SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Understanding the interaction between human embryonic stem cells (hESCs) and their microenvironment is crucial for the propagation and the differentiation of hESCs for therapeutic applications. hESCs maintain their characteristics both in serum-containing and serum-replacement (SR) media. In this study, the effects of the serum-containing and SR culture media on the gene expression profiles of hESCs were examined. Although the expression of many known embryonic stem cell markers was similar in cells cultured in either media, surprisingly, 1,417 genes were found to be differentially expressed when hESCs cultured in serum-containing medium were compared with those cultured in SR medium. Several genes upregulated in cells cultured in SR medium suggested increased metabolism and proliferation rates in this medium, providing a possible explanation for the increased growth rate of nondifferentiated cells observed in SR culture conditions compared with that in serum medium. Several genes characteristic for cells with differentiated phenotype were expressed in cells cultured in serum-containing medium. Our data clearly indicate that the manipulation of hESC culture conditions causes phenotypic changes of the cells that were reflected also at the level of gene expression. Such changes may have fundamental importance for hESCs, and gene expression changes should be monitored as a part of cell culture optimization aiming at a clinical use of hESCs for cell transplantation.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Human embryonic stem cells (hESCs) provide new opportunities for cell transplantation in severe degenerative diseases [1, 2]. To enable the use of hESCs in cell transplantation in humans, it is essential to eliminate the risk of infection transmitted by animal pathogens. Recent data have also suggested that hESCs cultured in the presence of animal proteins express an immunogenic nonhuman sialic acid [3]. Therefore, nonhuman sera and feeder cells in the hESC culture systems should be replaced by alternatives. The establishment of hESC lines was first described by using fetal calf serum (FCS)-containing medium and fetal mouse fibroblasts as feeder cells [4, 5]. hESC lines have recently been successfully cultured under serum-free conditions using serum replacement (SR) [6] and without feeder cells on matrigel using mouse embryonic fibroblast (MEF)-conditioned medium [7, 8]. Completely serum-free culturing conditions using SR medium and postnatal human fibroblasts as feeder cells have been described [9]. Recently, a feeder- and serum-free system for culturing hESCs on fibronectin matrix was described [10]. In the study, transforming growth factor β1 (TGFβ1), basic fibroblast growth factor (bFGF), and leukemia inhibitory factor (LIF) were added to the 20% SR culture medium, and the cells were successfully propagated. However, judging by morphology, differentiation of cells was seen in the colonies [10]. hESCs have previously been shown to maintain all ES cell characteristics as nondifferentiated cells when cultured either in FCS- or SR-containing medium with adequate supplements [46]. In mouse ESC cultures, the feeder layer can be replaced by addition of LIF to the growth medium [11]. However, hESCs seem to lack this response to LIF [4, 5] and therefore the use of LIF in the growth medium is probably unnecessary. The SR medium has been shown to require the supplementation of bFGF to prevent differentiation of hESCs [6].

FCS is a complex mixture containing compounds with both beneficial and adverse effects on hESCs, and FCS batches vary in capability of maintaining hESCs at an undifferentiated stage. To avoid these problems and to develop entirely animal-free culture conditions, we have optimized the SR culture conditions for our hESC lines that have been derived and growing on postnatal human foreskin fibroblasts [12]. Our hESCs maintained their pluripotency both in serum-containing and SR medium, but in SR medium they proliferated faster [13]. It is unknown why SR medium supports the growth of hESCs better than serum-containing medium. Because both culture media support the pluripotent nondifferentiated growth of hESCs, the factors responsible for the better growth rate seen in SR medium are unlikely to regulate the mechanisms responsible for the pluripotency of hESCs. In the present work, we studied the effects of two different culture media, a serum-containing and a serum-free one, on the gene expression profiles of hESCs. We used DNA microarray analysis, which allows a large-scale gene expression profiling from a limited amount of starting material. High-density oligonucleotide microarrays, containing most of the known human genes as well as thousands of unknown ESTs, are especially useful tools for studying unknown changes in hESCs caused by different culture media.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

hESC Lines

The hESC lines HS181, HS235, and HS237 from Karolinska University Hospital Huddinge were derived and cultured in FCS-containing medium on human foreskin fibroblast feeder cells. The derivation and characterization of the line HS181 has been previously described [12], and HS235 and HS237 lines have been characterized accordingly. All of these lines have a karyotype 46XX [14]. They express markers typical for hESCs, alkaline phosphatase, SSEA-4, TRA-1-0, TRA-1-1, and Oct-4 but are SSEA-1 negative. The pluripotency has been demonstrated by the formation of teratomas when injected to severe combined immunodeficiency mice and by in vitro differentiation of embryoid bodies expressing markers from three embryonic germ cell layers [12, 13].

hESC Cultures

The human foreskin fibroblasts (CRL-2429, American Type Culture Collection, Manassas, VA, http://www.atcc.org) used as feeder cells were mitotically inactivated by irradiation (35 Gy) and cultured in Iscove's medium supplemented with 10% FCS (Stem Cell Technologies, Vancouver, British Columbia, Canada, http://www.stemcell.com). After the formation of a confluent monolayer, feeder cells were cultured in hESC medium containing serum or SR. The hESCs were cultured on feeder cells in two different media. The serum medium consisted of Knockout Dulbecco's modified Eagle's medium (DMEM), 20% FCS (Stem Cell Technologies), 2 mM L-glutamine, 0.1 mM beta-mercaptoethanol, 1% penicillin streptomycin, 1% nonessential amino acid, and 1 μl/ml recombinant human LIF (Chemicon, Temecula, CA, http://www.chemicon.com). Originally the hESCs were cultured in serum medium but moved into SR medium for 12 weeks (∼16 passages). The SR medium consisted of Knockout DMEM, 20% Knockout SR, 2 mM L-glutamine, 1% penicillin streptomycin, 1% nonessential amino acids, 0.5 mM beta-mercaptoethanol, 1% ITS (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), and 8 ng/ml bFGF (R&D Systems, Minneapolis, http://www.rndsystems.com). All of the chemicals were from Gibco (Grand Island, NY, http://www.invitrogen.com) unless stated otherwise.

Oligonucleotide Microarray Analysis Using the HS237 Line

The total RNA was isolated from 5 to 10 HS237 hESC colonies cultured for 37 passages using an RNeasy mini kit (Qiagen Nordic, West Sussex, UK, http://www1.qiagen.com). hESC colonies were selected under a light microscope to avoid colonies that might have started to differentiate. Because the possible RNA contamination from the fibroblasts in the isolated RNA cannot entirely be avoided, the total RNA from human foreskin fibroblast was included in the study as a control sample. Human foreskin fibroblasts were plated in serum-containing medium and transferred into SR-containing medium for 1 week before the RNA isolation. From all RNA samples, 100 ng of total RNA was used as a starting material for the microarray sample preparation. The sample preparation was performed according to the Affymetrix two-cycle GeneChip eukaryotic small-sample target labeling assay version II (Affymetrix, Santa Clara, CA, http://www.affymetrix.com). Biotin-labeled cRNA 15 μg was fragmented and hybridized to HG-U133A and HG-U133B arrays. Arrays were stained and scanned according to Affymetrix protocols. Microarray analyses were performed for two biological replicates of HS237 cells and fibroblasts.

The gene transcript levels were determined from data images with algorithms in the GeneChip Microarray Suite software (Affymetrix MAS version 5.0), and further analysis of data was performed with Kensington software (InforSense, London, http://www.inforsense.com). At the detection level, each probe set was assigned to call of present (P), absent (A), or marginal (M). A gene with detection call “present” was considered to be expressed. The comparison level analysis of the cells cultured in serum or SR medium defined a gene as differentially expressed if change call (change p < .05) was increased (I/MI) or decreased (D/MD). A gene was defined as significantly upregulated if the signal fold-change (FC) between the target sample and the reference sample was larger than 2 and target sample was present. A gene was defined as significantly downregulated if FC was less than -2 and the reference sample was present. As recommended by Affymetrix, the probe sets were excluded if the detection call for both the target and the reference was “absent” or if the change call gave no change (NC) (change p > .05) in the comparison analysis. Only genes that fulfilled all the filtering criteria reproducibly in two biological replicates were considered significant. The signal values and detection calls for all the genes gained with algorithms in the MAS software are available upon request.

Validation of the Microarray Results

To validate microarray results gained with HS237 line, the HS181 and HS235 hESC lines were cultured in similar culture conditions as the HS237 line. At the onset of RNA isolation, the hESC lines HS181 and HS235 had been cultured for 34 and 50 passages, respectively. For the validation of the microarray results with TaqMan real-time reverse transcription–polymerase chain reaction (RT-PCR) and RT-PCR, a set of 15 genes was selected (Table 1). Primers and probes were designed by Primer Express software (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com) and made by CyberGene AB (Huddinge, Sweden, http://www.cybergene.se) and DNA Technology (Aarhus, Denmark, http://www.dna-technology.dk). The sequences for the primers and probes and the cycle conditions for RT-PCR are listed in Table 1. Total RNA 100 ng from cells was used for cDNA synthesis using Sensiscript Reverse Transcription kit (Qiagen). The TaqMan experiments were performed using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) as described previously [15]. The relative levels of the target mRNA expression were normalized against GAPDH expression. All measurements were performed in duplicate in two separate runs using samples derived from two biological replicates. The standard deviation of individual Taq-Man measurements had to be less than 0.5.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

DNA Microarray Analyses

Expression Profiling of hESCs Cultured in Serum-Containing and SR Media

The mRNA expression patterns of HS237 hESCs cultured in serum-containing or SR medium were compared using Affymetrix microarrays, which enable a large-scale gene expression profiling of ∼39,000 transcripts and variants, including more than 33,000 well-substantiated human genes. Biological replicates for all of the samples showed a correlation coefficient ≥ 0.963, indicating a high reproducibility of the data. The average signal fold-change (AverageFC) of the genes expressed in hESCs cultured in serum-containing versus SR medium was calculated from two biological replicates. To exclude redundant genes included in arrays (total number of probe sets, 44,928), Unigene IDs were used in analyses.

Using microarrays, we identified 10,460 nonredundant transcripts (15,707 probe sets) expressed both in cells cultured in serum and SR medium (Fig. 1). A total of 947 of these 10,460 shared genes were upregulated (change p < .05), and 82 of these genes were more than twofold upregulated in the cells cultured in serum-containing medium compared with the cells cultured in SR medium. On the other hand, 470 of the 10,460 shared genes were upregulated (change p < .05) and 13 were more than twofold upregulated in the cells cultured in SR medium compared with the cells cultured in serum-containing medium.

thumbnail image

Figure Figure 1.. Combination Venn diagram of shared and specific genes expressed in HS237 hESCs cultured in two different culture media, serum-containing and SR medium. The region of overlap between all areas indicates the number of genes expressed in hESCs cultured in either culture medium. Regions not overlapping indicate genes expressed specifically in hESCs cultured in the indicated culture medium. Ellipses represent differentially expressed (p < .05) genes; rectangles, greater than twofold differentially expressed genes in hESCs cultured in serum or SR medium. Abbreviations: hESC, human embryonic stem cell; SR, serum replacement.

Download figure to PowerPoint

There were also genes that were characteristic for the cells cultured in one of the media used; 156 and 677 transcripts were expressed specifically in cells cultured in SR or serum medium, respectively (Fig. 1). Ninety-one of these medium-specific genes were expressed more than twofold in cells cultured in serum medium compared with the signal level of the cells cultured in SR medium. Thirteen of these medium-specific genes were expressed more than twofold in the cells cultured in SR medium compared with the signal level of the cells in serum-containing medium.

Expression of ESC Markers

Among the genes expressed at similar levels (NC, change p > .05) in cells cultured in either medium, there were many ESC markers, such as Oct-4, Nanog, Cripto, and DNMT3B (Table 2). Some of the known ES cell markers, such as LIFR, IL6ST(gp130), connexin 43, CD9, Tcf3, and galanin, were also expressed in the fibroblast control sample. The use of this group of genes as markers in expression studies is complicated because there is a possibility that some signal may come from the feeder cell. Among these genes, gp130 was upregulated more than twofold (AverageFC, 2.39) in cells cultured in serum medium compared with cells in SR medium. Also, LIFR was slightly upregulated (AverageFC, 1.19) in the cells cultured in serum medium, although its relative expression level was very low. The telomere repeat binding factor (TERF) expression was downregulated (AverageFC, −1.1) in cells cultured in serum medium compared with the cells cultured in SR medium. The transcriptional coactivator UTF1 was expressed only in the cells cultured in SR medium (Average FC, −2.0).

Markers for differentiated cell phenotypes, such as GFAP, SOX-1, MYF5, and GATA-2, were not expressed in hESCs cultured in either medium. Among the early differentiation markers (keratin 8, keratin 18, beta tubulin 5, cardiac actin, and troponin T1) reported by another study [16], all genes except for beta tubulin 5 were expressed in hESCs cultured in either medium, suggesting that these genes may also be useful markers for early differentiation in our culture conditions. According to our microarray results, the differentiation markers GATA6 and SOX17 were expressed only in cells cultured in serum medium (Average FC, 3.43 and 3.1, respectively). All of these differentiation markers, except for troponin T1, beta tubulin 5, and SOX17, were also expressed in the fibroblast control sample, but the expression was higher in hESCs.

Differentially Expressed Genes in hESCs Cultured in Serum-Containing and SR Media

Among the 10,460 genes expressed in cells cultured in serum and SR media, we detected 1,417 differentially expressed genes, 947 upregulated in cells cultured in serum medium and 470 upregulated in cells cultured in SR medium. The full list of these genes is available on request. For the analyses we used a hierarchical clustering of log-transformed signal values. The gene expression profiles obtained using the biological replicates of each sample clustered well together. As expected, the hESCs cultured in different conditions were more closely related to each other than to fibroblast samples (Fig. 2A). On the other hand, we performed clustering analyses also for the genes whose expression showed more than twofold difference between the cells cultured in serum and SR media. In those analyses, the gene expression profiles of the cells cultured in serum medium clustered more closely together with those of fibroblasts, perhaps indicating that the cells cultured in serum medium were more differentiated than those cultured in SR medium (Fig. 2B). A total of 1,417 differentially expressed genes were further classified by biological function using NetAffex (Affymetrix) database. Approximately 40% of these differentially expressed genes had no known biological function (Fig. 3). Among the 947 genes whose expression was increased in cells cultured in serum medium, there were genes mainly involved in signaling, development, protein modifications, proliferation/regulation of proliferation or cell cycle, regulation of transcription, and cell adhesion (Fig. 3A). On the other hand, among the 470 genes whose expression was increased in cells cultured in SR medium, there were genes mainly involved in signaling, development, and cell proliferation (Fig. 3B).

thumbnail image

Figure Figure 2.. Hierarchical clustering of biological replicates. Log-transformed signals from all samples were clustered using hierarchical clustering. The colors indicate the relative expression level of each gene in all analyzed samples, with red indicating higher expression and dark color indicating lower expression. The length of the arms is proportional to the similarities of expression pattern, with shorter length representing a closer relationship. (A): The dendrogram presenting expression pattern of 1,417 differentially expressed genes in HS237 hESCs cultured in serum and SR media. (B): The dendrogram presenting expression pattern of 95 genes differentially expressed greater than twofold in HS237 hESCs compared with those cultured in serum or SR media. A full list of genes differentially expressed greater than twofold is presented in Tables 3 and 4. Samples in both dendrograms are hESCs in SR medium (1, 2), hESCs in serum medium (3, 4), and fibroblasts (5, 6). Abbreviations: hESC, human embryonic stem cell; SR, serum replacement.

Download figure to PowerPoint

thumbnail image

Figure Figure 3.. A pie chart presenting biological function of 1,417 differentially expressed genes in HS237 human embryonic stem cells when comparing cells cultured in serum or SR media. (A): Percentages of 947 genes upregulated in cells cultured in serum medium compared with cells in SR medium. (B): Percentages of 470 genes upregulated in cells cultured in SR medium compared with cells in serum medium. Annotation was made using NetAffex database (Affymetrix). Abbreviation: SR, serum replacement.

Download figure to PowerPoint

Next, we used twofold cut-off in expression level to identify the most differentially expressed genes. Eighty-two of the shared but differentially expressed genes were upregulated more than twofold in the cells cultured in serum medium compared with the cells cultured in SR medium (Fig. 1, Table 3). This group included genes involved in the regulation of transcription (EOMES, MAFF), development (COL12A1, COL2A1, FBN1, ACTC, ACTA2, TAGLN2, CALD, VEGFC, POSTN, GREM1), the regulation of cell growth (IGFBP3, IGFBP7, CTGF), and cell adhesion (FLRT3, OSF2, TNC, TGFBI, CD44, CDH11). Among the shared but differentially expressed genes, only 13 of the genes were upregulated more than twofold in cells cultured in SR medium compared with the cells cultured in serum medium, including genes involved in metabolism (NME4, INDO) and 6 genes without a known biological function (Fig. 1, Table 4).

hESCs cultured in serum or SR medium also expressed genes that were specific for a certain culture medium (Fig. 1). Ninety-one of these medium-specific genes were expressed more than twofold in cells cultured in serum medium but not in cells cultured in SR medium (Table 5). These 91 transcripts included genes involved in development (ACTA1, COMP, BDNF, NRPI, Nodal), development/regulation of transcription (HOXA1, GATA6, SOX17, TBX5, TBX3, SIX1, BHLHB2, FOXD1, INSM1, NR2F1), and cell adhesion (ALCAM, PARVA, PCDH10). The 13 transcripts, expressed only in cells cultured in SR medium, included two genes involved in ion transport (KCNK12, SCNNIG), UTF1 involved in the regulation of transcription, and seven genes without a known biological function (Table 6).

Given the differences observed in the growth rate of hESCs cultured in serum and SR medium [13], we assumed that cells may display additional differences in their signaling pathways related to cell growth. Wnt signaling has been implicated in maintaining undifferentiated ES cells. There were 35 transcripts involved in the Wnt signaling pathway that were expressed in cells cultured either in serum or SR media. Six of these genes (PAFAH1B1, PLAU, LDLR, WNT5A, CCND1/Cyclin D1, GSK3B) were upregulated in the cells cultured in serum medium compared with the cells cultured in SR medium but by less than twofold. Recently, one group reported a finding that the activation of the canonical Wnt pathway by inactivation of GSK3 is sufficient to maintain the self-renewal of hESCs [17]. In our study, the level of GSK3 expression was slightly upregulated (AverageFC, 0.7) in the cells cultured in serum medium, suggesting possible early differentiation of the cells compared with the cells cultured in SR medium.

The negative regulation of the TGFβ pathway might be critical for the maintenance of the undifferentiated hESCs [18]. The hESCs that were cultured in either one of the culture media expressed 26 genes involved in the TGFβ pathway. Seven of these genes (THBS1, TGIF, FST, SPP1, SMAD7, TGFBR1, SMAD1) were upregulated, and THBS1 and FST were upregulated more than twofold in the hESCs cultured in serum medium compared with those in SR medium. According to microarray results, one of the TGFβ pathway target genes, Serpine, was highly expressed (AverageFC, 3.4) in cells cultured in serum medium, and these results suggested a higher activity of TGFβ pathway in the hESCs cultured in serum medium compared with those in SR medium. Interestingly, the expression of Nodal (mesodermal and endodermal inducer) and, on the other hand, nodal signaling inhibitors CER1, LeftB, and FST was also upregulated more than twofold in cells cultured in serum medium compared with those cultured in SR medium, suggesting higher activity of Nodal signaling pathway in cells cultured in serum medium.

Because the SR medium requires a supplementation with bFGF to prevent the differentiation of hESCs [6], we checked the expression of genes related to the FGF signaling pathway. Among these genes, the expression of endogenous FGF2 and FGF13 was slightly upregulated (AverageFC, 1.9 and 1.0, respectively) in cells cultured in serum medium. One of the bFGF receptors, FGFR1, was upregulated (AverageFC, −1.5) in cells cultured in SR medium, possibly indicating a higher FGF receptor activity in the cells cultured in SR medium containing bFGF. The enrichment of FGFR1 expression in the undifferentiated hESCs compared with differentiated cells has been published [18].

Comparison of Differentially Expressed Genes with Previously Reported Microarray Results

To determine if differentially expressed genes in HS237 hESC line cultured in serum and SR media include ESC genes reported previously, we compared our data with the microarray data of hESCs cultured in various other culture conditions. A summary of the data comparison is presented in Table 7.

Sato et al. [18] reported 918 genes that were upregulated in undifferentiated hESCs cultured with matrigel and MEF-conditioned medium compared with the differentiated cells. In our study, 45 of the genes upregulated in the cells cultured in serum medium compared with the cells in SR medium were found in their list of genes upregulated in undifferentiated cells. On the other hand, in our study, 46 of the genes upregulated in the cells cultured in SR medium compared with cells in serum medium were found in their list of genes upregulated in undifferentiated cells. Sperger et al. [19] compared the gene expression profiles of five hESC lines cultured with MEF feeders and 20% SR medium to somatic cell lines. By using their Unigene ID annotation, we were able to compare their data with ours: 55 of the genes upregulated in our study in the cells cultured in serum medium compared with the cells in SR medium were among the genes found to be differentially expressed between hESC and somatic cell lines. On the other hand, 28 of the genes upregulated in our study in the cells cultured in SR medium compared with the cells in serum medium were among their genes. Bhattacharya et al. [16] compared six hESC lines to universal RNA and reported 92 genes that were upregulated in all six hESCs compared with universal RNA. Their cell lines were cultured on MEF feeders in a medium containing both serum and SR. In our study, only 11 of the genes upregulated in cells cultured either in serum or SR medium were found in their data. Among these genes was early differentiation marker α-cardiac actin, which in our study was only expressed in the cells cultured in serum medium but not in the cells cultured in SR medium, suggesting the presence of cells with a differentiated phenotype in the serum medium.

These three comparisons suggest that some of the genes in our study, which actually had less than twofold change in expression level between cells cultured in serum and SR media, may have a significant role in hESC characteristics and early differentiation because their expression was changed when undifferentiated hESCs were compared with the differentiated cells in the data published by Sato et al. [18], Sperger et al. [19], and Bhattacharya et al. [16]. This data comparison clearly demonstrates that when the gene expression profiles of hESCs cultured in various types of culture conditions are compared, only few genes are expressed in a similar manner.

Validation of Microarray Results Using Real-Time RT-PCR and RT-PCR

Selected genes were further analyzed by TaqMan real-time RT-PCR (Table 1), and the average fold-change values of the real-time RT-PCR from two separate runs are presented in Figure 4. Based on the microarray results, the expression of many known ESC markers were expressed at similar levels in HS237 cells cultured either in serum or SR medium. These findings were further studied by analyzing the kinetics of DNMT3B, Oct-4, and Nanog expression also in two other hESC lines cultured in a serum-containing and SR medium. TaqMan detection verified that the expression of Nanog was downregulated in all three hESC lines in serum medium compared with cells in SR medium, but by less than twofold. The expression of Oct-4 was downregulated in all three hESC lines cultured in serum medium, and this downregulation was more than fivefold in the HS181 line compared with the cells in SR medium. The expression of DNMT3B was also downregulated in all three hESC lines cultured in serum medium, and this downregulation was more than 25-fold in the HS181 line compared with the cells in SR medium.

thumbnail image

Figure Figure 4.. Verification of microarray results with TaqMan real-time quantitative RT-PCR. The expression of DNMT3B, gp130, UTF1, GATA6, FST, LIFR, DUSP6, OCT-4, and Nanog was analyzed using real-time RT-PCR. RNA isolated from three human embryonic stem cell lines cultured in serum-containing and SR medium was analyzed. All measurements were performed in duplicate in two separate runs using samples derived from two biological replicates. The relative levels of gene expression of target mRNA was normalized against GAPDH expression. The average ΔΔCt values of gene expression are presented as fold change (fold change = 2Δ Δ ΔCt) for cells cultured in serum medium as relation to expression in cells cultured in SR medium. Abbreviations: RT-PCR, reverse transcription–polymerase chain reaction; SR, serum replacement.

Download figure to PowerPoint

According to microarray results, some of the genes were expressed more than twofold in HS237 cells cultured in serum medium compared with cells cultured in SR medium. To further study these findings, the expression of FST and DUSP6 was studied in all three hESC lines. TaqMan analysis demonstrated that the expression of these genes was increased more than twofold only in HS237 cells cultured in serum medium compared with those cultured in SR medium showing hESC line–specific expression pattern. To further study our microarray findings showing that LIF receptors LIFR and gp130 were upregulated in HS237 cells cultured in serum medium, the expression of LIFR and gp130 was studied in all three hESC lines. These results showed that gp130 expression was increased more than twofold in all three lines cultured in serum medium compared with the cells in SR medium. LIFR also showed greater than twofold increases in HS181 and HS237 cells but, on the other hand, greater than twofold decreases in HS235 cells cultured in serum medium compared with the cells cultured in SR medium.

According to the microarray results, there were also genes that were characteristic for the cells cultured in one of the media used; GATA6 was expressed specifically at a greater than twofold higher level in HS237 cells cultured in serum medium and UTF1 in HS237 cells cultured in SR medium. These findings were further confirmed in HS181 and HS235 lines using TaqMan detection. RT-PCR showed the expression of Eomes in all three hESC lines cultured in both culture media, and this result was consistent with DNA microarray data from the HS237 line. Interestingly, SULF1 was not expressed in HS235 cells cultured in serum-containing medium but was expressed in both culture conditions in HS181 and HS237 cells. In contrast, among the genes that were according to microarray results specifically expressed in HS237 cells cultured in serum (SOX17, Serpine, TBX5), only SOX17 showed a specific expression in HS237 cells cultured in serum medium. Serpine and TBX5 expression were detected in all three hESC lines in both conditions when more-sensitive RT-PCR was used for detection (Fig. 5).

thumbnail image

Figure Figure 5.. RT-PCR analysis of selected genes in three hESC lines cultured in serum-containing and SR media. A subset of genes was analyzed, including two genes expressed in HS237 cells cultured in either medium (SULF1 and Eomes) and three genes expressed only in HS237 cells cultured in certain culture medium (SOX17, Tbx5, Serpine). Only SOX17 showed medium-specific expression in HS237 cells cultured in serum medium, and other analyzed genes were expressed in all hESC lines cultured in either medium. − indicates RT-PCR–negative control. Abbreviations: hESC, human embryonic stem cell; RT-PCR, reverse transcription–polymerase chain reaction; SR, serum replacement.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

We have previously shown that our hESC lines maintain their characteristics as nondifferentiated pluripotent cells when cultured either in a serum-containing or SR medium and that cells proliferate faster in a SR medium [1214]. In this study, our goal was to study whether these two culture conditions influence the gene expression profiles of hESCs. Moreover, we were interested in elucidating whether factors in SR medium support the undifferentiated growth of hESCs better than those in serum-containing medium. According to microarray results, there were many known ES cell markers among the genes whose expression profiles were similar in the cells cultured in either medium, supporting our assumption that the factors responsible for the better growth rate seen in SR medium are unlikely to regulate functions behind the pluripotency of hESCs.

Using real-time RT-PCR, a slight downregulation in the expression of DNMT3B, Oct-4, and Nanog in all three hESC lines cultured in serum medium was seen when compared with the gene expression in cells cultured in a SR medium (Fig. 4). On the other hand, according to the microarray results, the downstream genes of Oct-4, such as platelet-derived growth factor α receptor and Osteopontin [20], were upregulated in HS237 cells cultured in serum medium, showing that the slight decrease of Oct-4 expression had no effect on their expression. According to microarray results, the expression of Sox-2 was also slightly downregulated (AverageFC, −1.5) in HS237 cells cultured in serum medium compared with the cells cultured in SR medium. Sox-2 cooperates with Oct-4 in stimulation of UTF1 transcription [21]. In mouse ESCs, the disappearance of UTF1 expression precedes that of Oct-4 and Sox-2 [21]. Similarly, in our culture conditions, UTF1 may be an important marker for an early differentiation because it was downregulated more than twofold in all three hESC lines cultured in serum medium compared with those cultured in SR medium (Fig. 4). Also, the downregulation of TERF in HS237 cells cultured in serum medium compared with the cells cultured in a SR medium suggested a presence of differentiated cells in serum medium.

Although human ESCs seem to lack the response to LIF [4, 5], it is possible that added LIF in serum medium may induce the expression of LIF receptors (LIFR and gp130). Recent data showed that the STAT3 signaling pathway can be stimulated by LIF in hESCs but that the level of activation is much lower than in mouse ESCs [17]. In HS237 cells, STAT3 and SOCS-1, inhibitor of STAT3 signaling, were expressed in the cells cultured in either culture medium without changes, but SOCS-3 was upregulated (AverageFC 1.5) in the cells cultured in serum medium. This is in concordance with the results in mouse ESCs, which showed that the expression of SOCS-3 (but not SOCS-1) was increased in the presence of LIF [22]. It has been suggested that constitutive expression of SOCS1 and SOCS3 may inhibit LIF signal transduction in embryonal carcinoma cells and that the silencing of endogenous SOCS-1 in hESCs could make the culturing of these cells more feasible [23]. In our study, in Smad7 and especially Smad1, involved in a complex formation with STAT3 [24], the expression was slightly increased in HS237 cells cultured in serum medium compared with the cells cultured in SR medium. Recently, one group reported that four of their hESC lines cultured without LIF expressed no LIF receptors [7], supporting the possibility that LIF may increase the expression of its receptors and genes related to LIF signaling when added in a culture medium. On the other hand, our preliminary data suggest that the expression of these receptors is not induced by LIF in a dose-dependent manner (Aghajanova et al., unpublished data), and it is most likely that the expression of LIF receptors is increased during hESC differentiation.

As seen in microarray data, among the genes upregulated more than twofold in HS237 cells cultured in serum medium compared with cells in SR medium, many genes known to be expressed in differentiated cells were identified. The cluster analysis of these genes also showed that hESCs cultured in a serum medium clustered more closely to fibroblasts than to the hESCs cultured in SR medium. These results suggest the presence of differentiating cells in serum medium, although these cells were classified as undifferentiated cells by morphology. Based on our data, the downregulation of UTF1 and especially the upregulation of GATA6, an inducer of endodermal differentiation [25], are good markers for early differentiation. GATA6 expression was shown to increase when the expression of Oct-4 was decreased during hESC differentiation [26].

We found 1,417 shared genes that were differentially expressed (p < .05) in HS237 cells cultured in similar conditions. The difference in the two culture media was that one contained serum and LIF and the other contained SR and bFGF. Approximately 40% of the shared but differentially expressed genes have no known biological function. Some of these genes may explain previously observed differences in the growth rate of hESCs [13], namely that the hESCs were growing faster in SR medium compared with those cultured in serum-containing medium. Several genes involved in the regulation of transcription, RNA processing, and cell proliferation were upregulated in HS237 cells cultured in SR medium, reflecting higher proliferation rates of cells in these conditions. TGFβ signaling pathway regulates cell proliferation, differentiation, and extracellular matrix production of cells, and TGFβ has been shown to inhibit the growth of epithelial cells through TGFB receptors [27, 28]. The expression of TGFBR1 receptor was upregulated in HS237 cells cultured in serum medium, suggesting higher activity of TGFβ signaling pathway in cells cultured in serum medium compared with the cells cultured in SR medium. The downregulation of SULF1 expression may enhance growth signaling in cancer cells, and cells expressing SULF1 have diminished proliferation [29]. Interestingly, in our data, the expression of SULF1 was upregulated (AverageFC, 3.6) in HS237 cells cultured in serum medium, suggesting a possibility that also in hESCs, SULF1 expression may diminish cell proliferation rate. The expression of Nodal and nodal signaling inhibitors CER1, LeftB, and FST was upregulated in HS237 cells cultured in serum medium compared with those in SR medium. CER1 inhibits Nodal signaling during embryonic development in mouse, and cell proliferation is inhibited in the same regions where CER1 is expressed [30]. In our study, CER1 was expressed only in HS237 cells cultured in serum medium, suggesting similar effects in hESCs, i.e., reduced cell proliferation in serum medium. Another gene, related to the inhibition of T-cell proliferation [31], GADD45A, was also slightly upregulated (AverageFC, 1.5) in HS237 cells cultured in serum-containing medium, but the functional impact of this and other genes of interest in this study on the proliferation of hESCs remains to be studied.

In addition to differences in growth rate in cells cultured in serum or SR medium, we have observed that hESCs attach better to culture plates in serum-containing than in SR medium. In our data, 50 cell adhesion–related genes, such as integrins, laminin receptors, and TGFBR1, were upregulated in HS237 cells cultured in serum medium compared with the cells cultured in SR medium. TGFBR1 has been shown to induce fibronectin expression [27], and we noticed that the expression of fibronectin was upregulated (AverageFC, 1.5) in HS237 cells cultured in serum medium. Homeobox genes such as HOXA1 may control the expression of genes encoding cell adhesion molecules [32]. This gene was specifically and highly expressed in HS237 cells cultured in serum medium. ALCAM, a transmembrane cell adhesion molecule, plays an important role in cell-to-cell interaction and is expressed in human blastocysts but not in eight-cell embryos or morulae [33, 34]. Our data suggest that AL-CAM plays an important role in hESC attachment as well because it was specifically expressed in HS237 cells cultured in serum medium but not in the cells cultured in SR medium.

Generally, gene expression studies have focused on large differences due to the assumption that larger expression changes are biologically more important. However, it has been clearly demonstrated that, for example, differences of less than twofold in the amount of Oct-4 expression have important biological effects in ES cells [35]. If we consider only changes greater than twofold as biologically significant, we may lose a lot of important data, especially if we can rule out the effect of genetic variation on gene expression when a single hESC line is studied. As our data comparison with other microarray data shows, some of the genes that actually had less than twofold changes in expression level between HS237 cells cultured in serum and SR media may have a significant role in hESC characteristics and early differentiation. The detection of small changes challenges the microarray technology, but oligonucleotide microarrays are more sensitive to detect small changes in gene expression than cDNA microarrays [36].

Although hESCs cultured in two different culture conditions have shown similar ESC characteristics, our data clearly indicate that the manipulation of hESC culture conditions results in phenotypic changes of the cells. Such changes are also reflected at the level of gene expression. Because gene expression changes may have a fundamental importance for hESCs, such changes should be monitored as a part of cell culture optimization. The results presented in this study clearly support the previous findings favoring the use of SR medium rather than serum-containing medium for culturing of hESCs. The SR currently available is not entirely animal free because it contains animal proteins [10], so the development of totally animal-free culture systems aiming at clinical use of hESCs for cell transplantation in humans requires more effort.

Table Table 1.. Real-time quantitative reverse transcription–polymerase chain reaction (RT-PCR) and RT-PCR primers and probes
 RT-PCR Cycle Conditions

1) 5-Forward Primer-3

2) 5-Reverse Primer-3

3) 5-Probe-3for TaqMan

Oct-4 

1) TCTGCAGAAAGAACTCGAGCAA

2) AGATGGTCGTTTGGCTGAACAC

3) CCTCTTCTGCTTCAGGAGCTTGGCAA

Nanog 

1) TGCAGTTCCAGCCAAATTCTC

2) CCTAGTGGTCTGCTGTATTACATTAAGG

3) TCCAAAGCAGCCTCCAAGTCACTGG

DNMT3B 

1) CGAAAGGATGTTTGGCTTTCC

2) GACCTTCCCAGCAGCTTCTG

3) ACAGACGTGTCCAACATGGGCCGT

FST 

1) GTAAGTCGGATGAGCCTGTCTGT

2) CAGCTTCCTTCATGGCACACT

3) CCAGTGACAATGCCACTTATGCCAGC

Dusp6 

1) GCTGTGGCACCGACACAGT

2) ACTCGCCGCCCGTATTCT

3) CTCTACGACGAGAGCAGCAGCGACTG

LIFR 

1) ACTGTGGAAGATATAGCTGCAGAAGA

2) CACTGTTGCTGTCTATGGATCTAGGA

3) ATAAAACTGCGGGTTACAGACCTCAGGCC

gp130 

1) GCCTCAACTTGGAGCCAGATT

2) GTTTAAGGTCTTGGACAGTGAATGAAG

3) CTCCTGAAGACACAGCATCCACCCGA

GAPDH 

1) GTTCGACAGTCAGCCGCATC

2) GGAATTTGCCATGGGTGGA

3) ACCAGGCGCCCAATACGACCAA

UTF1 

1) GGCACCTGGGCGACATC

2) TCCACGTGCTGGTTCAAGGT

3) AACATCCTGGGCCCGCTGCG

Gata6 

1) GAGCACCAATCCCGAGAACA

2) GCGAGACTGACGCCTATGTAGA

3) CCCATCTTGACCCGAATACTTGAGCTCG

Sox17(annealing 57°C, 35 cycles)

1) CGCACGGAATTTGAACAGTA

2) CACACGTCAGGATAGTTGCAG

EOMES(annealing 57°C, 35 cycles)

1) ACCCCCTTCCATCAAATCTC

2) CCATGCCTTTTGAGGTGTCT

Sulf1(annealing 56°C, 35 cycles)

1) TCTTGGGGAGCTGAATAGGA

2) TGTAAGACCTCACCAAGTTCTGA

Tbx5(annealing 55°C, 35 cycles)

1) AGCACTTCTCCGCTCACTTC

2) CCGTGCACAGAGTGGTACTG

Serpine(annealing 62°C, 35 cycles)

1) TCCAGTTTTGTCCCAGATGA

2) ATCGAGGTGAACGAGAGTGG

Table Table 2.. A set of embryonic stem cell (ESC) markers expressed according to microarray results at similar levels in HS237 cells cultured in serum-containing or serum-replacement medium
ESC MarkerUnigene IDAnnotation
Nanog [37, 38]Hs.329296homeobox transcription factor
POU5F1, Oct-4 [35, 39]Hs.249184homeobox transcription factor
Cripto (TDGF1) [40]Hs.385870teratocarcinoma-derived growth factor 1
Connexin 45 [16, 41]Hs.532593gap junction protein, alpha 7, 45 kDA
DNMT3B [42]Hs.251673DNA (cytosine-5-)-methyltransferase 3 beta
ACVR2B [16]Hs.23994activin A receptor, type II
ABCG2 [16]Hs.194720ATP-binding cassette, subfamily G, member 2
PODXL [43]Hs.16426podocalyxin-like
REX-1 (Zfp42) [44]Hs.458361zinc finger protein 42
LIN28 [16]Hs.86154lin-28 homologue (C. elegans)
GDF3 [45, 46]Hs.86232growth-differentiation factor 3
PUM1 and PUM2 [47]Hs.153834/Hs.133543Pumilion 1 and 2
Nanos 1 [48]Hs.351851Nanos homologue 1
Table Table 3.. Genes expressed in HS237 hESCs cultured in either medium but upregulated more than twofold in hESCs cultured in serum medium compared with hESCs cultured in SR medium
  1. a

    Abbreviations: FC, fold change; hESC, human embryonic stem cell; SR, serum replacement.

Gene SymbolGene DescriptionAverage FC to Cells in SR MediumUnigene ID
IGFBP3insulin-like growth factor binding protein 34.4Hs.450230
EOMESeomesodermin homologue (Xenopus laevis)4.3Hs.147279
POSTNperiostin, osteoblast-specific factor4.2Hs.136348
ANXA1annexin A14.1Hs.287558
ACTA2actin, alpha 2, smooth muscle, aorta3.7Hs.208641
SULF1sulfatase 13.6Hs.409602
ANXA3annexin A33.5Hs.442733
CTGFconnective tissue growth factor3.5Hs.410037
SPP1secreted phosphoprotein 1 (osteopontin)3.4Hs.313
KIAA1199KIAA11993.4Hs.212584
GREM1gremlin 1 homologue, cysteine knot superfamily (Xenopus laevis)3.3Hs.40098
COL12A1collagen, type XII, alpha 13.3Hs.101302
TAGLNtransgelin3.3Hs.410977
TGFBItransforming growth factor, beta-induced, 68 kDa3.2Hs.421496
URBsteroid-sensitive gene 13.0Hs.356289
IGFBP7insulin-like growth factor binding protein 72.9Hs.435795
FBN2fibrillin 2 (congenital contractural arachnodactyly)2.9Hs.79432
Full-length cDNA clone CS0DF022YN12 of fetal brain of Homo sapiens2.9Hs.5921
TNCtenascin C (hexabrachion)2.8Hs.98998
full-length cDNA clone CS0DN003YO15 of adult brain of Homo sapiens2.8Hs.371609
CDH11cadherin 11, type 2, OB-cadherin (osteoblast)2.8Hs.443435
CALD1caldesmon 12.7Hs.443811
ACTCactin, alpha, cardiac muscle2.7Hs.118127
FSTfollistatin2.7Hs.9914
COL2A1collagen, type II, alpha 12.6Hs.408182
COL8A1collagen, type VIII, alpha 12.6Hs.114599
CD44CD44 antigen (homing function and Indian blood group system)2.6Hs.306278
FER1L3fer-1-like 3, myoferlin (C. elegans)2.6Hs.362731
LUMlumican2.6Hs.406475
TNFAIP6tumor necrosis factor, alpha-induced protein 62.6Hs.407546
ARK5AMP-activated protein kinase family member 52.5Hs.200598
NNMTnicotinamide N-methyltransferase2.5Hs.364345
COL5A2collagen, type V, alpha 22.5Hs.283393
HICI-mfa domain–containing protein/I-mfa domain–containing protein2.5Hs.132739
LOXlysyl oxidase2.5Hs.102267
PAPPApregnancy-associated plasma protein A, pappalysin 12.5Hs.440769
HAKheart alpha-kinase2.5Hs.388674
S100A10S100 calcium-binding protein A102.5Hs.143873
DKFZp434L142hypothetical protein DKFZp434L1422.5Hs.323583
FLJ23091putative NFkB-activating protein 3732.5Hs.297792
AMIGO2amphoterin-induced gene 22.5Hs.121520
DUSP6dual-specificity phosphatase 62.5Hs.298654
LEFTBleft-right determination, factor B2.5Hs.278239
SIPA1L2signal-induced proliferation-associated 1 like 22.4Hs.406879
CYBRD1cytochrome b reductase 12.4Hs.31297
DDR2discoidin domain receptor family, member 22.4Hs.440905
IL6STinterleukin 6 signal transducer (gp130, oncostatin M receptor)2.4Hs.71968
SLC40A1solute carrier family 40 (iron-regulated transporter), member 12.4Hs.409875
FLRT3fibronectin leucine-rich transmembrane protein 32.4Hs.41296
C14orf31chromosome 14 open reading frame 312.3Hs.439190
MGC4677hypothetical protein MGC46772.3Hs.432419
RBM24RNA-binding motif protein 242.3Hs.201619
THBS1thrombospondin 12.3Hs.164226
PTX3pentaxin-related gene, rapidly induced by interleukin-1 beta2.3Hs.2050
IER3immediate early response 32.3Hs.76095
NEK7NIMA (never in mitosis gene a)-related kinase 72.3Hs.24119
WNT5Awingless-type MMTV integration site family, member 5A2.2Hs.152213
TFPI2tissue factor pathway inhibitor 22.2Hs.438231
TAGLN2transgelin 22.2Hs.406504
CAV1caveolin 1, caveolae protein, 22 kDa2.2Hs.74034
NRIP1nuclear receptor–interacting protein 12.2Hs.155017
KIAA0992paladin2.2Hs.194431
MRNA; cDNA DKFZp762M127 (from clone DKFZp762M127)2.2Hs.12853
FLJ38507colon carcinoma–related protein2.2Hs.435013
CDK6cyclin-dependent kinase 62.2Hs.38481
RASGRF2Ras protein–specific guanine nucleotide-releasing factor 22.1Hs.410953
COL15A1collagen, type XV, alpha 12.1Hs.409034
VEGFCvascular endothelial growth factor C2.1Hs.79141
MRNA for hypothetical protein (ORF1), clone 002752.1Hs.152129
PRNPprion protein (p27–30)2.1Hs.438582
AMOTL2angiomotin-like 22.1Hs.426312
SLC7A5solute carrier family 7, member 52.1Hs.184601
JAK1Janus kinase 1 (a protein tyrosine kinase)2.1Hs.436004
MYLKmyosin, light polypeptide kinase2.0Hs.386078
CTHRC1collagen triple helix repeat-containing 12.0Hs.283713
PDGFCplatelet-derived growth factor C2.0Hs.43080
NQO1NAD(P)H dehydrogenase, quinone 12.0Hs.406515
MAFFv-maf musculoaponeurotic fibrosarcoma oncogene homologue F (avian)2.0Hs.460889
FLNCfilamin C, gamma (actin-binding protein 280)2.0Hs.58414
CAMK2Dcalcium/calmodulin-dependent protein kinase (CaM kinase) II delta2.0Hs.111460
DKFZP434B044hypothetical protein DKFZp434B0442.0Hs.262958
CYR61cysteine-rich, angiogenic inducer, 612.0Hs.8867
Table Table 4.. Genes expressed in HS237 hESCs cultured in either medium but upregulated more than twofold in hESCs cultured in SR medium compared with hESCs in serum-containing medium
  1. a

    Abbreviations: FC, fold change; hESC, human embryonic stem cell; SR, serum replacement.

Gene SymbolGene DescriptionAverage FC to Cells in Serum MediumUnigene ID
NME4nonmetastatic cells 4, protein expressed in2.6Hs.9235
INDOindoleamine-pyrrole 2,3 dioxygenase2.5Hs.840
GUCA1Aguanylate cyclase activator 1A (retina)2.4Hs.92858
EFHC2EF-hand domain (C-terminal)-containing 22.2Hs.301143
TROtrophinin/trophinin2.2Hs.434971
APOBEC3Bapolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3B2.2Hs.226307
NMIN-myc (and STAT) interactor2.2Hs.54483
PGAP1GPI deacylase2.1Hs.528683
MEG3maternally expressed 32.1Hs.418271
MRNA; cDNA DKFZp586E2317 (from clone DKFZp586E2317)2.0Hs.293563
ARHGEF9Cdc42 guanine nucleotide exchange factor (GEF) 92.0Hs.54697
HLA-DQB1major histocompatibility complex, class II, DQ beta 12.0Hs.409934
PCSK9proprotein convertase subtilisin/kexin type 92.0Hs.18844
Table Table 5.. Genes specifically expressed in HS237 hESCs cultured in serum-containing medium and with greater than twofold level compared with signal level in hESCs cultured in SR medium
  1. a

    Abbreviations: FC, fold change; hESC, human embryonic stem cell; SR, serum replacement.

Gene SymbolGene DescriptionAverage FC to Cells in SR MediumUnigene ID
SP5Sp5 transcription factor5.6Hs.368802
HOXA1homeobox A15.3Hs.67397
NR2F1nuclear receptor subfamily 2, group F, member 14.6Hs.361748
RGS5regulator of G-protein signaling 54.5Hs.24950
MFAP5microfibrillar-associated protein 54.5Hs.300946
COL12A1collagen, type XII, alpha 14.4Hs.101302
full-length cDNA clone CS0DI014YH214.3Hs.23871
COMPcartilage oligomeric matrix protein4.3Hs.1584
KIAA0882KIAA0882 protein4.3Hs.411317
SERPINE1serine (or cysteine) proteinase inhibitor, clade E, member 14.1Hs.414795
PARVAparvin, alpha4.1Hs.44077
URBsteroid-sensitive gene 14.1Hs.356289
FLJ21069hypothetical protein FLJ210694.1Hs.341806
SLC22A3solute carrier family 22 (extraneuronal monoamine transporter), member 34.0Hs.242721
CDNA FLJ38181 fis, clone FCBBF10001253.9Hs.143134
MGC109463.8Hs.130692
PAGphosphoprotein associated with glycosphingolipid-enriched microdomains3.8Hs.266175
LOC285458hypothetical gene supported by AK0969523.7Hs.381187
NPPBnatriuretic peptide precursor B3.7Hs.219140
GLIPR1GLI pathogenesis-related 1 (glioma)3.7Hs.511765
HRB2HIV-1 rev binding protein 23.7Hs.269857
PPP1R14Cprotein phosphatase 1, regulatory (inhibitor) subunit 14C3.6Hs.192822
CDNA FLJ44429 fis, clone UTERU20156533.6Hs.86538
TBX5T-box 53.5Hs.381715
NODALnodal homologue (mouse)3.5Hs.370414
APOA1apolipoprotein A-I3.5Hs.93194
INSM1insulinoma-associated 13.5Hs.89584
C9orf13chromosome 9 open-reading frame 133.5Hs.385887
GATA6GATA-binding protein 63.4Hs.50924
ALDH1A1aldehyde dehydrogenase 1 family, member A13.4Hs.76392
SYTL2synaptotagmin-like 23.4Hs.390463
BHLHB2basic helix-loop-helix domain–containing, class B, 23.3Hs.171825
SDCCAG33serologically defined colon cancer antigen 333.3Hs.284217
ALCAMactivated leukocyte cell adhesion molecule3.3Hs.10247
ARHGAP24Rho GTPase-activating protein 243.2Hs.442801
3.2Hs.124776
MBD2methyl-CpG-binding domain protein 23.2Hs.25674
IGFBP3insulin-like growth factor–binding protein 33.1Hs.450230
FBLN2fibulin 23.1Hs.198862
TBX3T-box 3 (ulnar mammary syndrome)3.0Hs.129895
AGPAT31-acylglycerol-3-phosphate O-acyltransferase 33.0Hs.443657
hypothetical gene supported by BX6476082.9Hs.411391
SEMA3Csema domain, immunoglobulin domain2.9Hs.171921
EPHA2EPH receptor A22.8Hs.171596
B1parathyroid hormone–responsive B1 gene2.8Hs.79340
PCDH10protocadherin 102.8Hs.146858
FER1L3fer-1-like 3, myoferlin (C. elegans)2.7Hs.362731
P4HA3procollagen-proline, 2-oxoglutarate 4-dioxygenase2.7Hs.440644
ADAMTS5A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif2.7Hs.58324
DKFZP564O0823DKFZP564O0823 protein2.7Hs.105460
KIAA1245hypothetical protein MGC89022.7Hs.445556
EBFearly B-cell factor2.6Hs.120785
GREM2gremlin 2 homologue, cysteine knot superfamily (Xenopus laevis)2.6Hs.207407
AHNAKAHNAK nucleoprotein (desmoyokin)2.6Hs.378738
FN1fibronectin 12.6Hs.418138
TSLPthymic stromal lymphopoietin2.5Hs.389874
COL4A1collagen, type IV, alpha 12.5Hs.437173
ACTA1actin, alpha 1, skeletal muscle2.5Hs.1288
RUNX2runt-related transcription factor 22.5Hs.122116
FAM46Afamily with sequence similarity 46, member A2.5Hs.10784
SIX1Sine oculis homeobox homologue 1 (Drosophila)2.5Hs.54416
LOC339535hypothetical protein LOC3395352.4Hs.532047
RGC32response gene to complement 322.4Hs.76640
FOXD1forkhead box D12.3Hs.96028
SIAH2seven in absentia homologue 2 (Drosophila)2.3Hs.20191
ODZ2Odz, odd Oz/ten-m homologue 2 (Drosophila)2.3Hs.173560
LTBP3latent transforming growth factor beta–binding protein 32.3Hs.289019
NAV3neuron navigator 32.3Hs.306322
CDNA FLJ43100 fis, clone CTONG20031002.3Hs.440492
SEMG1semenogelin I2.3Hs.1968
WASPIPWiskott-Aldrich syndrome protein-interacting protein2.3Hs.401414
AMOTL1angiomotin-like 12.3Hs.292781
NRP1neuropilin 12.2Hs.173548
NEXNnexilin (F actin–binding protein)2.2Hs.22370
DDX3YDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked2.2Hs.99120
ZNF25zinc finger protein 25 (KOX 19)2.2Hs.5856
TMEPAItransmembrane, prostate androgen–induced RNA2.2Hs.83883
DACH1dachshund homologue 1 (Drosophila)2.2Hs.63931
THSD2thrombospondin, type I, domain-containing 22.2Hs.135254
LMO7LIM domain 72.2Hs.5978
MAP4microtubule-associated protein 42.2Hs.31095
CDNA: FLJ23131 fis, clone LNG085022.1Hs.301296
CDC42EP3CDC42 effector protein (Rho GTPase–binding) 32.1Hs.352554
MFAP3LMicrofibrillar-associated protein 3-like2.1Hs.178121
PDE4DIPphosphodiesterase 4D–interacting protein (myomegalin)2.1Hs.502577
FBLN5fibulin 52.1Hs.11494
FLJ23091putative NFkB-activating protein 3732.1Hs.297792
LAMA2laminin, alpha 2 (merosin, congenital muscular dystrophy)2.1Hs.445120
HDLBPhigh-density lipoprotein–binding protein (vigilin)2.0Hs.427152
CER1cerberus 1 homologue, cysteine knot superfamily (Xenopus laevis)2.0Hs.248204
BDNFbrain-derived neurotrophic factor2.0Hs.439027
Table Table 6.. Genes specifically expressed in HS237 hESCs cultured in SR medium and with greater than twofold level compared with signal level in hESCs cultured in serum-containing medium
  1. a

    Abbreviations: FC, fold change; hESC, human embryonic stem cell; SR, serum replacement.

Gene SymbolGene DescriptionAverage FC to Cells in Serum MediumUnigene ID
MGC34827hypothetical protein MGC348274.8Hs.31110
SCNN1Gsodium channel, non–voltage-gated 1, gamma4.1Hs.145645
Similar to 6-pyruvoyl-tetrahydropterin synthase3.9Hs.14204
LOC388889 ///CDNA FLJ25967 fis, clone CBR019293.9

Hs.355618

Hs.517501

WDR1WD repeat domain 12.5Hs.85100
KCNK12potassium channel, subfamily K, member 122.4Hs.252617
RPL23ribosomal protein L232.4Hs.406300
LOC3889202.2Hs.120377
CDK11cyclin-dependent kinase (CDC2-like) 112.1Hs.129836
ZNF334zinc finger protein 3342.1Hs.192662
C10orf110chromosome 10 open reading frame 1102.1Hs.283652
UTF1undifferentiated embryonic cell transcription factor 12.0Hs.458406
PIWIL2piwi-like 2 (Drosophila)2.0Hs.528649
Table Table 7.. Comparison of our results on genes differentially expressed between HS237 hESCs cultured in serum-containing and SR medium with previously reported microarray results of other hESC lines cultured in various culture conditions
  1. a

    aDifferentially expressed genes in hESCs compared with differentiated cells. bCorresponding genes found from HG-U133A and B arrays by Unigene annotation. Greater than threefold downregulated genes in hESCs compared with somatic cell lines. cCorresponding genes found from HG-U133A and B arrays by Unigene annotation. Greater than threefold upregulated genes in hESCs compared with somatic cell lines. dGreater than threefold differentially expressed genes in six hESC lines compared with universal RNA. eCulture conditions described elsewhere [8]. fCulture conditions described elsewhere [7].

  2. b

    Abbreviations: hESC, human embryonic stem cell; MEF, mouse embryonic fibroblast; SR, serum replacement.

 947 Genes Upregulated in Cells Cultured in Serum-Containing Medium470 Genes Upregulated in Cells Cultured in SR-Containing Medium91 Genes Expressed More Than Twofold Only in Cells Cultured in Serum Medium16 Genes Expressed More Than Twofold Only in Cells Cultured in SR MediumCulturing Condition
Sato et al. [18] 918 genesaAHCY, CD59, EPB41L2, NASP, NID, ALDH3A2, CASP3, TGIF, GULP1, MT1X, FGF2, CSPG2, NAP1L3, GPC4, FGF13, DIAPH2, CALB1, EBAF, LEFTB, SEMA3A, CCND1, DUSP6, ILF3, SLC39A8, DUT, RANBP5, H2AFV, RRAS2, MDN1, PLEKHE1, TA-LRRP, NEK3, ADCY2, DKC1, LOC283824, SAV1, MRS2L, NUDT15, B1, KLHL7, E2F5, BM039, TEAD4 + 2 ESTs (45)MYST2, FUS, NDUFB8, ALDOC, BIRC5, RNASEH2A, KIF5C, TRIM14, DFFA, TERF1, IMP-3, PCCA, SGNE1, PIM2, RIMS3, DBT, UGP2, MAP2K6, POLG2, RBPMS, CYB5, GCDH, SUMO2, SAP18, LTA4H, PRKCBP1, ABCB7, NTHL1, CDT1, SILV, KCNQ2, C1orf38, LRIG1, HLA-DQB1, USP32, SLD5, OLFM1, DATF1, NPTX2, SFRS7, PPP2R2B, BTD, AASS, ZNF451, FGFR1, PASK, PAI-RBP1, POLR3E, PLCXD1, FLJ20171, ZNF331, MGC8407, ZNF589, ZBTB3, MLSTD1, GNB2L1 (46)ACTA1, DDX3Ymatrigel, MEF- conditioned mediume
Sperger et al. [19] Negatively significant 913 genesbCYBRD1, FLJ20421, MANEA, SLC40A1, IRF2BP2, FBXL3, DKFZp761B1514, NDFIP2, ARHGAP18, C14orf32, ZAK, C6orf89, MGC46719, T2BP, RAI1, GLTP, PS1TP4, MGC8902, HECTD2, TIMP2, GOLPH4 + 2 ESTs (23)LOC90799, HSMPP8 + 1 ESTFLJ21069, PPP1R14C, SDCCAG33MEFs + 20% SR mediumf
Sperger et al. [19] Positively significant 1,471 genescTMEPAI, RAMP, EGLN3, CXXC5, NID67, PCDHA1, SEMA6A, LOC83690, MIG-6, NEURL, ZCCHC3, NFATC3, MGC18216, JUB, NSE2, COL8A1, DKFZp762C1112, ZNRF3, DAM12, SOCS3, DSC2, MAP3K3, GPR, PARD6G, DRCTNNB1A, ASAM, PAPPA, INM01 + 4 ESTs (32)MGC2749, MTA3, BCOR, FAM44B, PHC1, ERBB3, LOC55971, PCSK9, NOPE, HDGFRP3, ADRBK2, RNF149, GRTP1, FAM46B, CDCA7, LOC152485 + 9 EST (25)EST (Hs.517501)MEFs + 20% SR mediumf
Bhattachary et al. [16] 92 genesdKRT18, ACTC, LEFTB, KRT8, MGC4083, TUBB4, RAMP, SEMA6A (8)RPL7, SFRP2, EIF4A1 (3)MEFs + 15% serum + 5% SR medium

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

O.H. and R.L. contributed equally to this study. We thank Jonna Rinne for reviewing the language of this manuscript, Miina Miller for technical advice on Affymetrix technology, Tuomas Nikula for advice on Kensington software, and the Finnish DNA Microarray Center at Turku Centre for Biotechnology for providing facilities for the microarray analysis. We thank the personnel of the IVF Unit of Karolinska University Hospital, Hud-dinge, for their support in the stem cell research. R.L. and H.S. were supported by the Academy of Finland/JDRF, H.S. by Finnish Cultural foundations and NorFA, and O.H. by the Swedish Research Council/JDRF.

Disclosures

The authors indicate no potential conflicts of interest.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References