p-Nitrophenol was measured spectroscopically at 410 nm using an EAR 400 multiwell spectrophotometer (SLT Labinstruments, Salzburg, Austria). Results are expressed as nanomoles per minute (U) per mg of cell protein (U/mg protein). To visualize ALP activity in individual cells, cells were fixed in 0.02% glutaraldehyde and incubated with naphthol AS-BI phosphate and a diazonium salt (Sigma, St. Louis, MO, USA). The stained cells were fixed in cold ethanol and counted.

Osteocalcin, released into the culture medium over a 48-h incubation period, was measured in triplicate dishes (60-mm dish) from each culture by a specific radioimmunoassay (Nichols, San Juan Capistrano, CA, USA) using specific antibodies against human intact osteocalcin.(42) The secretion of osteocalcin was expressed as nanograms per milligrams of cell protein.

PICP levels were considered to be an index of osteoblastic bone matrix formation in vitro. PICP in the cell-conditioned medium (n = 6) was measured using an ELISA (Metra Biosystems, Mountain View, CA, USA).

Cells, in triplicate dishes (60-mm dish) from each culture, were stimulated for 20 minutes with 10−7 M PTH, and cAMP was measured after trichloracetic acid precipitation of the cell extracts using a competitive protein binding assay, as described previously.(46) Results are expressed as picomoles of cAMP per milligrams of cell protein.

Cells for each assay were provided from primary cultures that first reached subconfluence after the preparation of osteoblastic cells.

Transfection of osteoblasts with hTERT cDNA-expressing plasmid

The full-length cDNA encoding hTERT was kindly provided by Dr. F. Ishikawa (Tokyo Institute of Technology Graduate School of Bioscience and Biotechnology, Tokyo, Japan).(27) The full-length cDNA encoding hTERT was subcloned into the mammalian expression vector pcDNA3 (Invitrogen Co., Carlsbad, CA, USA). Subconfluent osteoblastic cells were transfected with either the hTERT cDNA-expressing plasmid or the control plasmid that contains only a bacterial neomycin-resistant gene. Each plasmid preparation (5 μg) was added to 10 μg of lipofectin (Gibco BRL). The plasmid preparation and lipofection were added to the cells, and the cells were incubated for 2 days. The cells were washed with DMEM without serum, and the cells were suspended in DMEM containing 10% FBS and G418 sulfate (600 μg/ml, Gibco BRL), an analog of neomycin, and were seeded into 60-mm culture dishes. Then, the cells were cultured for 2 weeks to select for stably transfected cells expressing neomycin resistance. Culture medium with G418 was changed twice weekly. Transfected cells were maintained into DMEM with 10% FBS. Transfection efficiencies were measured using the control plasmid pGreen Lantern-1 (Gibco BRL).

To investigate whether the cells after hTERT or mock transfection lose characteristics of osteoblasts, hTERT-transfected cells and mock-transfected cells were examined by ALP staining after the cells were transfected with the hTERT-expressing plasmid or with control plasmid and after they reached senescence or near senescence.

Determination of the population doubling time of human osteoblastic cells

Osteoblastic cells were provided from primary cultures that first reached subconfluence after the osteoblastic cell preparation from donor bone samples. Subconfluent cells were washed with PBS and detached with 0.5 ml of 10% trypsin in PBS. The detached cells were suspended in DMEM with 10% FBS, counted, and seeded at the appropriate density (1.0 × 104 cells/dish) into 60-mm dishes. The culture medium was changed every 2 days. The number of cells per dish was determined in triplicate cultures by a direct count under a dissecting microscope every 24 h for a period of 14 days. The population doubling times were derived from growth curves that were fit to the experimental data by the least squares method.(47)

Determination of the life span of human osteoblastic cells

Osteoblastic cells from donors were provided from primary cultures that first reached subconfluence after the preparation of osteoblastic cells. The cells from donors were subcultured weekly. At each subculturing, the total number of cells in the dish (60-mm culture dish) was determined, and 2.5 × 105 cells were transferred to a new dish. The number of cells that had attached 6 h after seeding was determined. The increase in cumulative population doublings at each subculture was calculated based on the number of cells attached and the cell yield at the time of the next subcultivation. Cellular senescence was defined as less than one population doubling in 4 weeks. The in vitro life span (remaining replicative capacity) was expressed as population doublings up to cellular senescence.(3, 47)

For determination of the life span of osteoblastic cells that were transfected with either the hTERT-expressing plasmid or with control plasmid, the cells were provided from cultures that first reached subconfluence after the 2-week selection in G418 containing medium.

Expression of hTERT, hTR, and TP1 in human osteoblastic cells

Reverse-transcription polymerase chain reaction (RT-PCR) for hTERT, hTR, TP1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; to normalize for equal amounts of RNA template) was performed using RNA derived from donor osteoblastic cells and from NHOst 54881 cells that were transfected with either hTERT-expressing plasmid or control plasmid.(27) Cell extract for each assay was isolated from primary cultures that first reached subconfluence after the selection in G418 containing medium. RT-PCR was performed with total RNA (1.0 μg) using the GeneAmp Ez rTth RNA PCR kit (Perkin-Elmer Co., Norwalk, CT, USA). hTERT messenger RNA (mRNA) was amplified using oligonucleotide primers LT5 (CGGAAGAGTGTCTGGAGCAA) and LT6 (GGATG-AAGCGG-AGTCTGGA) for 31 cycles (94°C for 45 s, 60°C for 45 s, and 72°C for 90 s). hTR mRNA was amplified using primers F3b (TCTAACCCTAACTGAGAA-GGGCGTAG) and R3c (GTTTGCTCTAGAATGAA-CGGTGGAAG) for 22 cycles (94°C for 45 s, 55°C for 45 s, and 72°C for 90 s). hTP1 mRNA was amplified using primers TP1.1 (TCAAGCCAAACCTGAATCTGAG) and TP1.2 (CCCGAGTGAATCTTTCTACGC) for 28 cycles (94°C for 45 s, 60°C for 45 s, and 72°C for 90 s). GAPDH mRNA was amplified using primers K136 (CTCAGACACCATGGGGAAGGTGA) and K137 (ATGATCTTGA-GGCTGTTGT-CATA) for 16 cycles (94°C for 45 s, 55°C for 45 s, and 72°C for 90 s). The amplified products were fractionated on either a 6% nondenaturing polyacrylamide gel (hTR and TP1) or a 2% agarose gel (hTERT and GAPDH). Gels were stained with SYBR Green I (Molecular Probes, Eugene, OR, USA) and analyzed using a fluorescence imaging analyzer.

Telomerase assay

Osteoblastic cells were treated with ice-cold hypotonic detergent lysis buffer (106 cells/100 μl: 0.5% 3[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate; Sigma), incubated on ice for 30 minutes, and centrifuged at 12,000g for 20 minutes at 4°C. The supernatant was stored at −80°C. Cellular telomerase activity was measured by the telomeric repeat amplification protocol (TRAP) according to the manufacturer's instructions (Intergen Co., Gaithersburg, MD, USA).(19) The PCR product was electrophoresed on a 15% polyacrylamide nondenaturing gel. A cell extract was considered negative if no ladder was detectable after a 10-h exposure. The telomerase-positive extracts were given a relative value of activity as a percent of the reference cell line (293, a transformed human kidney cell line), based on the mean value of two separate runs with two different exposures.

For determination of telomerase activity in osteoblasts from donors and NHOst 54881 cells that were transfected with either the hTERT cDNA-expressing plasmid or the control plasmid, cell extract was isolated from primary cultures that first reached subconfluence after the selection in G418 containing medium.

Telomere restriction fragment assay

Telomere length was determined by terminal restriction fragment (TRF) Southern blot analysis as described previously.(3, 12) Genomic DNA from donor osteoblastic cells was digested with 400 ml of DNA extraction buffer (100 mM NaCl, 40 mm Tris [pH 8.0], 20 mm EDTA [pH 8.0], and 0.5% sodium dodecyl sulfate [SDS]) and proteinase K (0.1 mg/ml). Cells were provided from primary cultures that first reached subconfluence after the preparation of osteoblastic cells. Extraction was performed using phenol-chloroform. Extracted DNA (5-10 μg) was digested with 10 U of MspI and RsaI (Boehringer Mannheim, Indianapolis, IN, USA) for 12-24 h at 37°C. The integrity of the DNA before digestion and the completeness of digestion were monitored by gel electrophoresis. Electrophoresis of digested genomic DNA was performed in 0.5% agarose gels in 45 mM Tris-borate EDTA buffer (pH 8.0) for a total of 660-700 V/h. After electrophoresis, gels were depurinated in 0.2N HCL, denatured in 0.5 M NaOH and 1.5 M NaCl, transferred to a nylon membrane using 20× SSC, and dried for 1 h at 70°C. The telomeric probe (TTAGGG)(3) (Genset, La Jolla, CA, USA) was 5′ end-labeled with [α-32P]adenosine triphosphate (ATP) using T4 PNK (Boehringer Mannheim). Prehybridization and hybridization were performed at 50°C using 5× Denhardt's solution, 5× SSC/0.1 M Na2HPO4/0.01 M Na4P2O7, and 30 μg salmon sperm DNA/ml per 0.1 mM ATP. The mean TRF length was determined from densitometric analysis of autoradiograms as described.(12)

For determination of the telomere length of osteoblastic cells that were transfected with either the hTERT-expressing plasmid or the control plasmid, the cells were provided from cultures that first reached subconfluence after the 2-week selection in G418 containing medium.

Statistical analysis

Results were expressed by a mean value ± SD. Comparison of the means was performed by analysis of variance (ANOVA). Correlation coefficients were determined by Spearman's rank correlation test. Analysis resulting in p < 0.05 was considered statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. REFERENCES

Characteristics of human osteoblastic cells in vitro

PTH receptor-expressing cells were isolated from bone-derived cells using anti-PTH receptor antibody and micromagnetic beads. In primary cultures, spindle-shaped cells (Fig. 1A) were observed and a majority of the cells (>90%) were ALP-positive (Fig. 1B). These cells responded to PTH with an increase in cAMP (Fig. 1C). The cells synthesized osteocalcin and 1,25-dihydroxyvitamin D3 [1,25(OH)2D3; 10 nM and 50 nM] increased osteocalcin in the osteoblastic cell culture (Fig. 1D). These results show that osteoblasts were the primary cell type found in our bone-derived cell cultures from donors.

thumbnail image

Figure FIG. 1.. Characterization of osteoblastic cells from representative donor. (A) Spindle-shaped cells were obtained from bone fragments after 3-6 weeks of incubation. PTH receptor-expressing cells were isolated from bone-derived cells by immunomagnetic sorting using anti-PTH receptor antibody and magnetic beads. The cells were photographed under bright-field illumination (original magnification ×200). (B) ALP activity in individual cells were visualized with immunofluorescence staining (original magnification ×200). (C) Cells were seeded at 104 cells/dish. cAMP response to PTH and osteocalcin secretion was determined 3 days after seeding. To determine cAMP response to PTH of osteoblastic cells, cells were stimulated for 20 minutes with 5 × 10−7 M PTH. cAMP was measured after TCA precipitation of the cell extracts using a competitive protein binding assay. Data are the mean ± SD. (D) Osteocalcin secretion was measured with the indicated concentration of 1,25(OH)2D3 in 48-h condition medium by ELISA. Data are the mean ± SD.

Download figure to PowerPoint

Age-related changes in the cell proliferation, ALP activity, and the secretion of osteocalcin and PICP of osteoblastic cells from donors

In primary osteoblastic cell cultures derived from patients with OA, the population doubling time of the cells increased with donor age. Osteoblastic cells from older donors showed a longer population doubling time (lower proliferation rate) than cells derived from younger donors. A significant correlation was found between the population doubling time and donor age (Fig. 2A; r = −0.58; p = 0.039).

thumbnail image

Figure FIG. 2.. Differences in cell proliferation and the expression of various osteoblast markers dependent on donor age. (A) Population doubling time, (B) ALP activity, (C) osteocalcin, and (D) PICP secretion in primary cultures of osteoblastic cells were shown as a function of donor age. Cell proliferation rate and the levels of osteoblastic markers in osteoblastic cells decreased with age of donor.

Download figure to PowerPoint

The ALP activity and the secretion of osteocalcin and PICP of human osteoblastic cells in primary cultures decreased with donor age. Clear reciprocal correlations were observed between donor age and ALP activity (Fig. 2B; r = −0.69; p = 0.021), between donor age and osteocalcin secretion (Fig. 2C; r = −0.63; p = 0.035), and between donor age and PICP secretion (Fig. 2D; r = 0.72; p = 0.018).

Age-related changes in the initial telomere length and replicative life span of osteoblastic cells from donors

The mean initial telomere length of the osteoblastic cells in primary cultures decreased gradually with donor age at a rate of 134 ± 39 base pairs (bp)/year in patients with OA (Figs. 3A and 3B). There was an inverse correlation between mean initial telomere length in the primary culture and donor age (Fig. 3B; r = −0.64; p = 0.031). The mean in vitro remaining life span of human osteoblastic cells in primary cultures decreased gradually in relation to donor age, with values of r = −0.66 (Fig. 3C; p = 0.027). The in vitro remaining life span correlated with the initial telomere length of osteoblastic cells (Fig. 3D; r = 0.68; p = 0.022).

thumbnail image

Figure FIG. 3.. Differences in telomere length and the remaining life span of osteoblasts according to donor ages. (A) Representative TRAP lengths of DNA from osteoblastic cells obtained from donors. The (B) mean telomere length and (C) remaining life span in primary osteoblastic cells decreased with donor aging. (D) The remaining life span of osteoblastic cells was significantly correlated with the initial telomere length. Cells for each assay were provided from primary cultures that first reached senescence after the preparation of osteoblastic cells.

Download figure to PowerPoint

Telomerase, hTERT, hTR, and TP1 expression in human osteoblastic cells

During passaging, human osteoblastic cells from all patients studied and human osteoblastic NHOst 54881 cells did not express telomerase activity and hTERT, whereas they did express hTR and TP1 (data not shown). Positive control 293 cells expressed strong telomerase activity and hTERT (Fig. 4). Telomerase activity was found to correlate with TERT expression but not with hTR or TP1 expression in human osteoblastic cells (Fig. 4).

thumbnail image

Figure FIG. 4.. Telomerase, hTERT, hTR, and TP1 expression in human osteoblastic cells obtained by transfection with a vector expressing the hTERT cDNA. Telomerase activity, hTERT, hTR, and TP1 expression in representative osteoblastic cell populations from patients with OA (61 years old). “PD 4” represents population doublings at the time of transfection. The human osteoblastic cells did not express telomerase activity and hTERT, whereas they did express hTR and TP1. Telomerase activity was associated with TERT expression but not with hTR or TP1 expression in human osteoblastic cells. The expression of hTERT was undetectable in the mock-transfected cells, but telomerase activity and hTERT were expressed in hTERT-transfected osteoblastic cells. Positive control was the telomerase activity extracted from 293 cells. The RT-PCR for hTERT, hTR, and TP1 were performed with equal amounts of RNA for three components of telomerase.

Download figure to PowerPoint

The expression of hTERT was not detected in the mock-transfected cells, but similar levels of hTERT were detected in both hTERT-transfected osteoblastic cells from donors and hTERT-transfected NHOst 54881 cells. Transfection efficiencies were approximately 10-30%. Significant levels of telomerase activity were observed in 14 of the 18 resultant stable hTERT-transfected osteoblastic cell populations from 18 donors and in 20 of the 48 resultant stable hTERT-transfected NHOst 54881 cell populations but not in mock-transfected osteoblastic cell populations (Fig. 5). Telomerase activity in these hTERT-positive cells ranged from 15% to 55% of that observed in the 293 cells that expressed strong telomerase activity and hTERT.

thumbnail image

Figure FIG. 5.. Effect of hTERT transfection on telomerase expression in human osteoblastic cells. Representative telomerase activity in hTERT- or mock-transfected osteoblastic cells. (A) Telomerase activity in hTERT-transfected osteoblastic cells from donor (65 years old) and mock-transfected NHOst 54881cells; (B) the enzyme activity in hTERT-transfected osteoblastic cells from donor (68 years old) and mock-transfected NHOst 54881cells; (C) the enzyme activity in hTERT-transfected NHOst 54881 cells and mock-transfected osteoblastic cells from donor (65 years old). Significant levels of telomerase activity were observed in 14 of the 18 resultant stable hTERT-transfected osteoblastic cell cultures from 18 donors and in 20 of the 48 resultant stable hTERT-transfected NHOst 54881cell populations but not in mock-transfected osteoblastic cell populations.

Download figure to PowerPoint

Telomere length in hTERT-transfected osteoblastic cells

To determine if the hTERT-reconstituted telomerase acts on its normal chromosomal substrate, telomere lengths were measured. Telomeres in the hTERT-positive control 293 cells did not shorten during continuous cultures for more than 30 population doublings (Fig. 6A). In human osteoblastic cells from OA patients, telomere lengths in the hTERT-negative cell populations that were transfected with the control plasmid decreased gradually at a rate of 110 ± 45 bp per population doubling, whereas telomeres in the hTERT-positive osteoblastic cell populations that were transfected with hTERT cDNA-expressing plasmid did not shorten during continuous culture for more than 15 population doublings (Figs. 6A and 6B). Similarly, telomere lengths in the hTERT-negative NHOst 54881 cell populations decreased gradually with advancing population doublings, whereas telomeres in the hTERT-transfected NHOst 54881 cell populations did not shorten, comparable with the shortening seen in the hTERT-negative cultures at equivalent population doublings (Fig. 6C).

thumbnail image

Figure FIG. 6.. Effect of hTERT transfection on telomere length in human osteoblastic cells. (A) Representative telomere length in hTERT- or mock-transfected osteoblastic cells. Telomeres in the hTERT-positive control 293 cells did not shorten during continuous culture for more than 30 population doublings. Telomere lengths in the hTERT-negative cells that were transfected with the control plasmid decreased gradually with population doubling, whereas telomeres in the hTERT-positive osteoblastic cells transfected with hTERT cDNA-expressing plasmid did not shorten during the population doublings. (B) Mean telomere length at the indicated population doublings of the hTERT-positive osteoblastic cell populations (closed circle) and hTERT-negative osteoblastic cell populations (open circle) osteoblastic cells from donor. (C) Mean telomere length at the indicated population doublings of the hTERT-positive and hTERT-negative NHOst 54881 cells. The gray horizontal bar represents the mean telomere length of the cell population at the time of transfection.

Download figure to PowerPoint

Replicative life span and osteoblastic activity in hTERT-transfected cells

To investigate the effect of telomerase expression on the life span and cellular activity of human osteoblastic cells, we compared the life span and osteoblastic activity of hTERT-positive and hTERT-negative cells. In human osteoblastic cell cultures from OA patients, hTERT-positive cell populations that were transfected with hTERT cDNA-expressing plasmid exceeded the mean life span of hTERT-negative cell populations and continued to divide at the rate observed by young osteoblastic cells (Fig. 7A). Similarly, most of the hTERT-negative NHOst 54881 cell populations senesced after 10-20 population doublings, whereas the hTERT-transfected NHOst 54881 cell populations continued to divide beyond the average life span of the hTERT-negative NHOst 54881 cell populations (Fig. 7B).

thumbnail image

Figure FIG. 7.. Effect of hTERT transfection on cellular life span in osteoblastic cells. The proliferative status of each hTERT-negative and hTERT-positive cell population is shown; (A) human osteoblastic cells from donors; (B) NHOst 54881 cells. Open circles represent senescent cells (dividing less than once per 4 weeks). Open triangles correspond to cells near senescence (dividing less than once per 2 weeks). Closed circles represent cells dividing more than once per week. Most of the hTERT-negative osteoblastic cells senesced, whereas the hTERT-transfected osteoblastic cells exceeded the maximal life span of the hTERT-negative osteoblastic cells and continued to divide.

Download figure to PowerPoint

In both human osteoblastic cell cultures from donors and NHOst 54881, the ALP activity and PICP secretion of hTERT-negative cell populations decreased gradually with population doubling, whereas the hTERT-positive cell populations maintained ALP activity and PICP secretion for more than 30 population doublings (Fig. 8).

thumbnail image

Figure FIG. 8.. Effect of hTERT transfection on the ALP activity and PICP secretion in osteoblastic cells. The ALP activity and PICP secretion in (A) hTERT-negative osteoblastic cell populations from donors and (B) hTERT-negative NHOst 54881 cell populations decreased with population doublings, whereas the hTERT-positive cell populations maintained ALP activity and PICP secretion for more than 30 population doublings. Closed circle represents hTERT-positive cell populations. Open square corresponds to hTERT-negative cell populations. *The mean ALP activity and PICP secretion of senescent hTERT-negative cell populations (dividing less than once per 4 weeks).

Download figure to PowerPoint

To analyze whether the cells after the hTERT or mock transfection lose characteristics of osteoblasts, the cells were examined by ALP staining after the transfection and at the time when they reached senescence or are near senescent. At each examination, a majority of the cells showed ALP-positive staining (data not shown).

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. REFERENCES

Results presented in this report show that osteoblast replicative senescence in the periarticular bone is dependent on aging in patients with OA. Aging is known to be associated with various declines in osteoblast features, such as cell growth, the mitogenic responsiveness to hormones and growth factors, and the secretion of osteoblastic markers.(35–39) Our data also indicate that the secretion of bone matrix proteins and PTH-inducible cAMP formation in osteoblasts from periarticular bones in patients with OA decrease gradually with the advance of donor age. Previous results have shown that age-related bone loss is associated with a decreased number of active osteoblasts, which, in turn, is determined by the rate of replication of osteoblast progenitors, the life span of mature cells, and the timing of death by apoptosis.(36–38, (40, 43) Our findings suggest that senescent osteoblasts accumulate with aging and contribute to age-related bone loss in periarticular bones by arthritis.

This study shows that the telomere length and the in vitro remaining life span of osteoblasts from periarticular bone decrease gradually with advancing age in donors with OA. Moreover, the cell replicative life span is proportional to the initial telomere length in osteoblastic cells. In contrast, telomere length is stable during cell division in immortal cell lines, germline cells, and malignant tumor cells, suggesting that a regulatory mechanism exists for limiting telomere elongation by telomerase, which catalyzes the synthesis and extension of telomeric DNA.(13–18) However, telomerase is absent in most normal human somatic cells.(18–20) The telomere hypothesis of cellular aging proposes that normal somatic cells become senescent when progressive telomere shortening during cumulative cell division produces a threshold telomere length.(22) In this study, telomerase activity was undetectable in osteoblasts from periarticular bone samples obtained from patients with OA, suggesting indirectly that telomere length in osteoblasts shortens during each cell replication. In addition, our findings suggest that osteoblasts decrease their telomeric length and replicative life span with aging.

Also, several reports have shown an inverse relationship between donor age and replicative life span (or telomere length) of normal human somatic cells.(6, 7, 11, 12), 16) In most cases, the correlation was relatively weak with large variation, comparable with the correlations seen in this study. Allsopp et al. reported that relatively weak correlations were observed between proliferative ability and donor and between telomere length and donor age.(6) In their study, when replicative capacity was plotted as a function of the initial telomere length, a much more significant correlation was found than that between replicative life span and donor age. Furthermore, they investigated whether initial telomere length explains a significant portion of the variation in replicative capacity seen throughout the age range of donors (age ranges: 0-25 years, 26-50 years, 51-75 years, and >75 years). In each age range of donors, a striking correlation was observed between initial telomere length and replicative life span. Allsopp et al. concluded that telomere length is a much better predictor for replicative capacity than is donor age and is consistent with a causal role for telomere loss in the cell dividing, whereas it is still debatable whether replicative life span of human somatic cells is correlated closely with donor age.(6) Cristofalo et al. reported that if health status and biopsy conditions are controlled, there was high variability in the replicative life span of cells derived from all donor age groups; however, the replicative life span of fibroblasts in culture does not correlate with donor age.(48) Some of the variability in proliferative potential within age groups might be attributed to differences in donor health status and the conditions and timing of the biopsy. Cristofalo et al. mentioned that health status of donors was unknown in all of the other previous reports. In our study, the scatter of donor age was relatively small, because all donors were patients with OA (age range, 46-72 years) who underwent arthroplastic knee surgery. The reason why our data showed relatively tight correlations and much less variation than the data in other tissues remains unclear. In this study, bone samples were obtained from surgical specimens at the upper periarticular site of the tibial bone of diseased bone tissue. It is well known that mechanical loading stimulates many responses in bone and osteoblasts associated with osteogenesis.(49–52) These features are thought to develop because of dysregulation of tissue turnover in weight-bearing articular cartilage and subchondral bone. The affected tissues are metabolically active, the pathological changes being mediated by local production of cytokines and proteases by the cells in the cartilage, synovium, and bone.(53) Therefore, OA is mediated biochemically but it is probably mechanically driven, its localization depending on loading. The specific increased proliferative demands resulting from the disease process of OA may influence the proliferative capacity (replicative life span and telomere length) of osteoblastic cells at the site of periarticular bone in OA.

In regenerative tissues, progenitors or stem cells furnish a continuous stream of differentiated cells throughout life. To maintain a sufficient supply of these cells over a lifetime, stem cells should possess an extended replicative life span, which requires telomerase activity. Embryonal, epithelial, and hematopoietic stem cells have detectable telomerase activity.(54–56) However, it is found that they continue to exhibit a shortening of their telomeres throughout life. These findings suggest that a threshold level of telomerase activity is required for maintenance of telomeres and cellular immortalization. Sharma et al. reported that down-regulation of telomerase activity was found to be a general response to the induction of differentiation in epithelial and embryonal stem cells.(56) However, it still remains unclear whether osteoblastic progenitor cells have a potential as a stem cell that expresses telomerase. From the results of this study, we think that mature osteoblastic cells do not have telomerase activity. Further studies are needed to clarify the relationship between the differentiation of osteoblasts and telomerase expression. The telomere lengths and the replicative capacity of osteoblasts might be reflected in those of the progenitors.

The role of individual cell-replicative senescence in organismic aging remains controversial. Senescent cells show selected, cell-specific functional changes. Senescent cells arrest growth with a G1 DNA content and do not enter S phase in response to physiological mitogens. In contrast, senescent cells remain metabolically active and resist apoptotic death for long periods of time.(1, 7–9) Although further studies are needed to clarify whether cellular replicative senescence contributes to the aging of an organ or tissue, the cellular replicative senescence in regenerative tissues may be responsible for the disorder in tissue repair or remodeling, resulting indirectly in organismic senescence. Our findings of age-related changes in the cellular activity, telomere length, and replicative life span of osteoblasts support the hypothesis that cumulative osteoblast senescence during aging contributes to age-related pathologies such as osteopenia in patients with arthritis.

In this report, we show for the first time that the introduction of telomerase, with telomerase catalytic subunit (TERT), into human osteoblasts leads to an extension of their replicative life span and the maintenance of the osteoblast activity pattern typical of young normal osteoblasts. To clarify whether the cells after hTERT or mock transfection lose characteristics of osteoblasts, hTERT-transfected cells and mock-transfected cells were examined by ALP staining after the gene transfection and at the time when they reached senescence or are near senescent. At all examinations, a majority of the cells showed ALP-positive staining, suggesting that osteoblastic cells keep the characteristics of osteoblasts maintaining during the continuous cultures in this study. Thus, we think that the decrease in osteoblastic activity as shown in hTERT-negative cells is caused by a loss of the activity per cell rather than an outgrowth of the population with a longer-living subpopulation that fails to express ALP.

The telomerase enzymes are RNA-dependent DNA polymerases that synthesize the telomeric DNA repeats.(17, 19) Telomerase consists of three components: hTERT, hTR, and hTP1.(23–29, 57) It has been suggested that telomerase activity may be correlated with hTERT expression but not with either hTR or hTP1 expression. We also observed a significant correlation between hTERT expression and telomerase activity in osteoblasts. The hTERT-positive osteoblasts, which were transfected with hTERT cDNA-expressing vector, expressed telomerase activity, whereas hTERT-negative osteoblasts did not express telomerase activity regardless of hTR and hTP1 expression. Forced expression of the hTERT in normal human somatic cells such as skin fibroblasts and pigment epithelial cells can reconstitute telomerase activity and extend their replicative life span.(3, 58, 59) There is a general consensus that hTERT is essential for the expression of telomerase activity.(32) Our results are consistent with this assumption. However, we have not obtained the data yet of telomere lengths of hTERT-positive cells during the continuous cultures for more than 40 population doublings, although we have investigated the telomere lengths of hTERT-positive osteoblastic cell populations within 40 population doublings. It remains unclear whether exogenous telomerase induction can immortally keep the telomere lengths maintaining for longer periods. Recently, Kiyono et al. reported that both Rb/p 16 INK 4a inactivation and telomerase activity are required to immortalize human epithelial cells.(60) Only an introduction of telomerase into the cells might be insufficient to immortalize normal somatic cells. We think that the longer-term effects of exogenous telomerase expression on telomere maintenance and the life span of these cells remain to be determined in studies of longer duration.

Recent reports have suggested that ectopic expression of telomerase in normal human somatic cells does not result in changes typically associated with malignant transformation.(61, 62) Factors such as in vitro growth requirements, cell-cycle checkpoints, and karyotypic stability in telomerase-expressing cells are similar to those of untransfected controls.(61) Specific stem cells and germline populations are telomerase-positive and have long or indefinite life spans, suggesting that telomerase expression per se is not oncogenic and that telomerase expression in normal cells does not appear to induce changes associated with a malignant phenotype.(62) Therefore, expanded populations of long-living normal cells or genetically engineered rejuvenated cells could be used for autologous or allogeneic cell and gene therapy. For osteoblasts in the osteoporotic bone tissue, the challenge of expanding cellular life span and maintaining these cells as differentiated bone matrix-producing cells may prove important in the development of new therapeutic strategies for osteoporosis.

In conclusion, results from this study suggest that the replicative senescence of osteoblasts in the periarticular bone occurs with aging in patients with OA. Osteoblast senescence may, at least in part, contribute to periarticular osteopenia. The ability to extend the cellular life span of osteoblasts may have important implications for biological research and the development of new technologies for bone and joint diseases.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. REFERENCES
  • 1
    Goldstein S 1990 Replicative senescence: The human fibroblast comes of age. Science 249:11291133.
  • 2
    Campisi J 1990 Replicative senescence: An old lives' tale? Cell 84:497500.
  • 3
    Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu C-P, Morin GB, Harley CB, Shay JW, Lichtsteiner S, Wright WE 1998 Extension of life-span by introduction of telomerase into normal human cells. Science 279:349352.
  • 4
    Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj I, Pereira-Smith O 1995 A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA 92:93639367.
  • 5
    Rohme D 1981 Evidence for a relationship between longevity of mammalian species and life spans of normal fibroblasts in vitro and erythrocytes in vivo. Proc Natl Acad Sci USA 78:50095013.
  • 6
    Allsopp R, Vaziri H, Patterson C, Goldstein S, Younglai E, Futcher B, Greider CW, Harley CB 1992 Telomere length predicts replicative capacity of human fibroblast. Proc Natl Acad Sci USA 89:1011410118.
  • 7
    Vaziri H, Schachter F, Uchida I, Wei L, Zhu X, Effros R, Cohen D, Harley CB 1993 Loss of telomeric DNA during aging of normal and trisomy 21 human lymphocytes. Am J Hum Genet 52:661667.
  • 8
    Hayflick L 1977 Cell biology. In: FinchCE, HayflickL (eds.) Handbook of the Biology of Aging. Van Nostrand Reinhold, New York, NY, USA, pp. 159186.
  • 9
    Goldstein S 1978 Genetics of aging. In: SchneiderE (ed.) Genetics of Aging. Plenum, New York, NY, USA, pp. 171224.
  • 10
    Martin GM 1978 Genetics Effects of Aging. BergsmaD, HarrisonDE (eds.) Wiley Liss, New York, NY, USA, pp. 539.
  • 11
    Blackburn EH 1991 Structure and function of telomeres. Nature 350:569573.
  • 12
    Harley CB, Futcher AB, Greider CW 1990 Telomeres shorten during aging of human fibroblasts. Nature 345:458460.
  • 13
    Lindsey J, McGill N, Lindsey LA, Green DK, Cooke HJ 1991 In vivo loss of telomeric repeats with age in humans. Mutat Res 256:4548.
  • 14
    Harley CB 1991 Telomere loss: Mitotic clock or genetic time bomb? Mutat Res 256:27182.
  • 15
    Shay JW, Wright WE, Brasiskyte D, Van Der Haegen BA 1993 E6 of human papolomavirus type 16 can overcome the M1 stage of immortalization in human mammary epithelial cells but not in human fibroblasts. Oncogene 8:14071413.
  • 16
    Levy MZ, Allsopp RC, Futcher B, Greider CW, Harley CB 1992 Telomere end-replication problem and cell aging. J Mol Biol 225:951960.
  • 17
    Morin GB 1989 The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 59:521529.
  • 18
    Counter CM, Avillion AA, LeFeuvre CE, Stewart NG, Greider CW, Harley CB, Bacchetti S 1992 Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 11:19211929.
  • 19
    Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PLC, Coviello GM, Wright WE, Weinrich SL, Shay JW 1994 Specific association of human telomerase activity with immortal cells and cancer. Science 266:20112015.
  • 20
    Counter CM, Gupta J, Harley CB, Leber B, Bacchetti S 1995 Telomerase activity in normal leukocytes and in hematologic malignancies. Blood 85:23152320.
  • 21
    Chadeneau C, Hay K, Hirte HW, Gallinger S, Bacchetti S 1995 Telomerase activity associated with acquisition of malignancy in human colorectal cancer. Cancer Res 55:25332536.
  • 22
    Rhyu MS 1995 Telomeres, telomerase, and immortality. J Natl Cancer Inst 87:884894.
  • 23
    Nakamura TM, Morin GB, Chapman KB, Weinrich SL, Andrews WH, Lingner J, Harley CB, Cech TR 1997 Telomerase catalytic subunit homologs from fission yeast and human. Science 277:955959.
  • 24
    Meyerson M, Counter CM, Earon EN, Ellisen LW, Steiner P, Caddle SD 1997 hEST2, the putative human telomerase catalytic subunit gene is up-regulated in tumor cells and during immortalization. Cell 90:785795.
  • 25
    Harrington L, Zhou W, McPhail T, Oulton R, Yeung DS, Mar V, Bass MB, Robinson MO 1997 Human telomerase contains evolutionarily conserved catalytic and structural subunits. Genes Dev 11:31093115.
  • 26
    Kilian A, Bowtell DD, Abud HE, Hime GR, Venter DJ, Keese PK, Duncan EL, Reddel RR, Jefferson RA 1997 Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns indifferent cell types. Hum Mol Genet 6:20112019.
  • 27
    Nakayama J, Tahara H, Tahara E, Saito M, Ito K, Nakamura H, Nakanishi T, Tahara E, Ide T, Ishikawa F 1998 Telomerase activation by hTRT in human normal fibroblasts and hepatocellular carcinoma. Nat Genet 18:6568.
  • 28
    Feng J, Funk WD, Wang SS, Weinrich SL, Avilion AA, Chiu C-P, Adams RR, Chang E, Allsopp RC, Yu J 1995 The RNA component of human telomerase. Science 269:12361241.
  • 29
    Harrington L, McPhail T, Mar V, Zhou W, Oulton R, Bass MB, Arruda I, Robinson MO 1997 A mammalian telomerase-associated protein. Science 275:973977.
  • 30
    Weinrich SL, Pruzan R, Ma L, Ouellette M, Tesmer VM, Holt SE, Bondnar AG, Lichtsteiner S, Kim NW, Tranger JB, Taylor RD, Carlos R, Andrews WH, Wright WE, Shay JW, Harley CB, Morin GB 1977 Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT. Nat Genet 17:498502.
  • 31
    Steinert S, Shay JW, Wright WE 2000 Transient expression of human telomerase extends the lifespan of normal human fibroblasts. Biochem Biophys Res Commun 273:10951098.
  • 32
    Nugent CI, Lundblad V 1998 The telomerase reverse transcriptase: Components and regulation. Genes Dev 12:10731085.
  • 33
    Manolagas SC, Jilka RL 1995 Mechanisms of disease: Bone marrow, cytokines, and bone remodeling. Emerging insights into the pathophysiology of osteoporosis. N Engl J Med 332:305311.
  • 34
    Jilka RL, Hangoc G, Girasole G, Passeri G, Williams DC, Abrams JS Boyce B, Broxmeyer H, Manolagas SC 1992 Increased osteoclast development after estrogen loss: Mediation by interleukin-6. Science 257:8891.
  • 35
    Jilka RL, Weinstein RS, Takahashi K, Parfitt AM, Manolagas SC 1996 Linkage of decreased bone mass with impaired osteoblastogenesis in a murine model of accelerated senescence. J Clin Invest 97:17321740.
  • 36
    Roholl PJM, Blauw E, Zurcher C, Dormans JAMA 1994 Evidence for a diminished maturation of preosteoblasts into osteoblasts during aging in rats: An ultrastructural analysis. J Bone Miner Res 9:355366.
  • 37
    Inoue K, Ohgushi H, Yoshikawa T, Okumura M, Sempuku T, Tamani S, Dohi Y 1997 The effect of aging on bone formation in porous hydroxyapatite: Biochemical and histological analysis. J Bone Miner Res 12:989994.
  • 38
    Bergman RJ, Gazit D, Kahn AJ, Gruber H, McDougall S, Hahn TJ 1996 Age-related changes in osteogenic stem cells in mice. J Bone Miner Res 11:568577.
  • 39
    Parfitt AM 1990 Bone-forming cells in clinical conditions. In: HallBK (ed.) Bone, vol 1. CRC Press, Boca Raton, FL, USA, pp. 351429.
  • 40
    Shih MS, Cook MA, Spence CA, Palnitkar S, McElroy H, Parffit AM 1993 Relationship between bone formation rate and osteoblastic surface on different subdivisions of the endosteal envelope in aging and osteoporosis. Bone 14:519521.
  • 41
    Weinstein RS, Jilka RL, Parfitt AM, Manolagas SC 1998 Inhibition of osteoblastogenesis and promotion of apoptosis of osteoblasts and osteocytes by glucocorticoids: Potential mechanisms of their deleterious effects on bone. J Clin Invest 102:274282.
  • 42
    Martinez ME, del Campo MT, Medina S, Sanchez M, Sanchez-Cabezudo MJ, Esbrit P, Martinez P, Moreno I, Rodrigo A, Garces MV 1999 Influence of skeletal site of origin and donor age on osteoblastic cell growth and differentiation. Calcif Tissue Int 261:280286.
  • 43
    Jilka RL, Weinstein RS, Bellido T, Roberson P, Parfitt AM, Manolagas SC 1999 Increased bone formation by prevention of osteoblast apoptosis with parathyroid hormone. J Clin Invest 104:439446.
  • 44
    Pfeilschifter J, Diel I, Pilz U, Brunotte K, Naumann A, Ziegler R 1993 Mitogenic responsiveness of human bone cells in vitro to hormones and growth factors decreases with age. J Bone Miner Res 8:707717.
  • 45
    Sabokbar A, Millett PJ, Myer B, Rushton N 1994 A rapid quantitative assay for measuring alkaline phosphatase activity in osteoblastic cells in vitro. Bone Miner 27:5767.
  • 46
    Pfeilschifter J, Erdmann J, Schmidt W, Naumann A, Minne HW, Zirgler R 1990 Differential regulation of plasminogen activator and plasminogen activator inhibitor by osteotropic factors in primary cultures of mature osteoblasts and osteoblast precursors. Endocrinology 126:703711.
  • 47
    Smith JR, Braunschweiger KI 1978 Growth of human embryonic fibroblasts at clonal density: Concordance with results from mass cultures. J Cell Physiol 98:597602.
  • 48
    Cristofalo V, Allen RG, Pignolo RJ, Martin BG, Beck J 1998 Relationship between donor age and the replicative lifespan of human cells in culture: A reevaluation. Proc Natl Acad Sci USA 95:1061410619.
  • 49
    Toma CD, Ashkar S, Gray ML, Schaffer JL, Gerstenfeld LC 1997 Signal transduction of mechanical stimuli is dependent on microfilament integrity: Identification of osteopontin as a mechanically induced gene in osteoblasts. J Bone Miner Res 12:16261636.
  • 50
    Turner CH, Owan I, Alvey T, Hulman J, Hock JM 1998 Recruitment and proliferative responses of osteoblasts after mechanical loading in vivo determined using sustained-release bromodeoxyuridine. Bone 22:463469.
  • 51
    Fermor B, Gundle R, Evans M, Emerton M, Pocock A, Murray D 1998 Primary human osteoblast proliferation and prostaglandin E2 release in response to mechanical strain in vitro. Bone 22:637643.
  • 52
    Ryder KD, Duncan RL 2000 Parathyroid hormone modulates the response of osteoblast-like cells to mechanical stimulation. Calcif Tissue Int 67:241246.
  • 53
    Bullough PG 1998 Osteoarthritis and related disorders: Pathology. In: KlippelJH, DieppePA (eds.) Rheumatology, 2nd ed., vol 2. Mosby, London, UK, section 8, chapter 8, pp. 18.
  • 54
    Golubovskaya VM, Filatov LV, Behe CI, Presnell SC, Hooth MJ, Smith GJ, Kaufmann WK 1999 Telomere shortening, telomerase expression, and chromosome instability in rat hepatic epithelial stem-like cells. Mol Carcinog 24:209217.
  • 55
    Niida H, Shinkai Y, Hande MP, Matsumoto T, Takehara S, Tachibana M, Oshimura M, Lansdorp PM, Furuich Y 2000 Telomere maintenance in telomerase-deficient mouse embryonic stem cells: Characterization of an amplified telomeric DNA. Mol Cell Biol 20:41154127.
  • 56
    Sharma HW, Sokoloski JA, Maltese JY, Sartorelli AC, Stein CA, Nichols G, Khaled Z, Telang NT, Narayanan R 1995 Differentiation of immortal cells inhibits telomerase activity. Proc Natl Acad Sci USA 92:1234312346.
  • 57
    Nakajima J, Saito M, Nakamura H, Matsuura A, Ishikawa F 1997 TLP1: A gene encoding a protein component of mammalian telomerase is a novel member of WD repeats family. Cell 88:875884.
  • 58
    Counter CM 1998 Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc Natl Acad Sci USA 95:1472314728.
  • 59
    Vaziri H, Benchimol S 1998 Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr Biol 8:279282.
  • 60
    Kiyono T, Foster SA, Koop JI, McDougall JK, Galloway DA, Klingelhutz AJ 1998 Both Rb/p16 INK 4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 396:8488.
  • 61
    Jiang X-R, Jimenez G, Chang E, Frolkis M, Kusler B, Sage M, Beeche M, Bodnar AG, Wahl GM, Tlsty TD 1999 Telomerase expression in human somatic cells does not induce charges associated with a transformed phenotype. Nat Genet 21:111113.
  • 62
    Morales CM, Holt SE, Ouellette M, Kaur KJ, Yan Y, Wilson K, White MA, Wright WE, Shay JW 1999 Absence of cancer-associated changes in human fibroblasts immortalized with telomerase. Nat Genet 21:115118.