SEARCH

SEARCH BY CITATION

Keywords:

  • collagen;
  • proteoglycan;
  • growth plate;
  • collagenase;
  • mineralization

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The recent development of new specific immunoassays has provided an opportunity to study the assembly and resorption of type II and IX collagens of the extracellular matrix in relationship to endochondral calcification in situ. Here, we describe how in the bovine fetal physis prehypertrophic chondrocytes deposit an extensive extracellular matrix that, initially, is rich in both type II and type IX collagens and proteoglycan (PG; principally, aggrecan). The majority of the α1(IX)-chains lack the NC4 domain consistent with our previous studies with cultured chondrocytes. During assembly, the molar ratio of type II/COL2 domain of the α1(IX)-chain varied from 8:1 to 25:1. An increase in the content of Ca2+ and inorganic phosphate (Pi) was initiated in the prehypertrophic zone when the NC4 domain was removed selectively from the α1(IX)-chain. This was followed by the progressive loss of the α1(IX) COL2 domain and type II collagen. In the hypertrophic zone, the Ca2+/Pi molar ratio ranged from 1.56 to a maximum of 1.74, closely corresponding to that of mature hydroxyapatite (1.67). The prehypertrophic zone had an average ratio Ca2+/Pi ranging from 0.25 to 1, suggesting a phase transformation. At hypertrophy, when mineral content was maximal, type II collagen was reduced maximally in content coincident with a peak of cleavage of this molecule by collagenase when matrix metalloproteinase 13 (MMP-13) expression was maximal. In contrast, PG (principally aggrecan) was retained when hydroxyapatite was formed consistent with the view that this PG does not inhibit and might promote calcification in vivo. Taken together with earlier studies, these findings show that matrix remodeling after assembly is linked closely to initial changes in Ca2+ and Pi to subsequent cellular hypertrophy and mineralization. These changes involve a progressive and selective removal of types II and IX collagens with the retention of the PG aggrecan.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Endochondral ossification involves the assembly of hyaline cartilage in which an extracellular matrix is formed and then partly resorbed and calcified by deposition of hydroxyapatite.(1, 2) Reaching a clearer understanding of the molecular changes that may occur leading to the transformation of a noncalcifiable matrix into one that is calcified is the focus of this study. The primary growth plate in mammals (Fig. 1) is an ideal tissue in which to study the process of cartilage calcification because each sagittal section encapsulates the temporal and spatial sequence of structural changes that occur as the matrix is remodeled during the process of mineralization. The synchrony of cell proliferation and rapid matrix formation and its remodeling leading to mineral formation are tailor-made for ordered growth and elongation of bone.

thumbnail image

Figure FIG. 1.. Diagramatic representation of the organization of a primary growth plate showing sampling sites extending through the hypertrophic zone into the proliferative zone. The figure is reproduced with permission.(1)

Download figure to PowerPoint

The growth plates are dynamic structures in which the physis can be divided into different zones: reserve, proliferative, and hypertrophic zones (Fig. 1). The reserve zone cells show little or no cell division.(3) The proliferative zone, which abuts the reserve zone, contains cells that divide rapidly and secrete an extensive hyaline extracellular matrix consisting principally of type II collagen and the large aggregating proteoglycan (PG) aggrecan.(1, 2) These cells suddenly enlarge, round up, and start to synthesize type X collagen.(4–6) This characterizes them as hypertrophic chondrocytes. Although the function of type X collagen is still unclear, mutations in this molecule suggest that it may play a structural role in maintaining collagen fibril organization and the mechanical properties of the matrix at a time when there is considerable resorption and remodeling of these type II collagen fibers.(7) The hypertrophic cells enlarge 5- to 10-fold,(8, 9) resulting in a reduced matrix per unit volume of tissue. After resorption and remodeling, the residual matrix, which is by now of minimal volume,(10) starts to calcify in focal sites in the longitudinal septa where the PG molecules are concentrated. This involves the deposition of hydroxyapatite mineral [Ca10(PO4)6(OH)2], which has a Ca2+/inorganic phosphate (Pi) molar ratio of 1.67(11); The C-propeptide of type II collagen, a calcium-binding protein, accumulates in these mineralizing sites.(12, 13) Matrix vesicles are produced starting in the proliferative zone. They are sites where the earliest mineralization is observed.(14) These events are balanced by an angiogenic process whereby capillary sprouts erode the last transverse septa separating the hypertrophic zone from the metaphysis (Fig. 1).(15)

The organization of the matrix involves the assembly of types II, IX, and XI collagens into fibrils that give the tissue its tensile strength. The large aggregating PG, which provides the tissue with its compressive stiffness, resides in the interfibrillar matrix. We have shown that within the growth plate, type II collagen is extensively denatured in the hypertrophic zone and selectively removed leaving behind an increased content of aggrecan as chondrocytes enlarge in size.(10, 16, 17) It is likely that this loss of type II collagen occurs as a result of chondrocyte-mediated collagenase activity, particularly because collagenase cleavage initiates denaturation of type II collagen at physiological temperature and collagenase is increased in content and activity in these extracellular sites at this time.(18–20)

Type IX collagen, is located on the surface of collagen fibrils(21) and possesses an NC4 domain that protrudes from the fibril and is thought to provide a molecular link between the fibrils and other interfibrillar matrix components such as the PG aggrecan.(22) Type IX collagen is synthesized as a disulfide-bonded heterotrimer comprising three distinct α1(IX)-, α2(IX)-, and α3(IX)-chains.(23) The molecule is not processed before its deposition in the extracellular matrix. It comprises three collagenous triple-helical domains (COL1, COL2, and COL3) alternating with four noncollagenous domains (NC1, NC2, NC3, and NC4). The α2(IX)-chain can have a chondroitin/dermatan sulfate glycosaminoglycan (GAG) covalently attached at the NC3 domain; therefore, there are both PG and non-PG forms of type IX collagen.(24–26) The α1-chain has an amino-terminal extension composed of the COL3 and NC4 domains extending from the fibril surface into the perifibrillar space where it terminates in the NC4 globular domain of the α1(IX)-chain.(21, 23, 27) Type IX collagen is covalently cross-linked to collagen type II in an antiparallel orientation and also may be cross-linked to other type IX collagen molecules.(28–32)

The amino-terminal NC4 domain is very basic.(33–35) Some forms of type IX collagen may lack the NC4 domain because of the use of an alternative promoter(25) and the expression of this variant is thought to be tissue specific and developmentally regulated. The precise biological role(s) of type IX collagen, its assembly in relationship to type II collagen, and the mechanisms that regulate its synthesis and degradation remain unknown. But molecular abnormalities involving type IX collagen α-chains can lead to premature degeneration of articular cartilages, showing its importance in preserving matrix structure and function.(36–40) Very little is known of the structure and organization of type IX collagen molecules in the growth plate.

We have developed immunoassays that are capable of measuring the total content of type II collagen by using an antibody COL2-3/4m to an intrachain epitope.(40) Another antibody recognizes the carboxy-terminal (COL2-3/4Cshort) neoepitope of type II collagen, which is generated after the primary intrahelical cleavage of this molecule by collagenases.(41) These proteinases include matrix metalloproteinase (MMP) 1 (collagenase 1), MMP-8 (collagenase 2), and MMP-13 (collagenase 3). Thus, the concentrations and cleavage of matrix molecules can now be studied using these immunoassays. In this study, we used these type II collagen immunoassays in combination with two new immunoassays for the NC4 and COL2 domains of the α1(IX)-chain to examine the primary proximal tibial growth plate of the bovine fetus in situ. By analyses of transverse frozen sections, we were able to investigate the assembly and degradation of collagens II and IX in the growth plate and their relationship to matrix mineralization, cellular hypertrophy (type X collagen expression), MMP-13 expression, and PG (principally aggrecan). This study provides new insight into the molecular reorganization of matrix associated with matrix mineralization and hypertrophy.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Tissue preparation

Bovine fetuses were obtained from a local abattoir immediately after slaughter of pregnant cows and transported to the laboratory. Fetal age was determined by measurement of tibial length.(42) Fetuses ranged from 120 to 210 days old. Essentially, tissue preparation was as described.(10, 16) Briefly, the primary growth plates of proximal tibias were exposed by parallel vertical incisions made from the articular surface of the tibial plateau to the bony metaphysis. Epiphyseal cartilage was separated from metaphyseal bone to create the fracture face from which the sections were then cut. Only blocks of growth plate with a flat fracture surface at the junction with the primary spongiosa were excised. Tissue blocks were trimmed to provide cross-sectional areas of approximately 25 mm2. Twenty-micrometer-thick frozen transverse sections were cut parallel to the fracture face with a cryostat, starting at the fracture face and extending through the hypertrophic zone into the upper proliferative zone. Five consecutive sections were pooled to form one sample representing a 100-μm thickness of tissue labeled as A, B, C, and so on, from the fracture face (Fig. 1). Wet weights were determined immediately after sectioning; the weights ranged from 5 to 15 mg, depending on the sample. The weights of samples A and B were lower because of in part the irregularity of the fractured face.(16) A series of 16 samples from each block were analyzed. Eight to 10 blocks from the same fetus were processed. Because the amount of tissue in separated samples was very small, samples (A, B, C, etc.) from the different blocks were pooled immediately with corresponding samples (all A's with A's, B's with B's, etc.) and DulbeccO's modified Eagle's medium (DMEM; Life Technologies, Burlington Ontario, Canada) was added (at 5-15 mg wet wt/ml) and digested with α-chymotrypsin and proteinase K as described.(17, 40) The assay data presented in this study thus reflect assay variability (as opposed to growth plate variability) of combined growth plate blocks in any one fetus. A total of 5 fetuses was studied.

Extraction and immunoassay of COL2-3/4Cshort and COL2-3/4m epitopes

The method used to extract COL2-3/4Cshort and COL2-3/4m epitopes from cell layers essentially was as described.(40, 41) These epitopes were not destroyed by treatment involving α-chymotrypsin, which degrades denatured type II collagen. The ELISA assay used to measure the production of the carboxy-terminal (COL2-3/4Cshort) neoepitope generated by cleavage of native type II collagen by collagenase was performed as described(41) in α-chymotrypsin extracts. Total type II collagen was measured using the COL2-3/4m assay,(40) which measures an intrachain epitope in the triple helical domain in both α-chymotrypsin and proteinase K extracts. The latter proteinase degrades helical collagen without cleaving the COL2-3/4 m epitope.

Inhibition ELISAs for type IX collagen NC4 and COL2 domains

These ELISAs were described recently.(17) They were used to analyze α-chymotrypsin and proteinase K extracts.

Total calcium and phosphate analysis

Calcium was measured in both the α-chymotrypsin and proteinase K extracts using phthalein purple (Sigma) to measure the complex at 575 nm.(43) Pi concentration was determined using the ammonium molybdate method of Ames.(44) The results of α-chymotrypsin and the proteinase K digest analyses were totaled to obtain total Ca2+ or Pi in the tissue.

Total RNA extraction and isolation

Total RNA was isolated from fresh tissues (Fig. 1) using the alcohol/proteinase K method.(45, 46) Briefly, cartilage was solubilized in solution D (4 M of guanidine isothiocyanate, 25 mM of sodium acetate, pH 7.0, 0.1 M of 2-mercaptoethanol, and 0.5% N-lauroylsarcosine). One volume of isopropanol was added to this mixture and all proteins and nucleic acids were precipitated at 20°C overnight. After centrifugation, the pellet containing the proteins and nucleic acid was digested with 1 mg/ml of proteinase K (molecular biology grade; Life Technologies) for 2 h at 65°C. After digestion, the mixture then was extracted with 1 vol of phenol and 0.1 vol of chloroform/alcohol (48:1). The aqueous phase was recovered after centrifugation and precipitated with 1 vol of isopropanol. The RNA and remaining contaminating GAGs were recovered by centrifugation. This pellet was washed in 4 M of LiCl,(47) which solubilizes the GAGs but not the RNA. The RNA is recovered by centrifugation, resuspended in solution D, and extracted with phenol/chloroform. Pure total RNA is recovered by precipitating the aqueous phase and washing with 70% ethanol to remove any excess salt. Then, the total RNA pellet is resuspended in diethylpyrocarbonate (DEPC)-treated water. The optical density (OD) 260/280 nm is determined to provide content (1 OD, 260 = 40 μg of RNA) and assess the purity of the preparation (260/280 nM > 1.8).(45)

Reverse-transcriptase polymerase chain reaction

Reverse-transcriptase polymerase chain reaction (RT-PCR) was used to detect MMP-13 and collagen type X messenger RNA (mRNA). Five consecutive sections were pooled to form one sample representing a 100-μm thickness of tissue labeled as A, B, C, etc. from the fracture face (Fig. 1). Total RNA was extracted as described previously. The RT reaction was performed using total RNA isolated from the cartilage in a total volume of 20 μl containing 50 mM of Tris-HCl, pH 8.3; 75 mM of KCl; 3 mM of MgCl2; 10 mM of dithiothreitol; 50 mM each deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytosine triphosphate (dCTP), and deoxythymidine triphosphate (dTTP); 0.5 mg of oligo (dT)12-18; 5 μg of total RNA; and 200 U of SuperScript TMII H reverse transcriptase (Gibco BRL).

Oligonucleotide sequences used for PCR

Collagenase (MMP-13) primer sequences were selected by using conserved sequences found in humans,(48) rats, and mice(49): MMP-13-D (1241-1259), GATAAAGACTATCCGAGAC; and MMP-13-R (1369-1386), GACTTTTCTCCCCTCT. Type X collagen primer sequences were selected by using conserved sequences found in bovine(50) procollagen type X(α1) collagen type X-D (213-232), CTGAGCGATACCAAACACC, and Col X-R (297-319), GTAAAGGTGTATCACTGAGAGG. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers have been described(51): G3PDH-D (605-628), GCTCTCCAGAACATCATCCCTGCC; and G3PDH-R (927-950) AGCTCATTTCCTGGTATGACAACG.

PCR

PCR was performed in a total volume of 25 μl: 19 mM of Tris-HCl, pH 8.3; 1.5 mM of MgCl2; 0.4 mM each of dATP, dGTP, dCTP, and dTTP; 0,8 mM of each primer, 1 ml of RT mixture, and 2.5 U of AmpliTaq DNA polymerase (Perkin Elmer Life Sciences, Woodbridge, Ontario, Canada). Thirty cycles of PCR included denaturation (95°C, 1 minute), annealing (50°C, 1 minute), and extension (72°C, 5 minutes). After 1.6% agarose gel electrophoresis, PCR products were visualized by ethidium bromide staining.

Determination of GAG content

To measure sulfated GAGs (predominantly PG aggrecan), 10-μl samples of α-chymotrypsin and the proteinase K-digested cell layers were analyzed using the 1,9-dimethylmethylene blue (DMMB) dye binding assay.(52) The results of α-chymotrypsin and the proteinase K analysis were totaled to obtain total PG content in the tissue.

DNA content

This was measured on proteinase K digests as described by Labarca and Paigen.(53)

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

As in our previous work,(10, 16) we show the results for a single growth plate. They are entirely representative of results obtained on other fetuses.

Analyses of gene expression

The results of RT-PCR analyses of gene expression of MMP-13 and type X collagen, related to GAPDH (a housekeeping gene), on a single fetus are shown in a representative experiment shown in Fig. 2. Very similar results were obtained in other fetuses. Samples A through C represent the hypertrophic zone in which type X collagen, a definitive marker for the hypertrophic phenotype, was consistently expressed. Samples C and B accounted for maximal type X collagen gene expression. Previous studies have revealed that samples from D to L extend to the upper proliferative-resting zone.(10, 16) MMP-13 was expressed weakly in the proliferative zone (samples D-K). Like type X collagen it was strongly expressed in the hypertrophic zone (samples A-C).

thumbnail image

Figure FIG. 2.. RT-PCR analyses of type X collagen and MMP-13 in sequential transverse sections of the hypertrophic, maturing, and proliferative zones of bovine fetal growth plate. The reference gene for loading is GAPDH. Fetal age is 180 days.

Download figure to PowerPoint

Contents of calcium and phospate

These results shown here are typical of those found in studies of at least 2 separate fetuses. Figure 3 shows the contents of Ca2+ (Fig. 3A), Pi (Fig. 3B), and the Ca2+/Pi (Fig. 3C) molar ratio normalized to wet weight. The stoichiometry of Ca2+ and Pi accumulation in the growth plate consists of progressive Ca2+ and Pi ion acquisition starting from the proliferative zone (Fig. 3, sample H) with a Ca2+/Pi ion ratio of 0.78 coincident with the initiation of matrix resorption reflected by the loss of the NC4 domain of type IX collagen α1(IX)-chain (Fig. 4A, sample H) and then the COL2 domain of α1(IX) (Fig. 4B, sample G) followed by a gradual loss of type II collagen (Fig. 4C, from G). Sample I corresponded to an early peak in collagenase activity (Fig. 3D). This was followed by the degradation of type IX collagen with the loss of the NC4 domain (Fig. 4A). Ca2+ and Pi accumulation first seen in sample H peaked in the hypertrophic zone (Figs. 3A and 3B). The measurements of calcium and phosphate were shown previously to be related to mineralization.(54)

thumbnail image

Figure FIG. 3.. Changes in the total tissue contents of (A) calcium and (B) phosphate. The hypertrophic zone (HZ) is indicated. (C) The molar ratio for calcium/phosphate. Means ± SD are shown. Fetal age is 180 days. The sites at which calcification and type X expression (HZ) were observed are indicated.

Download figure to PowerPoint

thumbnail image

Figure FIG. 4.. Tissue contents of (A) type IX α1(IX) NC4 and (B) COL2 domains, (C) type II collagen content, (D) collagenase cleavage of type II collagen, and (E) PG content are shown. Means ± SD are given. Fetal age is 180 days. The sites at which calcification and type X expression (HZ) were observed are indicated.

Download figure to PowerPoint

The gradually increasing Ca2+/Pi molar ratio (Fig. 3C; peak 1.70-1.76) displayed a ratio close to that of mature hydroxyapatite (1.67). Mineralization increased proportionate to matrix degradation, being most pronounced where type II and IX collagen contents reached their lowest levels after matrix assembly (Figs. 4A-4C).

Matrix content and degradation

Matrix composition in the proliferative zone (Fig. 4) was characterized by an increasing content of type II (Fig. 4C, from sample L to H), NC4 domain of type IX (Fig. 4A, from sample L to J), and COL2 type IX (Fig. 4B, from sample L to J) collagens. These increases were at the time when calcium and phosphate contents were minimal (Figs. 3A and 3B, from sample L to I). Subsequently, contents of type IX collagen (Figs. 4A and 4B, sample I) and PG (Fig. 4E, samples J and I) were transiently reduced. This corresponded to an initial peak in collagenase activity (Fig. 4D, sample I). It was apparent that in sample I, PG content (principally aggrecan; Fig. 4E) did not closely follow that of type II collagen (Fig. 4C) or type IX collagen (Figs. 4A and 4B). The molar ratio of type II collagen to α1(IX) COL2 domain varied in the range of 8-25:1. The molar ratio of the COL2/NC4 domain varied in the range of 5-15 during matrix assembly, suggesting that a proportion of type IX collagen molecules lacked the NC4 domain as we previously observed in culture studies.(17) Coinciding with the onset of increased content of Ca2+ and Pi, there was a loss of the α1(IX) NC4 domain (Fig. 4A, sample H) and then loss of the COL2 domain of the α1(IX)-chain (Fig. 4B, sample G). Type II collagen content dropped progressively from sample H (Fig. 4C) and then precipitously reaching (sample D) its lowest concentration in the hypertrophic zone in samples C, B, and A (Fig. 4C). At this time of minimal type II content in the hypertrophic zone, there was maximal MMP-13 expression (Fig. 2, samples C, B, and A), which coincided with maximal collagenase activity (cleavage of type II collagen) in the hypertrophic zone (Fig. 4D, samples C, B, and A) from relatively little collagenase activity when type IX collagen resorption was initiated (Figs. 4A and 4B) coincident with the onset of an increase in Ca2+ and Pi contents (Figs. 3A and 3B). In contrast, PG content, which had reached one of its peaks with onset of Ca2+ and Pi deposition, attained a third peak at the time of mineral deposition in the lower hypertrophic zone (Fig. 4E). These results were reproducible in different fetuses. Hence, only one representative study is shown in these results.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

One of the major obstacles to understanding the complex assembly and remodeling of the extracellular matrix during endochondral ossification has been the lack of suitable methods with which to study this process in the different zones of the physis. Our prior development of in situ microchemical and immunochemical methods(10, 16) has permitted the quantitative analyses of different zones of the growth plate by using sequential transverse sections of the primary proximal tibial growth plate of the bovine fetus. In this study, we have used the same approach in combination with several new assays for matrix composition and degradation coupled with the use of RT-PCR. We have confirmed our earlier observations and extended them in this study. It is obvious from our present study that calcification at the time of hypertrophy is preceded by the accumulation of Ca2+ and Pi in the proliferative zone. This was evident at an early stage, increasing gradually thereafter. This finding is in close agreement with the results from cultured growth plate chondrocytes in which Ca2+ and Pi were shown to accumulate in premineralizing cultures before the massive extracellular deposition of mineral.(54)

We have not drawn Fig. 1 to reflect the fact that mineralization is occurring before hypertrophy because although we have measured Ca2+ and Pi, we have no direct evidence for the presence of calcium phosphate crystals in the prehypertrophic zone. However, the measurements of calcium and phosphate were shown previously to be related to mineralization.(54) It is possible that some Ca2+ may be bound to matrix PGs,(55, 56) the contents of which increase at this time. The measurements of calcium and phosphate were shown previously to be related to mineralization.(54)

Interestingly, the early accumulation of calcium and phosphate before cellular hypertrophy is related closely to a carefully controlled resorption of the extracellular matrix characterized initially by the irreversible removal of the NC4 domain of the collagen α1(IX)-chain, followed by the removal of the COL2 domain of α1(IX) and then loss of type II collagen, with only a transient loss of the PG aggrecan. In previous studies, we also observed that the NC4 domain is lost before type II collagen degradation.(17, 57, 58) Together, these observations show that cleavage of the α1(IX)-chain leading to the release of the NC4 domain takes place immediately before loss of the COL2 domain of the of α1(IX)-chain, which (unlike the NC4 domain) is applied closely to the collagen fibril surface and is degraded immediately before the time that type II collagen cleavage is initiated. From this study, it is apparent that the progressive removal of these collagens accompanies the progressive accumulation of calcium and phosphate. Thus, the collagen fibril, may act as a barrier to subsequent mineral growth and deposition, and not the PG aggrecan, the content of which peaks when mineral deposition is initiated and again when mineral deposition reaches a maximum.

The proteolytic mechanisms involved in this major removal of type II collagen in the hypertrophic zone are in part addressed by the demonstration of increased collagenase cleavage of type II collagen at the time of increased expression of MMP-13. The latter is the only collagenase observed in the growth plate.(59–62) It is known that its expression is maximal in the hypertrophic zone, as our studies confirmed. Thus, these observations link the marked increase in MMP-13 expression in hypertrophic chondrocytes to the extensive degradation of type II collagen as mineral formation is completed in the extracellular matrix of the physis. The proteinases involved in the cleavage of type IX collagen remain to be identified, although a cleavage involved in the release of the NC4 domain has been described.(63)

Our observations reveal a closely ordered remodeling with a selective resorption of the extracellular matrix in relation to subsequent extensive mineralization in a manner not identified previously. This study represents a logical extension and confirmation of earlier results from our culture studies, which examined synchronous chondrocyte terminal differentiation and matrix remodeling.(17) Although much qualitative data has been obtained from studies involving immunolocalization or in situ hybridization, quantitative data generally are scarce. Such quantitative information should be of value in defining the changes in the extracellular matrix and their relationship to matrix mineralization in endochondral ossification.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

This work was funded by the Medical Research Council of Canada, Shriners Hospitals for Children, Canadian Arthritis Network and National Institutes of Health (to A.R.P). Fackson Mwale was a recipient of a Shriners Hospitals for Children postdoctoral fellowship.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  • 1
    Poole AR 1991 Cartilage: Molecular aspects. In: HallBK NS (ed.) Endochondral Bone Formation and Development in the Axial and Appendicular Skeleton. CRC Press, Boca Raton, FL, USA, pp. 179211.
  • 2
    Poole AR, Laverty S, Mwale F 2000 Endochondral bone formation and development in the axial and appendicular skeleton. In: HendersonJE, GaltzmanD (eds.) The Osteoporosis Primer. Cambridge University Press, Cambridge, UK, pp. 317.
  • 3
    Kember NF 1960 Cell division in endochondral ossification: A study of cell proliferation in rat bones by the method of tritiated thymidine autoradiography. J Bone Joint Surg Br 42:824839.
  • 4
    Gibson GJ, Bearman CH, Flint MH 1986 The immunoperoxidase localization of type X collagen in chick cartilage and lung. Coll Relat Res 6:163184.
  • 5
    Schmid TM, Linsenmayer TF 1985 Immunohistochemical localization of short chain cartilage collagen (type X) in avian tissues. J Cell Biol 100:598605.
  • 6
    Marriott A, Ayad S, Grant ME 1991 The synthesis of type X collagen by bovine and human growth-plate chondrocytes. J Cell Sci 99:641649.
  • 7
    Chan D, Jacenko O 1998 Phenotypic and biochemical consequences of collagen X mutations in mice and humans. Matrix Biol 17:169184.
  • 8
    Hunziker EB, Schenk RK, Cruz-Orive LM 1987 Quantitation of chondrocyte performance in growth-plate cartilage during longitudinal bone growth. J Bone Joint Surg Am 69:162173.
  • 9
    Buckwater JA, Mower D, Ungar R, Shaeffer J, Grisberg B 1986 Morphometric analysis of chondrocyte hypertrophy. J Bone Joint Surg Am 68:243255.
  • 10
    Alini M, Matsui Y, Dodge GR, Poole AR 1992 The extracellular matrix of cartilage in the growth plate before and during calcification: Changes in composition and degradation of type II collagen. Calcif Tissue Int 50:327335.
  • 11
    Glimcher MJ 1992 The nature of the mineral component of bone and the mechanism of calcification In: CoeFL, FavusMJ (eds.) Disorders of Bone Mineral Metabolism. Raven Press, Ltd., New York, NY, USA, pp. 265286.
  • 12
    Poole AR, Pidoux I, Reiner A, Choi H, Rosenberg LC 1984 Association of an extracellular protein (chondrocalcin) with the calcification of cartilage in endochondral bone formation. J Cell Biol 98:5465.
  • 13
    Lee ER, Smith CE, Poole R 1996 Ultrastructural localization of the C-propeptide released from type II procollagen in fetal bovine growth plate cartilage. J Histochem Cytochem 44:433443.
  • 14
    Wuthier RE 1982 A review of the primary mechanism of endochondral calcification with special emphasis on the role of cells, mitochondria and matrix vesicles. Clin Orthop 169:219242.
  • 15
    Schenk RK, Wiener J, Spiro D 1968 Fine structural aspects of vascular invasion of the tibial epiphyseal plate of growing rats. Acta Anat 69:117.
  • 16
    Matsui Y, Alini M, Webber C, Poole AR 1991 Characterization of aggregating proteoglycans from the proliferative, maturing, hypertrophic, and calcifying zones of the cartilaginous physis. J Bone Joint Surg Am 73:10641074.
  • 17
    Mwale F, Billinghurst C, Wu W, Alini M, Webber C, Reiner A, Ionescu M, Poole J, Poole AR 2000 Selective assembly and remodelling of collagens II and IX associated with expression of the chondrocyte hypertrophic phenotype. Dev Dyn 218:648662.
  • 18
    Dean DD, Muniz OE, Berman I, Pita JC, Carreno MR, Woessner JF Jr, Howell DS 1985 Localization of collagenase in the growth plate of rachitic rats. J Clin Invest 76:716722.
  • 19
    Brown CC, Henry RM, Reynolds JJ 1989 Immunolocalization of metalloproteinases and their inhibitor in the rabbit growth plate. J Bone Joint Surg Am 71:580593.
  • 20
    Blair HC, Dean DD, Howell DS, Teitelbaum SL, Jeffrey JJ 1989 Hypertrophic chondrocytes produce immunoreactive collagenase in vivo. Connect Tissue Res 23:6573.
  • 21
    Vaughan L, Mendler M, Huber S, Bruckner P, Winterhalter KH, Irwin MI, Mayne R 1988 D-periodic distribution of collagen type IX along cartilage fibrils. J Cell Biol 106:991997.
  • 22
    Poole AR 1997 Cartilage in health and disease. In: KoopmanWJ (ed.) Arthritis and Allied Conditions. A Textbook of Rheumatology, vol. 13. Williams and Wilkins, Baltimore, MD, USA, pp. 255308.
  • 23
    van der Rest M, Mayne R, Ninomiya Y, Seidah NG, Chretien M, Olsen BR 1985 The structure of type IX collagen. J Biol Chem 260:220225.
  • 24
    Ayad S, Marriott A, Brierley VH, Grant ME 1991 Mammalian cartilage synthesizes both proteoglycan and non-proteoglycan forms of type IX collagen. Biochem J 278:441445.
  • 25
    Nishimura I, Muragaki Y, Olsen BR 1989 Tissue-specific forms of type IX collagen-proteoglycan arise from the use of two widely separated promoters. J Biol Chem 264:2003320041.
  • 26
    Brewton RG, Wright DW, Mayne R 1991 Structural and functional comparison of type IX collagen-proteoglycan from chicken cartilage and vitreous humor. J Biol Chem 266:47524757.
  • 27
    Irwin MH, Mayne R 1986 Use of monoclonal antibodies to locate the chondroitin sulfate chain(s) in type IX collagen. J Biol Chem 261:1628116283.
  • 28
    van der Rest M, Mayne R 1988 Type IX collagen proteoglycan from cartilage is covalently cross-linked to type II collagen. J Biol Chem 263:16151618.
  • 29
    Wu JJ, Woods PE, Eyre DR 1992 Identification of cross-linking sites in bovine cartilage type IX collagen reveals an antiparallel type II-type IX molecular relationship and type IX to type IX bonding. J Biol Chem 267:2300723014.
  • 30
    Eyre DR, Apon S, Wu JJ, Ericsson LH, Walsh KA 1987 Collagen type IX: Evidence for covalent linkages to type II collagen in cartilage. FEBS Lett 220:337341.
  • 31
    Eyre DR, Wu JJ 1995 Sites of stromelysin cleavage in collagen types II, IX, X, and XI of cartilage. J Rheumatol 22:8285.
  • 32
    Diab M, Wu JJ, Eyre DR 1996 Collagen type IX from human cartilage: A structural profile of intermolecular cross-linking sites. Biochem J 314:327332.
  • 33
    Vasios G, Nishimura I, Konomi H, van der Rest M, Ninomiya Y, Olsen BR 1988 Cartilage type IX collagen-proteoglycan contains a large amino-terminal globular domain encoded by multiple exons. J Biol Chem 263:23242329.
  • 34
    Muragaki Y, Nishimura I, Henney A, Ninomiya Y, Olsen BR 1990 The alpha 1 (IX) collagen gene gives rise to two different transcripts in both mouse embryonic and human fetal RNA. Proc Natl Acad Sci USA 87:24002404.
  • 35
    Muragaki Y, Kimura T, Ninomiya Y, Olsen BR 1990 The complete primary structure of two distinct forms of human alpha 1 (IX) collagen chains. Eur J Biochem 192:703708.
  • 36
    Nakata K, Ono K, Miyazaki J, Olsen BR, Muragaki Y, Adachi E, Yamamura K, Kimura T 1993 Osteoarthritis associated with mild chondrodysplasia in transgenic mice expressing alpha 1(IX) collagen chains with a central deletion. Proc Natl Acad Sci USA 90:28702874.
  • 37
    Fassler R, Schnegelsberg PN, Dausman J, Shinya T, Muragaki Y, McCarthy MT, Olsen BR, Jaenisch R 1994 Mice lacking alpha 1 (IX) collagen develop noninflammatory degenerative joint disease. Proc Natl Acad Sci USA 91:50705074.
  • 38
    Muragaki Y, Mariman EC, van Beersum SE, Perala M, van Mourik JB, Warman ML, Olsen BR, Hamel BC 1996 A mutation in the gene encoding the alpha 2 chain of the fibril- associated collagen IX, COL9A2, causes multiple epiphyseal dysplasia (EDM2). Nat Genet 12:103105.
  • 39
    Paassilta P, Lohiniva J, Annunen S, Bonaventure J, Le Merrer M, Pai L, Ala-Kokko L 1999 COL9A3: A third locus for multiple epiphyseal dysplasia. Am J Hum Genet 64:10361044.
  • 40
    Hollander AP, Heathfield TF, Webber C, Iwata Y, Bourne R, Rorabeck C, Poole AR 1994 Increased damage to type II collagen in osteoarthritic articular cartilage detected by a new immunoassay. J Clin Invest 93:17221732.
  • 41
    Billinghurst RC, Dahlberg L, Ionescu M, Reiner A, Bourne R, Rorabeck C, Mitchell P, Hambor J, Diekmann O, Tschesche H, Chen J, Van Wart H, Poole AR 1997 Enhanced cleavage of type II collagen by collagenases in osteoarthritic articular cartilage. J Clin Invest 99:15341545.
  • 42
    Pal S, Tang LH, Choi H, Habermann E, Rosenberg L, Roughley P, Poole AR 1981 Structural changes during development in bovine fetal epiphyseal cartilage. Coll Relat Res 1:151176.
  • 43
    Baginsky ES, Marie SS, Clark WL, Zak B 1973 Direct microdetermination of serum calcium. Chim Acta 46:4654.
  • 44
    Ames BN 1966 Assay of inorganic phosphate, total phosphate, and phosphatases. Methods Enzymol 8:115118.
  • 45
    Chomczynski P, Sacchi N 1987 Single step Method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156159.
  • 46
    Alini M, Kofsky Y, Wu W, Pidoux I, Poole AR 1996 In serum-free culture thyroid hormones can induce full expression of chondrocyte hypertrophy leading to matrix calcification. J Bone Miner Res 11:105113.
  • 47
    Puissant C, Houdebine LM 1990 An improvement of the single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Biotechniques 8:148149.
  • 48
    Freije JM, Diez-Itza I, Balbin M, Sanchez LM, Blasco R, Tolivia J, Lopez-Otin C 1994 Molecular cloning and expression of collagenase-3, a novel human matrix metalloproteinase produced by breast carcinomas. J Biol Chem 269:1676616773.
  • 49
    Henriet P, Rousseau GG, Eeckhout Y 1992 Cloning and sequencing of mouse collagenase cDNA. Divergence of mouse and rat collagenases from the other mammalian collagenases. FEBS Lett 310:175178.
  • 50
    Thomas JT, Kwan AP, Grant ME, Boot-Handford RP 1991 Isolation of cDNAs encoding the complete sequence of bovine type X collagen. Evidence for the condensed nature of mammalian type X collagen genes. Biochem J 273:141148.
  • 51
    Lum ZP, Hakala BE, Mort JS, Recklies AD 1996 Modulation of the catabolic effects of interleukin-1 beta on human articular chondrocytes by transforming growth factor-beta. J Cell Physiol 166:351359.
  • 52
    Farndale RW, Buttle DJ, Barrett AJ 1986 Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim Biophys Acta 883:173177.
  • 53
    Labarca C, Paigen K 1980 A simple, rapid, and sensitive DNA assay procedure. Anal Biochem 102:344352.
  • 54
    Wu LN, Ishikawa Y, Sauer GR, Genge BR, Mwale F, Mishima H, Wuthier RE 1995 Morphological and biochemical characterization of mineralizing primary cultures of avian growth plate chondrocytes: Evidence for cellular processing of Ca2+ and Pi prior to matrix mineralization. J Cell Biochem 57:218237.
  • 55
    Dziewiatkowski DD 1987 Binding of calcium by proteoglycans in vitro. Calcif Tissue Int 40:265269.
  • 56
    Hunter GK 1991 Role of proteoglycan in the provisional calcification of cartilage. A review and reinterpretation. Clin Orthop 262:256280.
  • 57
    Wu W, Mwale F, Tchetina E, Kojima T, Yasuda T, Poole AR 2001 Cartilage matrix resorption in skeletogenesis. Novartis Found Symp 232:158166.
  • 58
    Kojima T, Mwale F, Yasuda T, Girard C, Poole AR, Laverty S 2001 Early degradation of type IX and type II collagen with the onset of experimental inflammatory arthritis. Arthritis Rheum 44:120127.
  • 59
    Mattot V, Raes MB, Henriet P, Eeckhout Y, Stehelin D, Vandenbunder B, Desbiens X 1995 Expression of interstitial collagenase is restricted to skeletal tissue during mouse embryogenesis. J Cell Sci 108:529535.
  • 60
    Gack S, Vallon R, Schmidt J, Grigoriadis A, Tuckermann J, Schenkel J, Weiher H, Wagner EF, Angel P 1995 Expression of interstitial collagenase during skeletal development of the mouse is restricted to osteoblast-like cells and hypertrophic chondrocytes. Cell Growth Differ 6:759767.
  • 61
    Johansson N, Saarialho-Kere U, Airola K, Herva R, Nissinen L, Westermarck J, Vuorio E, Heino J, Kahari VM 1997 Collagenase-3 (MMP-13) is expressed by hypertrophic chondrocytes, periosteal cells, and osteoblasts during human fetal bone development. Dev Dyn 208:387397.
  • 62
    Stahle-Backdahl M, Sandstedt B, Bruce K, Lindahl A, Jimenez MG, Vega JA, Lopez-Otin C 1997 Collagenase-3 (MMP-13) is expressed during human fetal ossification and re-expressed in postnatal bone remodeling and in rheumatoid arthritis. Lab Invest 76:717728.
  • 63
    Douglas SP, Jenkins JM, Kadler KE 1998 Collagen IX: Evidence for a structural association between NC4 domains in cartilage and a novel cleavage site in the alpha 1(IX) chain. Matrix Biol 16:497505.