Electrophysiological Properties of Pluripotent Human and Mouse Embryonic Stem Cells

Authors


Abstract

Pluripotent embryonic stem cells (ESCs) possess promising potential for cell-based therapies, but their electrophysiological properties have not been characterized. Here we describe the presence of ionic currents in mouse (m) and human (h) ESCs and their physiological function. In mESCs, tetraethylammonium (TEA)–sensitive depolarization-activated delayed rectifier K+ currents (IKDR) (8.6 ± 0.9 pA/pF at +40 mV; IC50 = 1.2 ± 0.3 mM), which contained components sensitive to 4-aminopyridine (4-AP) (IC50 = 0.5 ± 0.1 mM) and 100 nM Ca2+-activated K+ current (IKCa) blocker iberiotoxin (IBTX),were detected in 52.3% of undifferentiated cells.IKDR was similarly present in hESCs (∼100%) but with an approximately sixfold higher current density (47.5 ± 7.9 pA/pF at +40 mV). When assayed by bromodeoxyurindine incorporation, application of TEA, 4-AP, or IBTX significantly reduced the proliferation of mESCs and hESCs in a dose-dependent manner (p < .05). A hyperpolarization-activated inward current (Ih) (−2.2 ± 0.4 pA/pF at −120 mV) was detected in 23% of mESCs but not hESCs. Neither Nav nor Cav currents were detected in mESCs and hESCs. Microarray and reverse transcription–polymerase chain reaction analyses identified several candidate genes for the ionic currents discovered. Collectively, our results indicate that pluripotent ESCs functionally express several specialized ion channels and further highlight similarities and differences between the two species. Practical considerations for the therapeutic use of ESCs are discussed.

Introduction

Embryonic stem cells (ESCs) are derived from the inner cell mass of blastocysts. Because ESCs can propagate indefinitely in culture while maintaining their pluripotency to differentiate into all cell types, they may therefore provide an unlimited supply of specialized cells such as cardiomyocytes and neurons for cell-based therapies. For instance, direct injection of pluripotent ESCs after myocardial infarction has been suggested as a means to repair the damaged heart [1]. However, transplantation of cells with undesirable electrical properties into the heart can predispose patients to lethal electrical disorders (arrhythmias) [2, 3]. Therefore, it is critical to understand the electrophysiological profile of undifferentiated ESCs, which has not been characterized. In this study, we hypothesize that ion channels are functionally expressed in mouse (m) and human (h) ESCs, although the specific encoding genes (and/or their isoforms) and their expression levels might differ. We discovered that several specialized ion channels are differentially expressed in pluripotent mESCs and hESCs. Collectively, our experiments reveal further similarities and differences between the two species. We discuss these results in relation to the physiological function of ion channels in hESC biology as well as practical considerations for potential therapeutic applications of hESCs.

Materials and Methods

Maintenance of mESCs and hESCs

The mESC line R1 [4] (kind gift from Dr. Andras Nagy, University of Toronto, Toronto), which has been genetically engineered to constitutively express the green fluorescent protein (GFP), was used in this study to assist their identification from mouse embryonic fibroblast (MEF) cells. mESCs were maintained in their undifferentiated stage by growing on mitomycin-treated MEF feeder layer [5] in Dulbecco's modified Eagle's medium (DMEM) (GIBCO, Carlsbad, CA, http://www.lifetech.com) supplemented with 20% fetal bovine serum (GIBCO), 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM β-mercaptoethanol, 0.1 mM nonessential amino acids, and 1,000 U/ml leukemia inhibitory factor (Chemicon, Temecula, CA; http://www.chemicon.com).

For hESCs, the H1 line (WiCell Research Institute, Madison, WI, http://www.wicell.org) [6] that has been stably transduced by the recombinant lentivirus LV-CAG-GFP (see below for further description of the lentiviral vector used), as we have recently described, was used [7, 8]. hESCs were maintained on irradiated MEF feeder layer and propagated as previously described. The culture medium consisted of DMEM supplemented with 20% fetal bovine serum (HyClone, Logan, UT, http://www.hyclone.com), 2 mM L-glutamine, 0.1 mM β-mercaptoethanol, and 1% nonessential amino acids. MEF cells were obtained from 13.5-day-old embryos of CF-1 mice.

Lentivirus-Mediated Stable Genetic Modification of hESCs

For stable genetic modification, we used the self-inactivating HIV1-based lentiviral vector (LV) [9]. The plasmid pLV-CAG-GFP was created from pRRL-hPGK-GFP SIN-18 (generously provided by Dr. Didier Trono, University of Geneva, Geneva, Switzerland) by replacing the human phosphoglycerate kinase 1 (hPGK) promoter with the CAG promoter, an internal composite constitutive promoter containing the cytomegalovirus enhancer and the β-actin promoter. Recombinant lentiviruses were generated using the three-plasmid system [10] by cotransfecting HEK293T cells with pLenti-CAG-GFP, pMD.G, and pCMV R8.91. The latter plasmids encode the vesicular stomatitis virus G envelope protein and the HIV-1 gag/pol, tat, and rev genes required for efficient virus production, respectively. Lenti-viral particles were harvested by collecting the culture medium at 48 hours after transfection and were stored at −80°C before use.

hESCs were transduced by adding purified lentiviruses to cells at a final concentration of 10,000 TU ml−1 with 8 μg/ml polybrene to facilitate transduction. The multiplicity of infection was approximately 5 for each round of transduction. After 4–6 hours of incubation with LV-CAG-GFP, 2 ml fresh medium per 60 mm dish was added. Transduction was allowed to proceed for at least 12–16 hours. Cells were washed with phosphate-buffered saline (PBS) twice to remove residual viral particles. For generating stably LV-CAG-GFP–transduced hESCs, green portions of hESC colonies were microsurgically segregated from the nongreen cells, followed by culturing under undifferentiating conditions for expansion. This process was repeated until a homogenous population of green hESCs, as confirmed by fluorescence-activated cell sorter, was obtained. Further details are also provided in another recent publication [11].

Immunostaining

mESCs or hESCs were fixed in 4% paraformaldehyde for 15 minutes at 21°C, washed with PBS, and permeabilized with 0.1% Trition X-100/PBS. The cells were then blocked with 10% bovine serum albumin with 0.075% saponin or 4% goat serum in PBS for 2 hours at 21°C. Fixed cells were incubated with the primary antibodies at a dilution of 1:25 (for SSEA-4 and TRA-1-60 in hESC staining) (Chemicon) overnight at 4°C, followed by incubation with fluorescent-labeled secondary antibodies for 50 minutes at 21°C and visualization by laser-scanning confocal microscopy.

Cell Proliferation Assay

Cell proliferation was determined in 96-well plates using a non-radioactive chemiluminescent bromodeoxyurindine (BrdU) kit (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) according to the manufacturer's protocols. mESCs or hESCs were treated with specified concentrations of tetraethylammonium (TEA), 4-aminopyridine (4-AP), or iberiotoxin (IBTX) for 24 hours. BrdU labeling solution was then added to give a final concentration of 10 μM of BrdU. Medium was removed after 2 hours, and cells were fixed with the addition of FixDenat solution (Roche Dianostics) for 30 minutes at room temperature. After removing FixDenat, 100 μl freshly diluted 1:100 anti-BrdU peroxidase solution was added to the wells for 30 minutes, followed by washing three times. Finally, 100 μl of substrate solution was added, and luminescence was read by a multiwell scanning spectrophotometer automatic luminometer.

Cell viability was determined in 96-well plates using a colorimetric MTT [3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide] kit (Roche Diagnostics). Briefly, specified concentrations of TEA, 4-AP, or IBTX were added for 24 hours. Then 10 μl of MTT labeling reagent (5 mg/ml in PBS) was added to each well, followed by incubation at 37°C for 4 hours. Solubilization solution (100 μl) was added to dissolve the formazan crystals formed. Absorbances at 540 nm were read by a spectrophotometer. Untreated cells were used as control (i.e., 100% survival).

Electrophysiology

Only GFP-expressing mESCs and hESCs (∼15 pF) were selected for experiments. Electrophysiological recordings were performed at room temperature using whole-cell patch clamp. Pipette electrodes (TW120F-6; World Precision Instruments, Sarasota, FL, http://www.wpiinc.com) were fabricated using a Sutter P-87 horizontal puller and fire-polished and had final tip resistances of 2–4 Mμ. All recordings were performed at room temperature in a bath solution containing (in mM) NaCl 110, KCl 30, CaCl2 1.8, MgCl2 0.5, HEPES 5, and glucose 10, pH adjusted to 7.4 with NaOH. The internal solution for patch recordings contained (in mM) NaCl 10, KCl 130, MgCl2 0.5, HEPES 5, EGTA 1, and MgATP 5, pH adjusted to 7.3 with KOH. For recording Ca2+-activated large-conductance K+ current (IKCa), 2.5 mM Ca2+ was added to the pipette solution containing (in mM) K-aspartate 110, NaCl 10, KCl 20, MgCl2•6H2O 1, Na2-phosphocreatine 5, HEPES 10, K2-EGTA 5, Mg2ATP 5, and GTP 0.1, pH adjusted to 7.2 with KOH. Blockers were diluted to the final concentrations in the bath solution as indicated and administrated via superfusion (at least 10 ml) using a fast-exchange perfusion system. The current amplitude at +50 mV was monitored every 30 seconds after 5 minutes of incubation until steady-state current blockage was achieved.

Half-blocking concentrations (IC50) were determined from the following binding isotherm: I = Iblocker-ins + (1 − Iblocker-ins) / (1 + [blocker]/IC50)n), in which IC50 is the half-blocking concentration, Iblocker-ins is blocker-insensitive component, n is the Hill coefficient, and I0 and I are the peak currents measured at the voltage indicated before and after application of the blocker, respectively. All IC50 and half-effective concentration (EC50) values reported were calculated from individual determinations (i.e., curve fitting to data from individual experiments). The curves presented in the Figures were fitted to averaged data points pooled from all experiments.

Reverse Transcription–Polymerase Chain Reaction

Total RNA was prepared from mESCs or mouse brain using ToTALLY RNA Kit (Ambion Inc., Austin, TX, http://www.ambion.com). Single-stranded cDNA was synthesized from approximately 1 μg of total RNA using random hexamers and SuperScript reverse transcription (RT) (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) according to the manufacturer's protocols, followed by polymerase chain reaction (PCR) amplification with gene-specific primers for ion channel genes. Primers, annealing temperatures, product sizes, and the corresponding references are given in Table 1. 18S ribosomal RNA (498 bp) was used as an internal control. The reaction was conducted using the following protocol: initial denaturing of the template for 5 minutes at 94°C followed by 32 repeating cycles of denaturing for 1 minute at 94°C, annealing for 1 minute, extension for 1 minute at 72°C, and a final elongation at 72°C for 7 minutes. The PCR products were size-fractionated by 1% agarose gel electrophoresis and visualized by ethidium bromide staining. All the primers were tested with preparations from mouse brain and water as positive and negative controls, respectively. To analyze RNA expression in hESCs by RT-PCR, total RNA was extracted using a NucleoSpin RNAII kit (Clontech, Palo Alto, CA, http://www.clontech.com), treated with DNase I, and used for RT-PCR with SuperScript One-Step RT-PCR with the Platinum Taq system (Invitrogen). The primers for gene-specific RT-PCR are given in Table 2. Equal aliquots of the PCR products were electrophoresed through 2% agarose gels and visualized by ethidium bromide staining.

Table Table 1.. Mouse gene-specific primers for reverse transcription–polymerase chain reaction
  • a

    a Manufactured by PREMIER Biosoft International, Palo Alto, CA, http://www.premierbiosoft.com.

GeneAccession no.Forward primer sequence (5-3)Reverse primer sequence (5-3)Length (bp)Annealing temperature (°C)Reference
HCN1NM_010408CTCTTTTTGCTAACGCCGATCATTGAAATTGTCCACCGAA29157[46]
HCN2NM_008226GTGGAGCGAGCTCTACTCGTGTTCACAATCTCCTCACGCA22957[46]
HCN3NM_008227GACACCCGCCTCACTGATGGATGTTTCCGCTGCAGTATCGAATTC37057[46]
HCN4XM_287905TGCTGTGCATTGGGTATGGATTTCGGCAGTTAAAGTTGATG33747[46]
Kv1.1NM_010595GCCTCTGACAGTGACCTCAGCGGGACAGGAGTCGCCAAGGG24057[47]
Kv1.2NM_008417CGTCCTCCCCTGACCTAAACCATGCAGAACCAGATGCTGTAG29657[47]
Kv1.3NM_008418ATCTTCAAGCTCTCCCGCCACGATCACCATATACTCCGAC47853[48]
Kv1.4NM_021275CTCCTCCCATGATCCTCAAGGGCAGGTCTGTGTACGAACACC25757[47]
Kv1.5NM_145983GCCATTGCCATCGTGTCGGTACATGTGGTCTCCACGATGA24253[48]
Kv1.6NM_013568GCTTGGCAAACCTGACTTTGCCCTGTTTTCCTGCAGGCC13657[47]
Kv2.1NM_008420CGGCAGTTCAACCTGATCCCTTTATTGCCCAGAATGCTGTCG46857[49]
Kv3.1NM_008421CGAGCTGGAGATGACCAAGAAGAAGAGGGAGGCAAAGG15660Designed with Primer Premier 5.0a
Kv3.2U52223AATAGCCATGCCTGTGCAGCGTCTGATAGGGAGC29660Designed with Primer Premier 5.0a
Kv4.2NM_019697ATCGCCCATCAAGTCACAGTCCCGACACATTGGCATTAGGAA11153[50]
Kv4.3NM_019931CAAGACCACCTCACTCATCGATCGAGCTCTCCATGCAGTTCT17660[50]
BKNM_010610CCATTAAGTCGGGCTGATTTAAGCCTTGGGAATTAGCCTGCAAGA18853[51]
Table Table 2.. Human gene-specific primers for reverse transcription–polymerase chain reaction
  1. a

    aFor information about Primer3 visit http://fokker.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi.

GeneAccession no.Forward primer sequence (5-3)Reverse primer sequence (5-3)Length (bp)Annealing temperature (°C)Reference
Cav, α2/δ subunit 2NM_006030gctgcagaactccaacatcaCGATGGAAGGGATCTCAAAA22460Designed with Primer3a
Cav, β3 subunitU07139acagcttgatgccctctgattggttgtgctctgagtcctg21160Designed with Primer3a
Cav2.1NM_023035agtgaacaaaaacgccaaccaaagtagcgcaggttcagga18460Designed with Primer3a
Nav1.9NM_014139ccaccaccaagagaaaggaatcagtcacagtggaccttgc20060Designed with Primer3a
Kv9.3NM_002252CAGTGAGGATGCACCAGAGATTGCTGTGCAATTCTCCAAG20060[52]
Kv4.2NM_0012281GCCAATGTGTCAGGAAGTCATTCTGGGGTGGTTACTGGAG20160[52]
Kv11.1NM_000238CCTTCCTCTGCATTGCTTTTCTTGTCTTGGGGTGAGCTGT21060[52]
Kv2.1NM_004975ACAGAGCAAACCAAAGGAAGAACCACCCTCCATGAAGTTGACTTTA38360[52]
Kv7.2NM_172109gcaagctgcagaatttcctcagtactccacgccaaacacc20160Designed with Primer3a
GAPDHNM_013568ACATCAAGAAGGTGGTGAAGCAGGCTCTTGCTCTCAGATCCTTGCTGG28160Designed with Primer3a
HCN1NM_021072.1GGCGGCAGTATCAAGAGAAGGGCATTGTAGCCACCAGTTT21160Designed with Primer3a

Microarray Analysis

Microarray analysis was performed using Affymetrix human genome U133A array (Affymetrix, Santa Clara, CA http://www.affymetrix.com), which represents 18,400 transcript and variants, including 14,500 well-characterized human genes. Total RNA was extracted from pluripotent hESCs (H1) and hybridized to microarrays according to the protocols provided by the manufacturer. The software Genespring 6.0 (Silicon Genetics, Redwood City, CA, http://www.silicongenetics.com) was used for microarray data analysis. Data were normalized to the expression level of the 50th percentile of the entire chip and filtered to show genes that are labeled as expressed (i.e., present flags) as defined by Affymetrix analysis.

Statistics

All data reported are means ± SEM. Statistical significance was determined for all individual data points and fitting parameters using one-way analysis of variance and Tukey's Honestly Significantly Different post-hoc test at the 5% level.

Results

Ionic Currents in Pluripotent mESCs

Figure 1A shows that undifferentiated mESC colonies were homogenously immunostained for the pluripotency markers Oct-4 and SSEA-1 [12, 13]. In 159 of 304 (52.3%) undifferentiated mESCs, depolarization-activated time-dependent noninactivating outward currents that increased progressively with positive voltages could be recorded (8.6 ± 0.9 pA/pF at +40 mV; Figs. 1B, 1C). These outwardly rectifying currents resemble the delayed-rectifier K+ currents (IKDR) and could be dose-dependently inhibited by the known K+ channel blocker TEA+ [14, 15] (IC50 = 1.2 ± 0.3 mM, n = 13; Figs. 1B, 1D). IKDR in mESCs was also sensitive to 4-AP (IC50 = 0.5 ± 0.1 mM, n = 17), a more potent K channel blocker than TEA+ [16, 17], and the Ca2+-activated large-conductance K+ current (IKCa) blocker IBTX (100nM) (current inhibition = 33.2% ± 12.7%, n = 3) (Figs. 1B, 1E). As shown in Figures 1D and 1E, increasing TEA or 4-AP to 30 mM could not lead to complete current inhibition. Indeed, even combined application of 30 mM TEA and 30 mM 4-AP also could not completely eliminate the IKDR (30 mM 4-AP, 30 mM TEA, and 30 mM TEA + 30 mM 4-AP reduced the IKDR to 45.8% ± 2.1%, 39.3% ± 7.6%, and 45.1% ± 8.1%, respectively; p > .05). The currents remaining after combined TEA/4-AP blockade were also not sensitive to 1 mM BaCl2, implicating the presence of some background current.

Figure Figure 1..

(A): Images of pluripotent mESCs immunostained for SSEA-1 and Oct-4. (B): Representative current tracings recorded from undifferentiated mESCs before (left panels) and after (right panels) blockade by TEA, 4-AP, and IBTX, as indicated. The electrophysiological protocol used for eliciting currents is also given. (C): Current-voltage relationship of IKDR of mESCs. Dose–response relationships for (D) TEA and (E) 4-AP block of IKDR of mESCs. Abbreviations: 4-AP, 4-aminopyridine; IBTX, iberiotoxin; mESC, mouse embryonic stem cell; TEA, tetraethylammonium.

Although voltage-gated Na+ (Nav) and Ca2+ (Cav) currents were completely absent in all pluripotent mESCs tested (n > 200), whether IKDR was present (Fig. 1B) or not (Fig. 2A), a modest yet detectable hyperpolarization-activated inward current (Ih, encoded by the hyperpolarization-activated cyclic nucleotide-modulated nonselective or HCN ion channel family [18]; −2.2 ± 0.4 pA/pF at −120 mV) was detected in 79 of 270 cells (29.3%; Fig. 2B). Ih in mESCs was reversibly blocked by the HCN inhibitor Cs+ [19, 20]. Application of 1 μM isoproterenol altered neither the kinetics nor amplitude of Ih recorded in mESCs. Inwardly rectifying K currents (IK1) responsible for stabilizing the resting membrane potential were also not present.

Figure Figure 2..

(A): Stimulation protocol and representative current traces demonstrating the absence of Nav or Cav currents in an mESC that lacks IKDR. (B): CsCl2-sensitive hyperpolarization-activated currents could be recorded from pluripotent mESCs but not hESCs. (C): Steady-state current-voltage relationships of hyperpolarization-activated currents of mESCs and hESCs. Abbreviations: hESC, human embryonic stem cell; mESC, mouse embryonic stem cell.

To obtain insights into the molecular identities of the ionic currents identified, total RNA was isolated from pluripotent mESCs for RT-PCR. Figure 3A shows that Kv1.1, 1.2, 1.3, 1.4, 1.6, 4.2, and BK (or Maxi-K) transcripts but not Kv1.5, 2.1, 3.1, 3.2, and 4.3 were detected. Consistent with the presence of Ih, HCN2 and HCN3 transcripts were also expressed. Inhibition by 4-AP and insensitivity to extracellular TEA ions is a pharmacological hallmark of A-type currents [21]. However, neither TEA-subtracted nor 4-AP–subtracted current traces from IKDR blockade revealed any transient outward current with the typical rapid inactivation feature (data not shown). Therefore, although Kv1.1, 1.2, 1.6, and BK channels might underline the delayed rectifier current recorded, we conclude that Kv1.4- and Kv4.2-encoded transient outward K+ currents were not functionally expressed.

Figure Figure 3..

(A): Expression of ion channel transcripts in mESCs probed by semiquantitative reverse transcription–polymerase chain reaction. Dose–response relationships of (B) TEA, (C) 4-AP, and (D) IBTX for inhibition of mESC proliferation assessed by BrdU incorporation (open squares) and cytotoxic effects by MTT (solid squares). Abbreviations: 4-AP, 4-aminopyridine; BrdU, bromodeoxyurindine; IBTX, iberiotoxin; mESC, mouse embryonic stem cell; TEA, tetra-ethylammonium.

Effects of Ion Channel Blockers

To investigate possible physiological roles of the ionic currents identified, we next studied the functional consequences of their pharmacological blockade by assessing the effects of extracellular application of K+ channel blockers on cell proliferation. Specifically, we measured DNA synthesis as an index for replication by quantifying BrdU incorporation into genomic DNA during the S phase of the cell cycle, which is proportional to the rate of cell division [22]. Application of TEA+ significantly inhibited the proliferation of mESCs in a dose-dependent manner (Fig. 3B, open squares). The EC50 was 20.1 ± 3.7 mM (n = 3), approximately 20-fold higher than the IC50 for IKDR inhibition. Similarly, 4-AP (EC50 = 2.7 ± 0.2 mM; Fig. 3C, open squares) and IBTX (EC50 = 133.9 ± 25.9 nM; Fig. 3D, open squares) also dose-dependently reduced cell proliferation. Of note, the rank orders of these agents to inhibit proliferation follow the trend of their potencies to block IKDR (i.e., IBTX > 4-AP > TEA). To assess the cytotoxic effect of K+ channel blockers, a colorimetric MTT kit was used to examine for changes in metabolism. Notably, the EC50 values for inhibition of metabolic activity by TEA (62.7 ± 9.0 mM; Fig. 3B, solid squares), 4-AP (4.6 ± 0.5 mM; Fig. 3C, solid squares), and IBTX (333.9 ± 64.6 nM; Fig. 3D, solid squares) were significantly higher than those for inhibiting cell proliferation (p < .05). These results implicate that the metabolic influences of these blockers were relatively insignificant at concentrations at which they effectively exert their inhibitory effects on ESC proliferation, presumably by K+ channel blockade.

Electrophysiological Properties of hESCs: Similarities and Differences

Although hESCs and mESCs share several similarities, significant differences are known to exist between the two species [23]. Therefore, we also examined the previously unexplored electrophysiological properties of hESCs. Pluripotent hESCs were positive for markers such as alkaline phosphatase, Oct4, SSEA4, and TRA-60 (Fig. 4A), consistent with previous reports [6]. Similar to mESCs, TEA+-sensitive IKDR (IC50 = 2.1 ± 0.2 mM; Fig. 4D) was also detected in hESCs (∼100%), but the current density was approximately sixfold higher (47.5 ± 7.9 pA/pF at +40 mV, n = 12, p < .05) (Figs. 4B, 4C). Similar to mESCs, application of TEA+ dose-dependently inhibited hESC proliferation as assayed by BrdU incorporation, with an EC50 (11.6 ± 2.0 mM) (Fig. 4D). Unlike mESCs, however, there was no measurable Ih in all hESCs tested (n = 30; Fig. 2B). Same as mESCs, neither Nav nor Cav currents could be detected in hESCs.

Figure Figure 4..

(A): Pluripotent hESCs were positive for alkaline phosphatase, SSEA-4, and TRA-1-60. (B): Representative current tracings recorded from undifferentiated hESCs. The same electrophysiological from Figure 1 was used. (C): Steady-state current-voltage relationship of IKDR in hESCs. (D): IC50 for blockade of IKDR and EC50 for proliferation inhibition by tetraethylammonium in hESCs. Abbreviation: hESC, human embryonic stem cell.

Microarray Analysis of Ion Channel Genes in hESCs

Using Affymetrix U133A chips, we performed microarray analysis of pluripotent hESCs to examine the expression of ion channels at the transcriptomic level. Figure 5A shows the expression profile of all genes tested in undifferentiated hESCs. For voltage-gated ion channels, a total of 36, 19, and 49 genes on the U133A chips were identified as Cav, Nav, or Kv channel genes, respectively. For inspection, their expression profile is extracted in Figure 5A and further summarized in Figures 5B and 5C by normalizing signals to the average expression level of the entire microarray in a manner similar to that of cytokines and their receptors in hESCs, as recently reported by Dvash et al. [24]. Our data indicate that among the total 104 voltage-gated ion channel genes mentioned above, only the transcripts of 3, 1, and 5 Cav, Nav, and Kv genes were significantly expressed, as defined by Affymetrix. The corresponding gene products were CACNA1A (Cav2.1), CACNA2D2 (Cav α2/δ subunit 2), CACNB3 (Cav β3 subunit), SCN11A (Nav1.9), KCNB1 (Kv2.1), KCND2 (Kv4.2), KCNQ2 (Kv7.2), KCNS3 (Kv9.3), and KCNH2 (Kv11.1) (note, however, that ICa, INa, and Kv4.2-encoded transient outward K+ currents could not be electrophysiologically recorded, like mESCs). Of note, KCNQ2 and KCNH2, which underlie the noninactivating, slowly deactivating M-current [25] and the rapid component of the cardiac delayed rectifier (IKr) [26], were relatively highly expressed. Similarly, KCNB1 and KCNS3, which encode for the delayed rectifier Kv2.1 channels and the silent modulatory α-subunit Kv9.3 that heteromerizes with Kv2.1 subunits [2729], respectively, were also expressed. Collectively, these ion channel genes could underlie the KDR current identified, although further experiments will be needed to confirm and dissect their molecular identities. By contrast, no HCN transcript was expressed in pluripotent hESCs. RT-PCR confirmed the array results for five of nine channels (Fig. 5D).

Figure Figure 5..

(A): Microarray analysis of pluripotent hESCs for the transcript expression of all genes tested using Affymetrix U133A microarrays (see Materials and Methods). (B): Left, 104 voltage-gated Cav, Nav, and Kv channel genes are clustered. The same expression scale bar shown in (A) was used. Right, same as the left panel, except only transcripts that were defined to be expressed, as defined by Affymetrix, are shown. (C): Bar graph of normalized transcript levels of the expressed ion channel genes. Data were normalized to the expression level of the 50th percentile of the entire microarray. (D): Expression of ion channel transcripts in hESCs probed by semiquantitative reverse transcription–polymerase chain reaction. Abbreviation: hESC, human embryonic stem cell.

Discussion

In this report, we have demonstrated that undifferentiated ESCs express several specialized ion channels at the mRNA and functional levels. Although cultured undifferentiated mESCs and hESCs were relatively homogenous when immunostained for pluripotency markers, heterogeneous expression of ion channels was observed in mESCs: Only fractions of mESCs tested express measurable IKDR and Ih. This observation parallels the heterogeneous pattern of ion channel expression recently described for human mesenchymal stem cells (hMSCs) [30]. Unlike mESCs (and hMSCs), however, ion channel expression in hESCs seems to be much more homogenous. IKDR was recorded in all pluripotent hESCs tested (vs. 52.3% of mESCs). In addition to the higher occurrence, the expressed amplitude of IKDR was also approximately 10-fold higher in hESCs, which in turn could underlie the more potent effects of K+ channel blockers on cell proliferation. Of note, high concentrations of TEA+ and IBTX also led to cytotoxic effects. Both the cytotoxicity of K+ channel antagonists and their effects on cell proliferation could result from their cellular uptake (e.g., via endocytosis) followed by interactions with some intracellular targets other than K channels. In this regard, K+ channel blockers are anticipated not to affect mESCs that do not express IKDR if the resultant functional consequences arise solely from their blockade of K+ channels. Unfortunately, our experiments do not dissect the relative contribution of these possibilities because the two cell populations cannot be readily isolated. In addition, tail currents were more often seen in hESCs rather than mESCs. Different channels, as suggested by our microarray and RT-PCR data, are likely to underlie these human and mouse delayed rectifier currents. Further experiments (e.g., the use of small interfering RNA and/or dominant-negative ion channel constructs [31] to suppress the surface expression of ion channel receptors) will be required to address the above-mentioned questions and to dissect their precise molecular identities.

Although self-renewable ESCs may provide an unlimited supply of cells for transplantation, this promising potential is somewhat hampered by concerns that ESCs (and their multipotent derivatives) also possess the potential to form malignant tumors. Various lines of evidence have suggested that K channels provide a link between physiological and biochemical processes that regulate cell cycle and proliferation by influencing the resting membrane potential (e.g., hyperpolarization is required for the progression of certain cells into the G1 phase of the mitotic cycle) in several vastly different cell types from cancer to T lymphocytes [3236]. In accordance with this notion, our results show that pharmacologic blockade of IKDR also inhibits the proliferation of both hESCs and mESCs. Perhaps targeted inhibition of specific K channel activity (e.g., by genetic suppression via overexpression of particular dominant-negative ion channel constructs [31]) may lead to a novel strategy to arrest any undesirable cell division of and to cause cytotoxicity in pluripotent ESCs, thereby inhibiting or eliminating their tumorgenicity.

Not surprisingly, the transcript expression profiles of mESCs and hESCs do not always correspond to the functional expression profile of ion channels. Previously, van Kempen et al. [37] demonstrated that a variety of ion channel transcripts, such as those of Kv4.3, KvLQT1, Nav, and HCN channels, are present in pluripotent mESCs but no ionic currents at all can be detected electrophysiologically before differentiation is induced [37]. Similarly, a direct correlation between mRNA and membrane ionic currents is also not seen in the pluripotent P19 embryonic carcinoma cell line [38]. Nevertheless, time-dependent changes in ion channel mRNA expression upon in vitro differentiation of hESCs have been reported [39]. The differences between these observations and those presented here could be attributed to the different pluripotent cell lines investigated or the different culturing conditions used, which may likewise contribute to the species differences in the electrophysiological profiles observed between mESCs and hESCs.

Although injection of undifferentiated mESCs into mice does not seem to be arrhythmogenic (unpublished data) [1], the associated electrophysiological consequences could be masked due to the slow current kinetics of IKDR in ESCs relative to the high mouse heart rate (∼600 bpm) and thus extremely short cardiac cycles. Such arrhythmogenic potential could become prominent in species whose heart rates are much slower (e.g., ∼80 bpm for humans). Like MSCs [40], pluripotent ESCs also express gap junction proteins [4143] for electrical coupling. Furthermore, ESCs can even subsequently differentiate into electrically active lineages [7, 39, 44, 45]. Taken collectively, our present results highlight additional similarities and differences between mESCs and hESCs and further suggest that the electrophysiological profile, in addition to the tumorgenic potential, of a given undifferentiated hESC line needs to be carefully assessed before it can be used for therapeutic application, especially when organs or systems in which electrical coordination is key for their functions (e.g., cardiac, pancreatic, and neuronal) are involved.

Acknowledgements

K.W. and T.X. contributed equally to this study. This work was supported by grants from the National Institutes of Health (R01 HL-52768 and R01 HL-72857 to R.A.L.), the Blaustein Pain Research Centre (to R.A.L.), and the Hong Kong Research Grant Council (HKU 7459/04M to H.F.T., R.A.L., G.R.L., and C.P.L.). S.Y.T. was supported by a postdoctoral fellowship award from the Croucher Foundation. We would also like to thank Dr. Guibin Chen at Johns Hopkins for helpful discussion in microarray analysis.

Disclosures

The authors indicate no potential conflicts of interest.

Ancillary