SEARCH

SEARCH BY CITATION

Keywords:

  • Human embryonic stem cells;
  • Sphingosine-1-phosphate;
  • Platelet-derived growth factor;
  • Lysophosphatidic acid

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results and Discussion
  6. Conclusion
  7. Acknowledgements
  8. References
  9. Supporting Information

Human embryonic stem cells (hESCs) have great potential for use in research and regenerative medicine, but very little is known about the factors that maintain these cells in the pluripotent state. We investigated the role of three major mitogenic agents present in serum—sphingosine-1-phosphate (S1P), lysophosphatidic acid (LPA), and platelet-derived growth factor (PDGF)—in maintaining hESCs. We show here that although LPA does not affect hESC growth or differentiation, coincubation of S1P and PDGF in a serum-free culture medium successfully maintains hESCs in an undifferentiated state. Our studies indicate that signaling pathways activated by tyrosine kinase receptors act synergistically with those downstream from lysophospholipid receptors to maintain hESCs in the undifferentiated state. This study is the first demonstration of a role for lysophospholipid receptor signaling in the maintenance of stem cell pluri-potentiality.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results and Discussion
  6. Conclusion
  7. Acknowledgements
  8. References
  9. Supporting Information

Human embryonic stem cells (hESCs) derived from human blastocysts [1, 2] have generally been cultivated on feeder layers of primary mouse embryonic fibroblasts (MEFs) in media supplemented with fetal calf serum (FCS). However, serum contains a wide variety of biologically active compounds that might adversely affect hESC growth and differentiation. Thus, cultivation of cells in FCS complicates experimental approaches to defining the intracellular mechanisms required for hESC maintenance. Furthermore, there is a potential biosafety concern if cells cultured in animal sera are subsequently used for implantation into humans. Alternative approaches to this culture system have been described, such as the use of a complex serum replacement, knockout serum replacement (KSR) plus basic fibroblast growth factor (bFGF) [35]. However, KSR still contains an undefined mixture of animal proteins. Although mouse embryonic stem (ES) cells are maintained in the pluripotent state by leukemia inhibitory factor (LIF), hESCs do not respond to LIF [1, 2]. The aim of this study was to identify specific factors in serum responsible for its beneficial effect on the growth of hESCs.

Sphingosine-1-phosphate (S1P) and lysophosphatidic acid (LPA) are bioactive lysophospholipids that are released by activated platelets and present in serum [6]. These lysophospholipids act on a wide range of cells and regulate numerous cellular functions, including proliferation and differentiation, from the early stages of embryonic development [6]. Most of their effects are mediated by specific G-protein–coupled receptors: S1P1/Edg-1, S1P2/Edg-5/Gpcr13/H218/AGR16, S1P3/Edg-3, S1P4/Edg-6, S1P5/Edg-8, LPA1/Edg-2/rec.1.3/vzg-1/Gpcr26/Mrec1.3, LPA2/Edg-4, and LPA3/Edg-7/ RP4-678I3/HOFNH30 [6, 7]. Moreover, S1P is also considered an intracellular second messenger with as-yet undefined intracellular targets [8]. Despite the use of FCS to support mouse and human ES cell growth for many years, the potential role for lysophospholipid signaling in stem cell renewal has not been examined previously. Platelet-derived growth factor (PDGF) is another serum component widely described as a potent mitogen, also shown to prevent apoptosis [9]. The PDGF family is comprised of dimeric isoforms of polypeptide chains A, B, C, and D that bind two tyrosine kinase receptors, PDGFR-α and PDGFR-β. PDGF can activate sphingosine kinases (SPKs), leading to a transient increase in intracellular S1P concentration, held to be responsible for PDGF-induced cell proliferation or survival in different cell types [8, 10, 11].

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results and Discussion
  6. Conclusion
  7. Acknowledgements
  8. References
  9. Supporting Information

Cell Culture

HES-2, HES-3, and HES-4 cells were cultured as previously described [2]. For fluorescence-activated cell sorter analysis, hESCs were cultured as described (bulk cultures) [5]. In feeder-free experiments, hESCs from bulk cultures [5] were plated onto Matrigel [4] in a medium consisting of 60% KSR medium, 20% MEF-conditioned medium, 20% HES-conditioned medium, and 4 ng/ml bFGF. For each type of experiment, after attachment, medium (complete with any inhibitor used) was changed every second day. The serum-free medium consisted of Dulbecco's modified Eagle's medium (without sodium pyruvate, glucose 4,500 mg/l), insulin/transferrin/selenium 1%, β-mercapto-ethanol 0.1 mM, NEAA 1%, glutamine 2 mM, HEPES 25 mM, penicillin 25 U/ml, and streptomycin 25 μg/ml (all from Invitrogen, Carlsbad, CA, http://www.invitrogen.com). Extemporaneous dilutions of lipids were made in 0.1% fatty acid–free bovine serum albumin (BSA) (final concentration, 0.01% BSA; Sigma, St. Louis, http://www.sigmaaldrich.com). In some experiments, human serum albumin (Sigma) was used at a final concentration of 0.01%. Albumin alone had no effect on HES cell maintenance. Human PDGF-AB, PDGF-AA, and PDGF-BB (Peprotech, Rocky Hill, NJ, http://www.peprotech.com) were used at 20 ng/ml, S1P (Biomol, Plymouth Meeting, PA, http://www.biomol.com) at 10 μM, LPA (Sigma) at up to 50 μM, U0126 (Promega, Madison, WI, http://www.promega.com) at 10 μM, pertussis toxin (PTX) (Biomol) at 100 ng/ml, and dimethylsphingosine (DMS) (Biomol) at 3 μM.

Reverse Transcription–Polymerase Chain Reaction Experiments

mRNA was extracted from HES-2 and HES-3 cells and MEFs and reverse-transcribed as previously described [2]. The cDNA samples were amplified by polymerase chain reaction (PCR) with sense and antisense primers (Sigma) designed for the specific detection of mouse (data not shown) or human DNA target sequences (Table 1) using Taq DNA polymerase (Biotech International, Inc., Needville, TX, http://www.biotechintl.com) [12]. The amplified DNA fragments were sized by electrophoresis on 1.5% (wt/vol) agarose gel and stained with ethidium bromide. Molecular sizes (bp) were calculated using 1 kb plus DNA ladder markers (M). The amplicons were purified and sequenced. The analysis showed that sequenced PCR products obtained with hESCs corresponded to those of the expected human cDNA.

Table Table 1.. Sense and antisense primers
GeneSense and antisense primersSize (bp)Annealing temperature (°C)Reference
S1P1CCACAACGGGAGCAATAACT GTAAATGATGGGGTTGGTGC48052[31]
S1P2CCAATACCTTGCTCTCTCTGGC CAGAAGGAGGATGCTGAAGG50252[31]
S1P3TCAGGGAGGGCAGTATGTTC CTGAGCCTTGAAGAGGATGG50552[31]
S1P4CGGCTCATTGTTCTGCACTA GATCATCAGCACCGTCTTCA70152[31]
S1P5TTCTGATACCAGAGTCCGGG CAAGGCCTACGTGCTCTTCT46052[31]
LPA1GCTCCACACACGGATGAGCAACC GTGGTCATTGCTGTGAACTCCAGC62156[32]
LPA2AGCTGCACAGCCGCCTGCCCCGT TGCTGTGCCATGCCAGACCTTGTC77556[32]
LPA3CCATAGCAACCTGACCAAAAAGAG TCCTTGTAGGAGTAGATGATGGGG48256[33]
PDGFR-αATCAATCAGCCCAGATGGAC TTCACGGGCAGAAAGGTACT89158[34]
PDGFR-βAATGTCTCCAGCACCTTCGT AGCGGATGTGGTAAGGCATA69858[34]
CriptoCAGAACCTGCTGCCTGAATG GTAGAAATGCCTGAGGAAACG18555 
Oct-4CGTTCTCTTTGGAAAGGTGTTC ACACTCGGACCACGTCTTTC32055[35]
SPK-1ACCCATGAACCTGCTGTCTC CAGGTGTCTTGGAACCCACT22755 
SPK-2TGGCAGTGGTGTAAGAACC CAGTCAGGGCGATCTAGGA20055 

Western Blot Analysis

HES-3 cells were lysed by addition of a reducing loading buffer in Laemmli sample buffer containing β-mercaptoethanol. Protein separation, transfer, and immunoblotting were carried out as previously described [13] using rabbit monoclonal antibodies against human Edg-1 and human Edg-5 and mouse monoclonal antibodies against human Edg-3 (Calbiochem, Nottingham, U.K., http://www.merckbiosciences.co.uk). Peroxidase-coupled secondary antibodies (DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.com) were detected by exposure of autoradiographic films in the presence of a chemiluminescent detection reagent (ECL; Amersham Biosciences, Piscataway, NJ, http://www.amersham.com).

Immunofluorescence

Cells fixed in paraformaldehyde 4% (PDGFR staining) or 100% ethanol were immunostained as previously described [2] using the following antibodies: anti-human PDGFR-α or PDGFR-β (R&D Systems, Inc., Minneapolis, http://www.rndsystems.com), GCTM-2 (this laboratory), TRA-1-60 (gift from P. Andrews, University of Sheffield, Sheffield, U.K.), Oct-4 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, http://www.scbt.com), TG-30 (this laboratory), nestin, β-tubulin, and neurofilament 200 (NF-200) (all from Chemicon, Temecula, CA, http://www.chemicon.com). Nuclei were counterstained with Hoechst-33342 (Chemicon). Assessment of long-term expression of stem cell markers was performed on HES-2 (supplemental online Fig. 1), HES-3, and HES-4 (supplemental online Fig. 1) at different passages (p) as follows, where each passage represents a minimum of five population doublings based on net colony expansion during each passage: GCTM-2 (HES-2 p6, HES-3 p3, p10, p13, p15, p20 HES-4 p3), TRA-1-60 (HES-3 p10, p13, HES-4 p3), Oct-4 (HES-2 p6, HES-3 p10, p13, p15, HES-4 p3), and TG-30 (HES-3 p10, p13, HES-4 p3). Fluorescence was visualized with an upright Leica DM R microscope equipped with a mercury lamp. Images were captured using a Leica DC200 camera and analyzed using Leica DC viewer software (Leica, Heerbrugg, Switzerland, http://www.leica.com).

Sphingosine Kinase Activity

HES-3 cells plated without MEF for 24 hours and depleted of serum for an additional 18 hours were incubated in the presence of PDGF for various time periods and were harvested and lysed by sonication (2 W for 30 seconds at 4°C) in lysis buffer (50 mM Tris/ HCl [pH 7.4], 10% glycerol, 0.05% Triton X-100, 150 mM NaCl, 1 mM dithiothreitol, 2 mM Na3VO4, 10 mM NaF, 1 mM EDTA, and protease inhibitors [Complete, Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com]). SPK activity was determined using D-erythro-sphingosine and [γ32P]ATP as substrates, as previously described [14]. Protein concentrations in cell homogenates were determined with Coo-massie brilliant blue reagent (Bio-Rad, Hercules, CA, http://www.bio-rad.com) using BSA as standard.

GCTM-2 Quantification

Cells fixed in 100% ethanol were immunostained with GCTM-2 followed by alkaline phosphatase–coupled secondary antibodies (Dako). Alkaline phosphatase activity was detected by 4-nitro-phenyl phosphate (Roche Diagnostics), and the concentration of the reaction product was determined by reading the optical density (OD) at 405 nm. To validate the technique as an accurate indicator of the proportion of GCTM-2–positive cells, standard curves were carried out with the embryonal carcinoma cell line GCT27C4, known to express GCTM-2 [15]. This showed a linear correlation between the number of cells and the OD read at 405 nm (Fig. 1A). The GCTM-2 antigen has been described for many years [2, 1521]. The antibody GCTM-2 detects an epitope on the core protein of a keratan sulphate/chondroitin sulphate pericellular matrix proteoglycan expressed by human pluripotent stem cells; TRA-1-60 and TRA-1-81 recognized epitopes on carbohydrate side chains on the same molecule.

thumbnail image

Figure Figure 1.. S1P and PDGF inhibit the spontaneous differentiation of hESCs in the absence of serum. (A): Correlation with cell number (GCT27C4) and GCTM-2 expression. The data were submitted to the linear regression test (r2 = .9497; 95% confidence interval). (B–E, H): GCTM-2 quantification from hESCs grown on mouse embryonic fibroblasts in the absence of serum, with or without (control) the indicated agonists for either (B) 2 weeks or (C–E, H) 12 days. Control: no serum. (F): Reverse transcription–polymerase chain reaction for SPKs. (G): SPK activity measurement after incubation of hESCs with PDGF. (I): GCTM-2 quantification from hESCs grown on Matrigel in the absence of serum, with or without (control) S1P + PDGF or KSR. (J, K): Fluorescence-activated cell sorter analysis of GCTM-2+/BrdU+/PI cells in the presence or absence (control) of S1P + PDGF or KSR. (J): Note that the GCTM-2 signal could be observed as a 1- or 2-peak signal in both S1P + PDGF and KSR conditions depending on the experiments. (K): The BrdU pulse was performed at day 7 and measured the proliferation rate of cells for this time point. (B, C, E–H, J1, K1): Mean ± SEM of at least three independent experiments. (A, D, I): Mean ± SEM of three determinations; representative of three independent experiments. (J2–J4, K2, K3): Representative data of at least three independent experiments; each gating was set according to its corresponding negative control. (E): PTX, U0126, and DMS were used at doses that produced a minimal effect on cells grown in serum-free medium without S1P + PDGF. Abbreviations: DMS, dimethylsphingosine; hESC, human embryonic stem cell; KSR, knockout serum replacement; PDGF, platelet-derived growth factor; PTX, pertussis toxin; S1P, sphingosine-1-phosphate; SPK, sphingosine kinase.

Download figure to PowerPoint

Proliferation Assay

After splitting and attachment, cells issued from same passaged bulk cultures were incubated with or without (control) S1P + PDGF or KSR for 7 days. Cells were labeled with 5-bromo-2′-deoxyuridine (BrdU-labeling reagent; Roche Diagnostics) for the last 2 hours of incubation. hESCs were harvested, dissociated into single cells, and fixed in methanol, and cellular DNA was denaturated by HCL 4N. After pH neutralization, cells were immunostained with GCTM-2 followed by alexa-fluor-647 secondary antibodies (Molecular Probes), anti–BrdU-FLUOS (Roche Diagnostics), and propidium iodide (Sigma). Samples were analyzed on a flow cytometer (MoFlo, DakoCytomation).

Karyotyping

G-banding of HES-2 (p6, 2 × 20 cells; supplemental online Fig. 1), HES-3 (p8, 15 cells; p23, 20 cells; p58, 13 cells), and HES-4 (p8, 20 cells; supplemental online Fig. 1) colonies were performed by Southern Cross Pathology Australia, Clayton, Australia.

Teratoma Formation in Severe Combined Immunodeficiency Mice

HES-3 (p6) and HES-4 (p4, p11, data not shown) cell colonies with an undifferentiated morphology were harvested and injected into testis of severe combined immunodeficiency (SCID) mice as previously described [2]. Seven weeks later, the resulting tumors were removed and fixed in neutral buffered formalin 10%, embedded in paraffin, and examined histologically after hematoxylin and eosin staining.

Neuronal Induction of hESCs

HES-3 cells (p11, p13–15) were differentiated into noggin cells, then into neurospheres, and lastly into neurons as previously described [22].

Statistical Analysis

All experiments were performed at least three times. Significance of the differences was evaluated using two-tailed t-tests. Values of p < .05 were considered significant (*).

Results and Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results and Discussion
  6. Conclusion
  7. Acknowledgements
  8. References
  9. Supporting Information

hESCs expressed mRNA transcripts for LPA receptors (Fig. 2A) and mRNA transcripts and the corresponding proteins for three S1P receptors, S1P1, S1P2, and S1P3 (Figs. 2B, 2C), whereas these cells did not express mRNA for S1P4 and S1P5 (data not shown). hESCs also expressed mRNA transcripts for PDGFR-α and PDGFR-β as well as the corresponding proteins (Figs. 2D–2J). Consistent with previous reports [9, 2326], we found that MEF expressed S1P1, S1P2, S1P3, LPA1, LPA2, PDGFR-α, and PDGFR-β (data not shown).

thumbnail image

Figure Figure 2.. hESCs are targets of S1P, LPA, and PDGF. Reverse transcription–polymerase chain reaction for lysophospholipid receptors (A, B), PDGFR-α (alpha), and PDGFR-β (beta) (D) with (+) or without (−) reverse transcriptase. (C): Western blot analysis of S1P receptors. Immunostaining of hESCs with (E, H) Hoechst 33342, (F) PDGFR-α, or (I) PDGFR-β and (G, J) GCTM-2 antibodies. Scale bars = 50 μm. Abbreviations: hESC, human embryonic stem cell; LPA, lysophosphatidic acid; PDGF, platelet-derived growth factor; PDGFR, platelet-derived growth factor receptor; S1P, sphingosine-1-phosphate.

Download figure to PowerPoint

When hESCs were grown on MEFs in a serum-free culture medium, they spontaneously differentiated into a morphologically diverse array of cell types. After 2 weeks in a serum-free medium, LPA (up to 50 μM) had no obvious effect on size or morphology of hESC colonies, whereas in the presence of either S1P or PDGF-AB (PDGF), the colonies appeared flatter and less-differentiated compared with controls. However, the combination of S1P and PDGF seemed to induce a more striking inhibition of spontaneous differentiation in the hESCs. To quantify these effects, we developed an enzyme-linked immunosorbent assay (ELISA)–based assay to measure expression of the stem cell surface antigen GCMT-2 using the embryonal carcinoma cell line GCT27C4 (Fig. 1A). We then incubated cells for 2 weeks with different agonists. Cells treated with S1P or PDGF showed greater reactivity with GCTM-2 than controls (S1P, 141% ± 41% [n = 3, statistically not significant] signal of controls; PDGF, 215% ± 42% [n = 3, p < .01] signal of controls), whereas hESCs treated with both S1P + PDGF showed 447% ± 124% (n = 3, p < .01) signal of controls (Fig. 1B). Cells grown in serum showed a higher reactivity with GCTM-2 (677% ± 282% of control, n = 4, p < .01) than S1P + PDGF but with higher variations between experiments (Fig. 1B). When human serum albumin was the same effect of S1P + PDGF on the maintenance of hESCs (data not shown). Cells treated with S1P and either PDGF-AA or PDGF-BB showed levels of GCTM-2 expression similar to those observed with S1P + PDGF (PDGF-BB, 448% ± 161% of control, n = 4, p < .01; PDGF-AA, 319% ± 98% of control, n = 4, p < .01; Fig. 1B). When hESCs were treated with PTX, which ADP-ribosylates αi/o proteins, the effect of S1P + PDGF measured with GCTM-2 reactivity was inhibited in a 12-day assay (Figs. 1C, 1E). Together, these results suggest that the combination of S1P + PDGF in a serum-free culture medium prevents the spontaneous differentiation of hESCs and that this effect is mediated by their respective receptors. Treatment of hESCs with the mitogen-activated protein kinase kinase inhibitor U0126 for 12 days inhibited the effect of S1P + PDGF on GCTM-2 expression (Figs. 1D, 1E), strongly suggesting that the activation of the extracellular signal-regulated kinases (ERKs) is required to maintain hESC undifferentiation.

Because SPK is a key molecule in PDGF signaling pathways and has been shown to be directly activated by ERK1/2 [27], we examined its involvement in hESC differentiation. Thus, we verified the presence of SPK transcripts in hESCs and showed expression of SPK-1 and SPK-2 mRNA (Fig. 1F). We next investigated whether PDGF modulates SPK activity in hESCs. PDGF enhanced in a time-dependent manner the SPK activity in hESCs (Fig. 1G). This effect lasted for at least 60 minutes, with SPK activity increasing 1.6-fold over basal levels (75.3 ± 3.9 pmol/min per mg, n = 3) after 30 minutes of incubation (Fig. 1G). In contrast, PDGF did not induce a statistically significant activation of SPK in MEF (data not shown). Moreover, a 12-day treatment of hESCs with the SPK inhibitor DMS (Figs. 1E, 1H) blocked the effect of S1P + PDGF, suggesting an essential involvement of SPK in the maintenance of hESCs in an undifferentiated state. Because MEF-SPK was not activated by PDGF, these data also indicate that the effect of PDGF on hESCs is direct and not feeder cell–mediated. Moreover, when hESCs were grown on Matrigel for 7 days, in the presence or absence of S1P + PDGF, the GCTM-2 expression level was higher in the presence of these two compounds compared with the one observed in the control condition, strongly suggesting a direct effect of S1P + PDGF on hESCs (Fig. 1I).

Using flow cytometry, we confirmed the ELISA results reported above and showed that the percentage of GCTM-2+ cells in hESC colonies cultivated for 1 week in the presence of S1P + PDGF was slightly lower than that of cells grown in the presence of KSR but much higher than in serum-free medium (65.3% ± 0.9% vs. 88.1% ± 3.6%, n = 4; control [no serum], 18.6% ± 6.4%, n = 3; Figs. 1J, 1K). The precise levels of GCTM-2+ cells in KSR or S1P + PDGF varied from experiment to experiment but were always at least two times higher than controls. hESCs cultivated for 1 week with S1P + PDGF had similar cell-cycle phase distributions to those cultivated in KSR, as measured by BrdU incorporation (respectively, 46.5% ± 5.4% and 46.3% ± 3.1% of the GCTM-2+ cells were in S phase after 2 hours of labeling with BrdU, n = 3, Figs. 1J, 1K), indicative of a primary effect on hESC maintenance rather than an effect on cell-cycle progression.

Long-term cultivation and assessment of expression of stem cell markers confirmed successful maintenance of hESCs in a serum-free medium in the presence of S1P + PDGF. The hESC cultures grown in S1P + PDGF formed colonies that were smaller and thinner compared with controls grown in serum, and they were therefore more fragile when passaged by mechanical dissociation. HES-2, -3, and -4 cells have been grown in a serum-free medium supplemented with S1P + PDGF for, respectively, 16, 83, and 11 passages or approximately 80, 415, and 55 population doublings (Fig. 3A). Reverse transcription–PCR studies showed that S1P/PDGF-treated hESCs expressed the mRNA for Oct-4 and cripto (Fig. 3B), and immunostaining showed reactivity with antibodies anti–GCTM-2, Oct-4, TG-30 (recognizing CD9), and Tra-1-60 (Figs. 3C–3F, supplemental online Fig. 1). All three hESC lines tested retained a normal karyotype (Fig. 3G, supplemental online Fig. 1) and formed teratomas containing tissues representative of the three embryonic germ layers after inoculation in the testis capsule of SCID mice (Figs. 3H, 3I). Moreover, S1P/PDGF-treated HES-3 cells responded to noggin treatment and neuronal induction [22] with formation of neuronal cells, as ascertained by immunostaining for nestin, β-tubulin, and NF-200 (Figs. 3J–3L). Altogether, these data demonstrate that hESCs grown in the presence of S1P + PDGF retain the normal characteristics of hESCs propagated in serum. Even if the use of this defined medium does not eliminate the feeder cell requirement, these findings provide a basis for the development of a fully defined hESC culture system.

thumbnail image

Figure Figure 3.. Characterization of human embryonic stem cells. (A): HES-3 cells grown in the presence of S1P + PDGF (p14). (B): Reverse transcription–polymerase chain reaction using mRNA from HES-3 cells grown in the presence of S1P + PDGF (p6) using specific primers for Oct-4, cripto, with (+) or without (−) reverse transcriptase. Immunostaining of HES-3 cells grown in the presence of S1P + PDGF (p13) with (C) GCTM-2, (D) Oct-4, (E) TG-30, or (F) TRA-1-60. (G): Karyotyping of HES-3 cells grown in the presence of S1P + PDGF. Histology of teratoma with cartilage and squamous epithelium (H), glandular epithelium, and pigmented cells (I) after injection of HES-3 (p6) into severe combined immunodeficiency mice. Neuronal differentiation assessed by (J) nestin, (K) β-tubulin, and (L) neurofilament 200. Scale bars = 50 μm. Abbreviations: PDGF, platelet-derived growth factor; S1P, sphingosine-1-phosphate.

Download figure to PowerPoint

Conclusion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results and Discussion
  6. Conclusion
  7. Acknowledgements
  8. References
  9. Supporting Information

This study demonstrates for the first time a role for lysophospho-lipid signaling in stem cell maintenance. Our data indicate a critical requirement for interaction between S1P and PDGF signaling, in that extracellular S1P and PDGF need to be present together to exert a potent biological effect. A similar mechanism has been reported in mesangial cells, where application of S1P + PDGF increases proliferation [28]. The addition of S1P + PDGF maintains hESCs in the undifferentiated state, and the cells remain pluripotent during extended cultivation in the presence of these factors. MEFs are also target cells of S1P and PDGF, but our biochemical studies indicate that hESCs directly respond to both S1P and PDGF. The effect of S1P in combination with PDGF might result from S1P activation of receptors to modulate intracellular signaling pathways, which complement those activated by PDGF. Because the maintenance of hESCs in an undifferentiated state only occurs in the presence of both S1P and PDGF, we could expect that intracellular S1P, produced in response to PDGF, acts within the cells, because its cell-surface receptors are likely to have already been engaged by S1P added to the culture medium.

Amit et al. [29] described a feeder-free culture system to propagate hESCs using a combination of different growth factors. Moreover, during the preparation of this manuscript, Beattie et al. [30] reported that activin A maintains hESCs undifferentiated in the absence of MEF or MEF-conditioned medium. Despite the absence of feeder cells in both culture systems, these conditions still require the presence of KSR and thus cannot be considered chemically defined media.

Altogether, these results are the characterization of a simple combination of bioactive molecules able to maintain pluripotentiality of hESCs. This study identifies lysophospholipid signaling as a novel pathway in pluripotent stem cell maintenance.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results and Discussion
  6. Conclusion
  7. Acknowledgements
  8. References
  9. Supporting Information

A.P. and R.C.B.W. contributed equally to this work. This study was supported by Monash University, ES Cell International, and the National Institutes of Health (NIGMS GM68417). We are grateful to Drs. S. Hawes and R. Mollard for helpful discussions and to Dr. P. Andrews for providing TRA-1-60.

Disclosures

M.F.P. owns stock in and within the past 2 years performed contract work for ES Cell International.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results and Discussion
  6. Conclusion
  7. Acknowledgements
  8. References
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results and Discussion
  6. Conclusion
  7. Acknowledgements
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
SC040338SuppFig.pdf76KSupplemental Figure 1

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.