SEARCH

SEARCH BY CITATION

Keywords:

  • OCT4;
  • Stem cells;
  • Tumor cell lines;
  • HeLa cells;
  • MCF7 cells

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosure of Potential Conflicts of Interest
  8. Acknowledgements
  9. References
  10. Supporting Information

The POU-domain transcription factor OCT4 is associated with the pluripotent state of cells comprising the inner cell mass of pre-implantation embryos and has been known to play a critical role in the maintenance of pluripotency of embryonic stem cells. Reactivation of OCT4 expression is postulated to occur in differentiated cells that have undergone carcinogenesis, or tumor formation. In contrast to earlier studies, recent reports describe OCT4 expression in several human tumor cell lines. To resolve the apparent discrepancy in OCT4 expression between earlier and recent studies, we determined OCT4 expression in the cervical carcinoma cell line HeLa and the breast cancer cell line MCF7 in comparison with the human teratoma cell line nTera by immunofluorescence, Western blot, and RT-PCR analyses. We were unable to detect staining of the OCT4 transcription factor in the nucleus of HeLa and MCF7 cells by immunofluorescence using two different monoclonal antibodies. Faint cytoplasmic staining in HeLa and MCF7 cells was observed; however, no OCT4 signal could be detected by Western blot analysis. In addition, we were unable to detect significant levels of OCT4 mRNA in HeLa and in MCF7 cells by RT-PCR. Furthermore, the OCT4 promoter region is highly methylated in HeLa and MCF7 cells. We argue that recent reports of OCT4 expression in these and other cancer cell lines could actually be attributed to OCT4 pseudogene expression or misinterpretation of background signals in immunofluorescence experiments. In conclusion, we emphasize the need for adequate controls in investigations of OCT4 expression in somatic cell lines by immunofluorescence and RT-PCR.

Disclosure of potential conflicts of interest is found at the end of this article.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosure of Potential Conflicts of Interest
  8. Acknowledgements
  9. References
  10. Supporting Information

The POU-domain transcription factor OCT4 is known to play a crucial role in the maintenance of embryonic stem cell potency and in the propagation of the mammalian germline [1, 2]. Loss of OCT4 expression at the blastocyst stage, by in vivo mutagenesis, has been shown to lead to differentiation of the cells of the inner cell mass into the trophectodermal cell fate [3], thereby suggesting that OCT4 is an essential component in the establishment and/or maintenance of cellular pluripotency. Following gastrulation, OCT4 is involved in the maintenance of the mammalian germline. Recent studies have demonstrated that OCT4 is required for the survival of early primordial germ cells, as these cells undergo apoptosis after deletion of the Oct4 locus in a conditional knock-out mouse model [4]. OCT4 is expressed in germ cell tumors, such as seminoma, dysgerminoma, germinoma, and embryonic carcinoma, and can be detected by immunohistochemistry, a tool that holds immense diagnostic potential in these diseases, according to a recent review by Cheng [5].

Ectopic OCT4 expression in somatic (stem) cells causes epithelial dysplasia and may be associated with tumor formation, as reported by Hochedlinger [6]. Several recently published studies describe the presence of OCT4 protein in tumor tissues or cells, such as bladder cancer [7], breast cancer [8, [9], [10]11], pancreatic cancer [12], as well as osteo- and chondrosarcoma [13]. Tai et al. [9] demonstrated the presence of OCT4 in several cell lines from breast, pancreatic, liver, kidney, and gastric cancer as well as in the cervical carcinoma cell line HeLa and the breast cancer cell line MCF7 by immunofluorescence analyses. In a recent publication, Zangrossi et al. [14] made reference to these results and, in particular, to the detection of OCT4 expression in MCF7 cells, which was described as a positive control. In these recent studies, OCT4 fluorescence signal was not localized to the nucleus, but to the cytosol. These findings are not consistent with earlier studies, which did not report OCT4 expression in HeLa cells, 293 kidney cancer cells, and COS cells—which had not been transfected with an OCT4 construct—by gel shift assay (EMSA), Western blot, or immunofluorescence [15, [16], [17], [18]19]. In line with these contradictory results, three recent papers dispute the role of OCT4 as a valid marker for stemness. Liedtke et al. raise the issue of OCT4 pseudogenes as a source of confusion in stem cell research [20] and Kotoula et al. demonstrate that the second isoform of hOCT4, that is, hOCT4B, which is related neither to stemness nor pluripotency, can account for much of the misinterpretation of experimental data [21]. In addition, Lengner et al. demonstrated that the absence of OCT4 protein does not interfere with somatic stem cell self-renewal [22].

To address these contradictory results as well as potential pitfalls regarding OCT4 as a general cancer stem cell marker, we systematically determined OCT4 expression in HeLa and MCF7 cells in comparison with the human teratoma cell line nTera using immunofluorescence, Western blot, RT-PCR, and DNA methylation analyses.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosure of Potential Conflicts of Interest
  8. Acknowledgements
  9. References
  10. Supporting Information

Cell Culture

HeLa and MCF7 cells were newly obtained from the European Collection of Cell Culture (London, http://www.ecacc.org.uk) for this study (Lot numbers 04A020 and 02K001, respectively) and cultured on gelatin-coated (0.1%) tissue culture plates (Falcon BD, Heidelberg, Germany, http://catalog.bd.com) in MEM-Earls medium (Invitrogen, Karlsruhe, Germany, http://www.invitrogen.com), supplemented with 10% heat-inactivated fetal calf serum and the additives L-Glutamine (2 mM), non-essential amino acids, and penicillin/streptomycin (all Invitrogen). nTera cells (ECACC: Lot number 02L006), which were used as a positive control for OCT4 expression, were cultured on tissue culture plates in high glucose DMEM (Invitrogen), supplemented with 10% heat-inactivated fetal calf serum, L-Glutamine (2 mM), and penicillin/streptomycin. To ensure identical incubation conditions during immunofluorescence analyses, HeLa, MCF7, and nTera cells were cultured side-by-side, in one well each, in 4-well chamber slides (Nunc).

Generation of the Monoclonal Antibody GA1

Six-week-old female Balb/c mice were immunized with 20 μg of recombinant mouse OCT4 protein diluted in Gerbu adjuvant (GA; Gerbu, Gaiberg, Germany, http://www.gerbu.de) per injection according to the manufacturer's specifications. Spleen cells from mice with sufficient serum titer (>1:1000 in a standard ELISA using 100 μg OCT4 protein per plate) were fused with myeloma cells according to standard procedures. Positive clones were recloned three times by limiting dilution. Clone GA1 was specifically reactive, and its supernatant was subjected to purification by protein G chromatography for immunofluorescence analyses.

Immunofluorescence

HeLa, MCF7, and nTera cells grown on chamber slides were washed in PBS before being fixed in 100% methanol (Sigma, Munich, Germany, http://www.sigmaaldrich.com) for 7 min at −20°C and then rinsed in acetone (Sigma, Germany) for 20-second at −20°C. Alternatively, cells were fixed in 4% paraformaldehyde for 5 min and then permeabilized in 0.1% Tween 20 in PBS (PBS-Tween) for additional 5 min. The cells were washed three times in PBS before being incubated with anti-OCT4 monoclonal antibodies for 45 min at room temperature. Several antibody dilutions were tested, with the 1:100 dilution considered optimal for both antibodies: sc5279 (Santa Cruz Biotechnology, Santa Cruz, CA, http://www.scbt.com) and purified GA1 (1 mg/ml). For negative control samples, the primary antibody was either omitted or the sc5279 antibody was blocked by inhibition with a four-fold excess of OCT4 blocking peptide (sc4420, Santa Cruz Biotechnology). Cells were washed three times in PBS both before and after incubation with the secondary antibody (Cy3-labeled goat anti-mouse lgG, Jackson ImmunoResearch, West Grove, PA, http://www.jacksonimmuno.com) and 1 nM 4′,6-Diamidino-2-Phenyl-Indol-dihydrochloride (DAPI, Sigma). ProLong Gold and SlowFade Gold Antifade Reagent (Invitrogen, Germany) was used as mounting medium to minimize fluorochrome quenching.

Western Blot

HeLa, MCF7, and nTera cells were cultured on 10-cm tissue culture dishes until the growth reached confluence. Cell extracts were prepared by hypotonic lysis in 1 ml of 10 mM Tris/HCl pH 7.4, supplemented with protease inhibitors (100 μM phenylmethanesulfonyl fluoride, PMSF; 1 μM leupeptin; 1 μM pepstatin; 0.3 μM aprotinin; all Sigma, Germany), followed by ultrasound homogenization for six cycles (5 seconds each). Protein concentrations were determined using the BIO-Rad Protein Assay (Biorad, Germany). Samples were separated on a 10% SDS-polyacrylamide gel (PAGE) according to standard procedures and blotted onto a PVDF membrane (Millipore, Schwalbach, Germany, http://www.millipore.de). After blocking in 3% milk powder (Amersham, Freiberg, Germany, http://www.gelifescience.com) and washing in PBS-Tween, the blots were incubated with anti-OCT4 monoclonal antibody (sc5279, Santa Cruz Biotechnology: 1:1000 or undiluted GA1 supernatant). Horseradish peroxidase–coupled anti-mouse IgG antibody (1:10,000, Amersham, Germany) was used as the secondary antibody. For chemoluminescence detection, ECL (ECL Western blotting detection reagents and analysis system, Amersham, Germany) was applied to the blots according the manufacturer's instructions.

RNA Isolation and RT-PCR

Confluent 10-cm culture plates of HeLa, MCF7, and nTera cells were used for RNA isolation (RNeasy Mini Kit, Qiagen, Hilden, Germany, http://www1.qiagen.com). RNA quality and quantity were determined using the 2,100 Bioanalyzer system (RNA 6,000 Nano Assay, Agilent Technologies, Germany). Four.2 μg of total RNA was digested with DNAse I (Invitrogen) and used for first strand cDNA synthesis (Super Script III First-Strand Synthesis System, Invitrogen). Both the HeLa mRNA sample that came with this kit and our freshly isolated total RNA sample from HeLa cells served as positive controls. Optimal RT-PCR reaction conditions were set as: 35 cycles of 94°C for 30 seconds; 58°C for 30 seconds; 72°C for 45 seconds, after an initial denaturation step of 94°C for 10 min. PCR products were sequenced to ensure specific amplification. For detection of human OCT4 RNA, the primer combination used was ACACCTGGCTTCGGATTTCG (for) and GGCGATGTGGCTGATCTGCT (rev) [23], and for detection of human β-actin RNA, the primer combination used was CGTGGGGCGCCCCAGGCACCA (for) and TTGGCCTTGGGGTTCAGGGGGG (rev).

Quantitative RT-PCR

For real-time RT-PCR analyses, OCT4 transcript levels were determined using the ABI PRISM Sequence Detection System 7,900HT (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com) and the ready-to-use 5′-Nuclease Assays-on-Demand (POU5F1A: Hs01895061_u1 and Hs03005111_g1, POU5F1B: Hs00742896_s1, β-actin (ACTB: Hs99999903_m1). Raw quantities of OCT4 transcripts were normalized to the endogenous β-actin gene within the log-linear phase of the amplification curve (Ct method, ABI PRISM 7,700 Sequence Detection System User Bulletin 2; Applied Biosystems). Three replicates were used for each real-time PCR; an RT blank and a no-template blank served as negative controls.

Bisulfite Sequencing Analysis

To determine the methylation status of the OCT4 distal enhancer (DE) region, which is highly conserved among species and one of the important regulatory elements of OCT4 [24], bisulfite sequencing PCR (BS-PCR) was performed with genomic DNA from HeLA, MCF7, and nTera cells as published earlier [25]. All PCR amplifications included a total of 50 cycles of denaturation at 94°C for 30 seconds, annealing at proper temperature for each target region for 30 seconds, and extension at 72°C for 30 seconds with a first denaturation at 94°C for 5 min and final extension at 72°C for 10 min. The primers and annealing temperatures were as follows: OCT4 distal enhancer (DE) first sense 5-AGGAGTTATTAGGAAAATGGGTAGTAG-3, OCT4 DE first antisense 5-TACCTTCTAAAAAAATAAATATCCC-3 (537 base pairs [bp], 45°C); OCT4 DE second sense 5-ATTTGTTTTTTGGGTAGTTAAAGGT-3, OCT4 DE second antisense 5-CCAACTATCTTCATCTTAATAACATCC-3 (221 bp, 55°C). Three μl of each of the first PCR product was used as the template for the second PCR reaction. The second PCR products were subcloned using PCR 2.1-TOPO vector (Invitrogen) according to the manufacturer's protocol. The reconstructed plasmids were purified with QIAprep Spin Miniprep kit (Qiagen), and individual clones were subsequently sequenced (GATC Biotech, Konstanz, Germany, http://www.gatc-biochem.com). Clones were only accepted if there was at least 90% cytosine conversion, and all possible clonalities were excluded based on criteria from the BiQ Analyzer software (Max Planck Society, München, Germany, http://www.mpg.de). At least 10 replicates were performed for each of the selected regions in each cell line.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosure of Potential Conflicts of Interest
  8. Acknowledgements
  9. References
  10. Supporting Information

We first analyzed the expression of OCT4 in HeLa and MCF7 cells in comparison with human teratoma cells (nTera) by immunofluorescence (Fig. 1), as this method provides information on both the presence and location of the OCT4 protein. Two different fixatives (methanol/acetone or paraformaldehyde followed by cell permeabilization with PBS-Tween) were used to optimize the immunofluorescence protocol. Both fixatives yielded comparable results, but the methanol/acetone fixative resulted in slightly lower background fluorescence. To ensure identical antibody incubation conditions for all three cell lines, HeLa and MCF7 cells were cultured on the same 4-well chamber slide as were the nTera cells, which served as the positive control. OCT4 was strongly detected in the nucleus of nTera cells using two different monoclonal anti-OCT4 antibodies (sc5279 in Fig. 1A and GA1 in Fig. 1C). When we controlled for the microscope settings (i.e., same exposure time, camera gain, etc.), no specific signal could be detected in HeLa and MCF7 cells neither using the sc5279 antibody nor the GA1-antibody (Fig. 1E, 1G, 1I, 1K). Upon a five-fold increase in exposure time and a higher camera gain setting, fluorescence signals could be detected in the cytosol of HeLa and MCF7 samples. During image processing (Adobe Photoshop CS1), the γ-curve was modified to further enhance these fluorescence signals, as demonstrated in the lower right insets in Figure 1E, 1G, 1I, 1K. However, similar results were obtained for the negative controls (no-first-antibody controls or after inhibition of the sc5279-immunoreactivity with the OCT4-blocking peptide), most likely due to background staining of the secondary antibody (supplemental online Fig. 1).

thumbnail image

Figure Figure 1.. OCT4 immunofluorescence in tumor cell lines. nTera (A–D), HeLa (E–H), and MCF7 (I–L) cells were grown in separate wells of 4-well chamber slides to ensure identical sample processing. Both anti-OCT4 monoclonal antibodies (sc5279 and GA1) yielded strong nuclear staining signals in nTera cells (A, C), which co-localized to the DAPI-staining (B, D). In contrast, with the same settings, no significant signals were detected in HeLa (E, G) or MCF7 (I, K) cells. Overexposure and excessive manipulations of signal levels and γ-curve adaptations during image processing only led to the amplification of background fluorescence (lower right quadrants in E, G, I, K) due to nonspecific cytosolic antibody binding (scale bar: 50 μm).

Download figure to PowerPoint

To further assess whether the low fluorescence signal in HeLa and MCF7 cells is due to weak but specific OCT4 protein expression or whether the signal reflects background fluorescence, we performed Western blot analyses of whole cell lysates from several cell preparations (Fig. 2). In the first set of analyses (Fig. 2A, 2B), we used 5 μg of protein extract from HeLa and MCF7 cells and 1 μg, 2.5 μg, and 5 μg of protein extract from nTera cells from two independent preparations. High-intensity bands of the expected size (∼50 kDa) were detected in the positive control nTera samples using both anti-OCT4 antibodies (sc5279 in Fig. 2A and GA1 in Fig. 2B), but only very faint, if any, bands in the expected size range and some bands of smaller size were detected using HeLa and MCF7 extracts. To determine if any of these bands are specific to OCT4, we addressed the issue of nonspecific reactivity of the secondary antibody (Fig. 2C, 2D). One blot was incubated with the sc5279 antibody (Fig. 2C) and another was used as no-first-antibody negative control (Fig. 2D); both blots incubated with the same secondary antibody. Again, faint bands were detected in the HeLa and MCF7 preparations (dashed box in Fig. 2C), but overexposure of the no-first-antibody negative control blot clearly demonstrated a nonspecific signal in the corresponding region due to binding of the secondary antibody. Furthermore, in the samples incubated with the secondary antibody alone, we also detected the smaller-size bands (Fig. 2C, 2D).

thumbnail image

Figure Figure 2.. Western blot analyses of nTera, HeLa, and MCF7 cell protein extracts. Two independent protein preparations were analyzed on one SDS-PAGE (left and right of dashed line in A and B, respectively) and detected on separate gels using two anti-OCT4 monoclonal antibodies (sc5279 in A, GA1 in B). In nTera extracts, the ∼50 kDa OCT4 protein was consistently detected, but only faint bands, if any, were detected in the HeLa and MCF7 extracts. In these samples, additional strong bands were also detected, corresponding to smaller-size proteins. In a third experiment, another protein preparation was loaded onto two SDS-PAGE, and the blots were incubated with sc5279 (C) or without a primary antibody as a negative control (D). Faint bands were detected for HeLa and MCF7 cells using the sc5279 antibody (dashed box in C), but overexposure of the negative-control blot clearly demonstrated that these bands were false positives due to nonspecific binding of the secondary antibody.

Download figure to PowerPoint

We next sought to determine whether OCT4 mRNA is present in HeLa and MCF7 cells. Both the use of undiluted and diluted (1:100) nTera RNA yielded high intensity PCR bands. However, no PCR products were detected using equal amounts of total HeLa or MCF7 RNA even after 35 cycles, confirming the absence of OCT4 transcripts (Fig. 3A). These qualitative data were confirmed using quantitative real-time PCR. Three different primer/probe sets from Applied Biosystems were used to distinguish between the two OCT4 isoforms, OCT4A and OCT4B, as well as the OCT4 pseudogene three (Fig. 3B). The expression of OCT4A (made-to-order assay Hs03005111_g1) was close to the detection limit (-RT-control) in both HeLa and MCF7 RNA preparations and at least two to three orders of magnitude lower than that in nTera cells (black bars in Fig. 3B). Slightly higher OCT4 expression levels were obtained using the inventoried assay Hs01895061_u1 (white bars in Fig. 3B), which can, additionally, amplify the OCT4 pseudogene 3. With the inventoried assay Hs00742896_s1 for the OCT4B isoform, similar expression levels were obtained in all three cell lines (gray bars in Fig. 3B). In addition to these experiments, we determined the OCT4 promoter methylation status by bisulfite sequencing analysis (Fig. 3C). In nTera cells, the distal enhancer region of OCT4 was found to be completely unmethylated (0.0%), whereas in HeLa and MCF7 cells, the promoter region was highly methylated (92.3% and 98.7%, respectively), suggesting that expression of OCT4 was completely silenced in both of these cell lines.

thumbnail image

Figure Figure 3.. Gene expression analyses of nTera, HeLa, and MCF7 cells. Equal amounts of total RNA were first transcribed into cDNA, and OCT4 and β-actin loci were then amplified by RT-PCR (A). Strong signals were obtained using nTera RNA preparations, but no OCT4 PCR product was obtained using HeLa RNA, regardless of whether we used the control sample from a commercial cDNA synthesis kit or freshly isolated RNA prepared from HeLa cells in our laboratory. Furthermore, no OCT4 PCR product was obtained using the MCF7 RNA preparations. In addition, by quantitative real-time RT-PCR (B) specific for human OCT4A (black bars), only basal OCT4 expression in HeLa and MCF7 cells was demonstrated. Using another assay, which can also detect the OCT4 pseudogene three (white bars), slightly stronger OCT4 expression was obtained. OCT4B transcription (gray bars) was similar in all samples. Most strikingly, determination of the methylation status of the distal enhancer region of the OCT4 promoter showed almost fully methylated CpG islets in HeLa and MCF7 in contrast to completely unmethylated regions in nTera cells (C).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosure of Potential Conflicts of Interest
  8. Acknowledgements
  9. References
  10. Supporting Information

The issue of OCT4 expression in somatic stem cells and its function as a marker for stemness is highly controversial and remains unresolved. Among a variety of studies, seven groups [7, [8], [9], [10], [11], [12]13] have described the expression of OCT4 in several tumor cells, as demonstrated by immunohistochemistry, Western blotting, or RT-PCR. In the most recent article by Zangrossi et al. [14], the authors have described the presence of the OCT4 protein in peripheral blood mononuclear cells and refer to the breast carcinoma cell line MCF7 as a positive control for OCT4 expression. Tai et al. [9] previously reported that OCT4 is present in stem cells of the human breast, liver, pancreas, kidney, and intestine. Their study specifically demonstrated cytosolic staining of the OCT4 protein in MCF7 and HeLa cells. These observations are not consistent with the results of earlier published studies. In particular, in these earlier studies, HeLa cells were frequently used to (over)express OCT4 for functional analyses. OCT4 was never detected in the nucleus or cytoplasm of untransfected controls cells by immunofluorescence [15]. In addition, no other methods, including Western blot, gel shift assay (EMSA), or promoter activity studies, divulged the presence OCT4 in HeLa cells [16, [17]18]. Furthermore, a recent study of Lengner et al. [22] demonstrated that OCT4 expression is not required for mouse somatic stem cell self-renewal, thus questioning the validity of OCT4 as a marker for stemness.

In our present study, we used two anti-OCT4 monoclonal antibodies to address the reported inconsistency of OCT4 expression in tumor cell lines: a commercial antibody from Santa Cruz Biotechnology (sc5279) and purified hybridoma supernatant (GA1) prepared in our laboratory. The human teratoma cell line nTera was readily available and used as a positive control for OCT4 expression in all experiments. Carefully selected negative controls obtained without the inclusion of the primary antibody or by pre-incubation of the primary antibodies with the respective blocking peptide, clearly demonstrated that the faint fluorescence signals detected in HeLa and MCF7 cells are due to nonspecific reactions of the secondary antibody (Fig. 1). Observations of cytosolic staining similar to those recently reported by Zangrossi et al. [14] and Tai et al. [9] (dashed boxes in Fig. 1E, 1G, 1I, 1K) could only be obtained when the microscope settings were drastically manipulated to detect even the background fluorescence and when the images were processed with the help of γ-curve, brightness, and contrast settings. With these settings, background fluorescence signals were also obtained in negative controls—one which included a blocking peptide for the OCT4 antibody (data not shown) or the other which omitted the primary antibody (online supplemental Fig. 1). Our Western blot analyses (Fig. 2) confirmed the absence of OCT4 protein in extracts from HeLa and MCF7 cells. However, faint signals in the expected size range were obtained for samples in which the primary antibody was omitted, due to nonspecific binding of the secondary antibody to the whole cell lysate. Again, we emphasize the need to perform this appropriate control or to select a monoclonal antibody that can be blocked with the respective blocking peptide, the latter being the most favorable control.

In our present study, we could not detect OCT4 transcripts in HeLa or MCF7 cells by RT-PCR analysis (Fig. 3A). False-positive results may however be reported, as RT-PCR data may be readily misinterpreted due to the existence of many OCT4 pseudogenes and their presence in several tissues [26]. For example, processed OCT4 pseudogenes are present in the genomic DNA and can be amplified and detected by PCR (if the sample is not digested with DNAse), even in the −RT control, in which the reverse transcriptase reaction is omitted. This type of misinterpretation may have occurred in the work of Zangrossi et al. who reported the presence of a PCR signal even in the RT controls [14]. Due to this inconsistency, the authors also performed quantitative RT-PCR for human OCT4 and demonstrated a 25-fold lower expression in peripheral blood mononuclear cells than in human embryonic stem cells, which were used as a positive control. However, the Applied Biosystems assay used in their study does not amplify the pluripotency-related isoform OCT4A but does amplify the OCT4B isoform, whose function remains unresolved. The alternative inventoried assay, which is based on the OCT4A sequence, also amplifies the OCT4 pseudogene 3. Therefore, we analyzed the made-to-order assay Hs03005111_g1, which clearly detects OCT4A in nTera cells. With this assay, CT-values close to the detection limit (<3 cycles) were obtained using HeLa- and MCF-RNA preparations, suggesting a basal promoter activity, at most, in these two cell lines (Fig. 3B). Last, but not least, we determined the methylation status of the distal enhancer region of the OCT4 promoter by bisulfite sequencing analysis and clearly demonstrated hypermethylation of this region in HeLa and MCF7 cells compared to hypomethylation in nTera cells (Fig. 3C).

In conclusion, we clearly demonstrate the absence of OCT4 expression—that is, the absence of both RNA and protein signals—in HeLa and MCF7 cells, and the strong OCT4 expression in the positive control nTera cells. The use of carefully selected negative controls—such as those obtained by using specific monoclonal antibodies or blocking peptide for immunofluorescence or Western blots—as well as the exclusion of OCT4 pseudogenes and the OCT4B isoform as a confounding source of PCR signal must be considered in investigations of OCT4 expression in tumor and somatic stem cells. The most appropriate control, however, is to determine the methylation status of the OCT4 promoter region in cells that are expected to express OCT4.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosure of Potential Conflicts of Interest
  8. Acknowledgements
  9. References
  10. Supporting Information

The authors strongly acknowledge the support of Claudia Ortmeier for assistance with real-time PCR experiments and the help of Jeanine Müller-Keuker for preparation of the manuscript.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosure of Potential Conflicts of Interest
  8. Acknowledgements
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Disclosure of Potential Conflicts of Interest
  8. Acknowledgements
  9. References
  10. Supporting Information
FilenameFormatSizeDescription
SC-07-0657_Supplemental_Figure_1.pdf389KSupplemental Figure 1
SC-07-0657_Supplemental_Figure_Legend.pdf20KSupplemental Figure Legend

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.