Properties of Pluripotent Human Embryonic Stem Cells BG01 and BG02

Authors

  • Xianmin Zeng Ph.D.,

    Corresponding author
    1. Cellular Neurobiology Research Branch, National Institute on Drug Abuse, Department of Health and Human Services (DHHS), Baltimore, Maryland, USA
    • Development and Plasticity Section, Cellular Neurobiology Research Branch, National Institute on Drug Abuse, 333 Cassell Drive, Baltimore, Maryland 21224, USA. Telephone: 410-550-6565 (ext 138); Fax: 410-550-1621
    Search for more papers by this author
  • Takumi Miura,

    1. Laboratory of Neuroscience, National Institute of Aging, DHHS, Baltimore, Maryland, USA
    Search for more papers by this author
  • Yongquan Luo,

    1. Laboratory of Neuroscience, National Institute of Aging, DHHS, Baltimore, Maryland, USA
    Search for more papers by this author
  • Bhaskar Bhattacharya,

    1. Laboratory of Molecular Tumor Biology, Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA
    Search for more papers by this author
  • Brian Condie,

    1. BresaGen Inc., Athens, Georgia, USA
    Search for more papers by this author
  • Jia Chen,

    1. Cellular Neurobiology Research Branch, National Institute on Drug Abuse, Department of Health and Human Services (DHHS), Baltimore, Maryland, USA
    Search for more papers by this author
  • Irene Ginis,

    1. Laboratory of Neuroscience, National Institute of Aging, DHHS, Baltimore, Maryland, USA
    Search for more papers by this author
  • Ian Lyons,

    1. BresaGen Inc., Athens, Georgia, USA
    Search for more papers by this author
  • Josef Mejido,

    1. Laboratory of Molecular Tumor Biology, Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA
    Search for more papers by this author
  • Raj K. Puri,

    1. Laboratory of Molecular Tumor Biology, Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA
    Search for more papers by this author
  • Mahendra S. Rao Ph.D.,

    Corresponding author
    1. Laboratory of Neuroscience, National Institute of Aging, DHHS, Baltimore, Maryland, USA
    • Laboratory of Neuroscience, National Institute of Aging, 33 Cassell Drive, Baltimore, Maryland 21224, USA. Telephone: 410-558-8204; Fax: 410-558-8249
    Search for more papers by this author
  • William J. Freed

    1. Cellular Neurobiology Research Branch, National Institute on Drug Abuse, Department of Health and Human Services (DHHS), Baltimore, Maryland, USA
    Search for more papers by this author

Abstract

Human ES (hES) cell lines have only recently been generated, and differences between human and mouse ES cells have been identified. In this manuscript we describe the properties of two human ES cell lines, BG01 and BG02. By immunocytochemistry and reverse transcription polymerase chain reaction, undifferentiated cells expressed markers that are characteristic of ES cells, including SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, and OCT-3/4. Both cell lines were readily maintained in an undifferentiated state and could differentiate into cells of all three germ layers, as determined by expression of β-tubulin III neuron-specific molecule (ectoderm), cardiac troponin I (cardiomyocytes, mesoderm), and α-fetoprotein (endoderm). A large-scale microarray (16,659 genes) analysis identified 373 genes that were expressed at three-fold or higher levels in undifferentiated BG01 and BG02 cells as compared with pooled human RNA. Ninety-two of these genes were also highly expressed in four other hES lines (TE05, GE01, GE09, and pooled samples derived from GE01, GE09, and GE07). Included in the list are genes involved in cell signaling and development, metabolism, transcription regulation, and many hypothetical proteins. Two focused arrays designed to examine transcripts associated with stem cells and with the transforming growth factor-β superfamily were employed to examine differentially expressed genes. Several growth factors, receptors, and components of signaling pathways that regulate embryonic development, in particular the nodal signaling pathway, were detected in both BG01 and BG02. These data provide a detailed characterization and an initial gene expression profile for the BG01 and BG02 human ES cell lines.

Introduction

Embryonic stem (ES) cells, isolated from the blastocysts of preimplantation embryos, are pluripotent and have the capability to generate all the differentiating cells present in the embryo. ES cells were first described in mice and recently have been identified from multiple species including subhuman primates (rhesus and marmoset) and human [14]. Because of their unique properties, human (h)ES cells could be used for repair and replacement of cells or tissues lost due to disease or trauma. A universal bank of well-characterized hES cells from which specific cells can be generated would potentially be invaluable for basic research and cell replacement therapy.

To date, 78 different lines from the National Institutes of Health (NIH) registry have been identified and tentatively classified as ES cells based on general morphological similarity. Early experiments suggest that the properties of hES cells differ in some respects from mouse ES cells [4]. Eleven of these lines are currently available for research purposes, and limited data on the biology of 26 of these lines are available [5]. Two of these lines, BG01 and BG02, were generated from embryos whose poor development was such that in the course of usual IVF practice they would have been discarded because 6–7 days post fertilization, fully 1–2 days after the usual time of embryo transfer, they had not developed sufficiently to survive cryopreservation. A report of their basic biology is available [6]; however, there are no published data on molecular characterization of these cell lines.

Considerable additional information is, however, available on other hES cell lines, notably those derived by Thomson and colleagues [4]. Teratocarcinoma formation, long-term stability, derivation of feeder-free subclones, microarray analysis, genome scan, and serial analysis of gene expression analysis have been completed or initiated for several lines [711]. Genetic modification, including homologous recombination, has been reported [12, 13]. Differentiation into multiple phenotypes, including cardiac, hepatic, pancreatic, neural, and hematopoietic lineages, has been described [1421]. Whether BG01 and BG02 lines have similar properties remains to be determined.

It is unlikely that all hES cell lines will be identical or equally stable in culture. Some differences in human cell lines have been described [5], although whether they reflect differences in the methods of propagation or illustrate underlying differences in biology remains to be determined. We also note that when rodent ES lines have been examined, strain differences in isolation and propagation of lines have been described [22, 23]. Indeed, uniformly successful isolation is not possible in all mouse strains, and it has been difficult to generate rat ES cell lines [24].

In an effort to understand the properties of the BG lines, we have propagated BG01 and BG02 in culture and examined their growth; differentiation characteristics; and gene expression patterns using immunostaining, reverse transcriptase polymerase chain reaction (RT-PCR), and microarray analysis. We show that BG01 and BG02 have the capacity to differentiate into cells that express divergent tissue-specific antigens consistent with pluripotency and express markers similar to other pluripotent hES cells. No significant differences were observed in gene expression profiles between these two lines.

Materials and Methods

Isolation and Growth of ES Cells

hES cell lines BG01 and BG02 were obtained from BresaGen (Athens, GA) and cultured according to manufacturer instructions. ES cells were maintained on mitomycin-C-inactivated mouse embryonic fibroblast (MEF, from strain SVB, 1 × 106 cells/35 mm dish) feeder cells in Dulbecco's-modified Eagle's medium/Ham's F12 (1:1) supplemented with 15% fetal bovine serum (FBS), 5% knockout serum replacement (KSR), 2 mM nonessential amino acids, 2 mM L-glutamine, 50 μg/ml Penn-Strep (all from Invitrogen; Carlsbad, CA; http://www.invitrogen.com), 0.1 mM β-mercaptoethanol (Specialty Media; Phillipsburg, NJ; http://www.specialtymedia.com), and 4 ng/ml of basic fibroblast growth factor (bFGF; Sigma; St. Louis, MO; http://www.sigmaaldrich.com). Cells were passaged by incubation in cell dissociation buffer or trypsin (Invitrogen), dissociated, and then seeded at about 20,000 cells/cm2. Under such culture conditions, the ES cells were passaged every 4–5 days. For freezing, cells were resuspended in medium containing 25% FBS, 65% hES medium, and 10% dimethylsulfoxide at 1 × 106 cells/ml at approximately 1°C per minute.

Differentiation In Vitro

ES cell cultures were dissociated into small clumps by collagenase IV (Sigma) by incubating at 37°C for 5 minutes. The hES cell colonies were pelleted, resuspended in hES medium without bFGF (differentiation medium), and cultured in 6-well plates for 7 days with a medium change every second day. ES cell colonies grew in suspension as embryoid bodies (EBs), while remaining feeder cells adhered to the plate. The EBs were transferred into a new plate and were further cultured for 7 days before immunostaining.

Immunocytochemistry

Expression of stem cell markers was examined by immunocytochemistry, and staining procedures were as described previously [25]. Briefly, the ES cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100. After blocking, the cells were incubated with primary antibody. The primary antibodies and the dilutions used are stage-specific embryonic antigen (SSEA)-1, SSEA-3, and SSEA-4 (Developmental Studies Hybridoma Bank, University of Iowa; http://www.uiowa.edu; 1:50); tumor recognition antigen (TRA)-1-60 and TRA-1-81 (Chemicon; Temecula, CA; http://www.chemicon.com; 1:100); octamer-binding transcription factor (OCT)-3/4 and cTnI (Santa Cruz Biotechnology; Santa Cruz, CA; http://www.scbt.com, 1:100); TuJ1 and α-fetoprotein (Sigma; 1:2000); smooth muscle actin (Sigma; 1:200); and nestin (BD Biosciences; San Jose, CA, http://www.bdbiosciences.com; 1:500). Localization of antigens was visualized by using appropriate secondary antibodies (Alexa fluor 594 or 488, Molecular Probes; Eugene, OR; http://www.probes.com).

RT-PCR Analysis

Total RNA was isolated with TRIzol (Invitrogen), a modification of the guanidine isothiocyanate-phenol-chloroform extraction method. The undifferentiated state of cultured cells was verified by immunostaining of ES markers such as OCT-3/4, SSEA-4, and TRA-1-60. cDNA was synthesized using 2.5 μg total RNA in a 20-μl reaction with Superscript II (Invitrogen) and oligo (dT)12–18 (Promega; Madison, WI; http://www.promega.com). One microliter RNase H (Invitrogen) was added to each tube and incubated for 20 minutes at 37°C before proceeding to the RT-PCR analysis. The PCR primers for OCT-3/4, SOX-2, REX-1, UTF1, hTERT, Dppa5, Cx43, Cx45, and ABCG2 were described by Ginis et al. [26]; the primers for Nanog, FLJ13072, KIAA1265, MGC27165, ZNF342, DNMT3L, DAX-1, Eras, TUBB5, KRT8, KRT18, cardiac actin, and galanin are listed in Table 1.

Table Table 1.. PCR primer pairs used in this study
GeneSizePrimerSequence (5′ to 3′)
ABCG2684 bphABCG2-FGTTTATCCGTGGTGTGTCTGG
  hABCG2-RCTGAGCTATAGAGGCCTGGG
Cardiac actin164 bphCRD-FGCCCTGGATTTTGAGAATGA
  hCRD-RATGCCAGCAGATTCCATACC
Connexin 43295 bphCx43-FTACCATGCGACCAGTGGTGCGCT
  hCx43-RGAATTCTGGTTATCATCGGGGAA
Connexin 45819 bphCx45-FCTATGCAATGCGCTGGAAACAACA
  hCx45-RCCCTGATTTGCTACTGGCAGT
DNA methyltransferase189 bphDNMT3L-FCTCTCAAGCTCCGTTTCACC
3-like (DNMT3L) hDNMT3L-RGTACAGGAAGAGGGCATCCA
Dppa 5353 bphDppa5-FATGGGAACTCTCCCGGCACG
  hDppa5-RTCACTTCATCCAAGGGCCTA
E-Ras152 bphERas-FGCTGTCTGTGATGGTGTGCT
  hERas-RTCTCCAGCAGTGGTCACAAG
Hypothetical protein FLJ13072179 bphFLJ-FTCTTCCGCAGACCAGTACCT
  hFLJ-RTCTCGGCAGAAGTCAATGTG
pro-Galanin156 bphGal-FAAGGAAAAACGAGGCTGGAC
  hGal-RGGACCTGTCAAAGCTTCCTG
Glyceraldehyde-3-phosphate474 bphGAPD-FGCTCAGACACCATGGGGAAGGT
dehydrogenase hGAPD-RGTGGTGCAGGAGGCATTGCTGA
Hypothetical protein KIAA1265194 bphKIAA-FCCTTTGCCCTGCATTGTTAT
  hKIAA-RAGATCACGCCTAGCAAGGAA
Keratin 8161 bphKRT8-FTGAGGTCAAGGCACAGTACG
  hKRT8-RTGATGTTCCGGTTCATCTCA
Keratin 18164 bphKRT18-FCACAGTCTGCTGAGGTTGGA
  hKRT18-RGAGCTGCTCCATCTGTAGGG
Hypothetical protein MGC27165216 bphMGC-FTTGGTCCCTGGCTAATTCAC
  hMGC-RTTGTGCATCTTCTGGCTTTG
Nanog158 bphNanog-FCAAAGGCAAACAACCCACTT
(Hypothetical protein FLJ12581) hNanog-RTCTGCTGGAGGCTGAGGTAT
NR0B1154 bphDax1-FGACTCCAGTGGGGAACTCAG
(Dax-1 protein) hDax1-RATGATGGGCCTGAAGAACAG
Oct-3/4171 bphOct3/4-FCTTGCTGCAGAAGTGGGTGGAGGAA
  hOct3/4-RCTGCAGTGTGGGTTTCGGGCA
Rex-1559 bphRex1-FTGAAAGCCCACATCCTAACG
  hRex1-RCAAGCTATCCTCCTGCTTTGG
Sox-2437 bphSox2-FATGCACCGCTACGACGTGA
  hSox2-RCTTTTGCACCCCTCCCATTT
hTERT147 bpLT5CGGAAGAGTGTCTGGAGCAA
  LT6GGATGAAGCGGAGTCTGGA
β-tubulin 5161 bphTUBB5-FCAGTGACCTGCAACTGGAGA
  hTUBB5-RGATTGGCCAAACACGAAGTT
UTF-1230 bphUTF1-FACCAGCTGCTGACCTTGAAC
  hUTF1-RTTGAACGTACCCAAGAACGA
Zinc finger protein 342193 bphZNF342-FGAAGGCATCACCCAAAAAGA
  hZNF342-RGCGGTTGAGCTTACTGCTCT

For each PCR reaction, 0.5 ml of 1:10 diluted cDNA template was used in a 50-ml reaction volume with the Taq DNA polymerase (Invitrogen). The cycling parameters were 94°C, 1 minute; 58°C, 1 minute; and 72°C, 1 minute, for 30 cycles. The PCR cycle was preceded by an initial denaturation of 3 minutes at 94°C and followed by a final extension of 10 minutes at 72°C.

Large-Scale Oligonucleotide Microarray

The microarray used in this analysis contained 16,659 70-bp oligonucleotides designed from 750 bases of the 3′ end of each open reading frame that represents the largest verified set available. Twenty micrograms of total RNA from each of BG01 and BG02 and universal human RNA (huRNA, Clontech; Palo Alto, CA; http://www.clontech.com) were labeled with Cy5 and Cy3, respectively, and duplicate arrays were hybridized and processed using the modified procedure developed at the Center for Biologics Evaluation and Research (CBER) microarray program under an interagency agreement between CBER and the Advanced Technology Center of the National Cancer Institute. The images were captured under wavelengths appropriate for both Cy3 and Cy5 photomultiplier tubes (PMTs; 600V-750V) using a GenePix 4000B scanner (Axon Instruments, Inc.; Union City, CA; http://www.axon.com). At this PMT range, the images gave the best signal-to-noise ratio. The data were initially analyzed using Gene Pix software. Both the scanned image and analyzed data files were uploaded into the Center for Information microarray database (mAdb) (http://www.nciarray.nci.nih.gov). The data were analyzed using two different analytic tools: single array viewer tools and extended data extraction tool. Scatter plot analysis of a control array with Cy5- and Cy3-labeled total RNA derived from huRNA showed equal hybridization of spots as indicated by a straight line from X to Y axis, indicating good quality of most spots and uniform hybridization (not shown).

Focused Microarray Analysis

The nonradioactive GEArray Q series cDNA expression array filters for human stem cell genes and transforming growth factor (TGF) β/BMPl pathway genes (Hs601 and Hs023; SuperArray Inc.; Frederick, MD; http://www.superarray.com) [26] were used according to the manufacturer's protocol. The biotin dUTP-labeled cDNA probes were specifically generated in the presence of a designed set of gene-specific primers using total RNA (4 mg/filter) and 200 U Moloney murine leukemia virus reverse transcriptase (Promega). The array filters were hybridized with biotin-labeled probes at 60°C for 17 hours. After that, the filters were washed twice with 2 × SSC/1% SDS and then twice with 0.1 × SSC/1% SDS at 60°C for 15 minutes each. Chemiluminescent detection steps were performed by incubation of the filters with alkaline phosphatase-conjugated streptavidin and CDP-Star substrate. Array membranes were exposed to x-ray film. Quantification of gene expression on the array was performed with ScionImage software. cDNA microarray experiments were done twice with new filters and RNA isolated at different times. Results from the focused array were independently confirmed, and the array itself was validated using procedures previously described [27].

Results

Growth and Morphology

BG01 and BG02 were cultured on MEF feeders and grew as colonies of tightly compacted undifferentiated cells resembling mouse and hES cells (Fig. 1). Like murine ES cells, BG01 and BG02 colonies had a high nuclear/cytoplasmic ratio. These cells were propagated in vitro for more than 40 passages and maintained a normal karyotype [6]. Successful passage of cells was achieved by using either trypsin or nonenzymatic cell dispersal buffers, and we found that both worked equally well. In general, the cultures became confluent 4–5 days after seeding and the cells had a doubling time of 30–35 hours, similar to that reported for other hES cells grown on feeders or feeder-free conditioned medium. In addition, these cells recovered quickly from frozen vials within 2–3 days, and an undifferentiated state was easily and reliably maintained with no instances of spontaneous differentiation. Spontaneous differentiation was, however, observed when BG01 or BG02 cells were seeded on MEFs at lower density (e.g., 1 × 105 cells/35 mm dish).

Figure Figure 1..

Morphology of undifferentiated BG01 and BG02 cells.Phase contrast microscopy of undifferentiated BG01 and BG02 cells grown on an MEF feeder layer. The scale bar is 20 μm.

Cell Surface and ES Cell Marker Expression

Immunocytochemistry was used to analyze whether BG01 and BG02 were similar to other hES cell lines in expressing cell surface markers that characterize undifferentiated pluripotent stem cells. These include SSEA-3 and SSEA-4; tumor recognition antigen, TRA-1-60 and TRA-1-81; and the POU transcription factor, OCT-3/4.

Undifferentiated BG01 and BG02 cells were strongly positive for TRA-1-60, TRA-1-81, SSEA-4, and OCT-3/4, but negative for SSEA-1. Almost all of the colonies were positive for TRA-1-60, TRA-1-81, SSEA-3, SSEA-4, and OCT-3/4, and the majority of cells in the colonies were stained for these markers (Fig. 2). Almost no positive staining was observed outside the ES colonies or in the feeder cells for TRA-1-60, TRA-1-81, SSEA-4, and OCT-3/4, but some positive cells were found outside the colonies for SSEA-3 (Fig. 2). Staining intensity for SSEA-4, TRA-1-60, TRA-1-81, and OCT-3/4 was consistently strong both within individual colonies and among the colonies, but staining intensity was weaker for SSEA-3.

Figure Figure 2..

Morphology of undifferentiated BG01 and BG02 cells and expression of markers by immunocytochemistry.Both BG01 and BG02 are strongly positive for SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, and OCT-3/4. Antibody staining is in red (SSEA-3 and SSEA-4) or green (TRA-1-60, TRA-1-81, and OCT-3/4), while nuclear DAPI staining is in blue. The scale bar is 20 μm for SSEA-4 and OCT-3/4 and 10 μm for the others.

RT-PCR was used to confirm some of the markers analyzed by immunochemistry and to examine additional markers that are associated with stem cells. Primers that span intron-exon boundaries for the TERT gene were used to assess possible genomic contamination. As expected, messages for telomerase reverse transcriptase TERT, homeobox-domain transcription factor SOX-2, zinc finger protein REX-1, and a gene similar to developmental pluripotency-associated 5 (Dppa 5) were detected in undifferentiated BG01 and BG02 cells (Fig. 3). Transcriptional coactivator UTF1 was also expressed in BG01 and BG02. Transcripts for some cell surface markers reported for blastocysts or stem cells, such as the gap junction proteins connexin-43 and connexins-45 (Cx-43 and Cx-45), and ABC transporter ABCG were also detected in undifferentiated BG01 and BG02 cells (Fig. 3). Table 2 summarizes the markers expressed by BG01 and BG02 using either immunocytochemistry, RT-PCR, or both.

Table Table 2.. Expression of markers is associated with stem cells in undifferentiated BG01 and BG02 cells
 BG01BG01BG02BG02
MarkerRT-PCRStainingRT-PCRStaining
SSEA-1  
SSEA-3 + +
SSEA-4 + +
TRA-1-60 + +
TRA-1-81 + +
TERT+ + 
OCT-4++++
SOX-2+ + 
REX-1+ + 
UTF1+ + 
Dppa5+ + 
Cx43+ + 
Cx45+ + 
ABCG2+ + 
Figure Figure 3..

Expression of markers associated with ES cells in BG01 and BG02 by RT-PCR.Genes known to be associated with the pluripotent state (hTERT, OCT-3/4, SOX-2, and REX-1) are expressed in both BG01 and BG02; five additional genes, Dppa5, UTF1, ABCG2, Cx43, and Cx45 are also expressed by BG01 and BG02. PCR was performed using gene-specific primers (Table1) with glyceraldehyde-3-phosphate dehydrogenase as a control. Markers are a 100-bp ladder with the lowest band being 100 bp.

Ability to Differentiate into Cell Types from All Three Germ Layers

The capacity of BG01 and BG02 to differentiate in vitro was evaluated. Differentiation of hES cells was initiated by culturing in the absence of an MEF feeder layer and bFGF. Under these conditions, hES cells formed embryoid bodies (EBs) of heterogeneous cells. TuJ1-positive neurons, cardiac troponin I-positive cardiomyocytes, and α-fetoprotein-positive cells (Fig. 4) were identified in EBs by immunocytochemistry. In addition, cells positive for nestin and smooth muscle actin were identified (Fig. 4). This result indicated that BG01 and BG02 were able to differentiate in vitro into ectodermal, mesodermal, and endodermal derivatives.

Figure Figure 4..

In vitro differentiation of BG01 and BG02 via embryoid bodies.Differentiation of hES cells was initiated by forming EBs in the absence of MEFs and bFGF. Positive immunostaining was identified for AFP, cTnI, SMA, nestin, and TuJ1, indicating that both lines can differentiate to express markers of ectoderm, mesoderm, and endoderm. The scale bar is 20 μm.

Microarray Analysis of Gene Expression in Undifferentiated Cells

The large-scale oligonucleotide microarray was employed to examine the overall gene expression profile of undifferentiated BG01 and BG02 cells. The probes used for this array included 1,987 hypothetical proteins and 72 expressed sequence tags (ESTs) and span approximately 50% of the human genome. RNA from undifferentiated BG01 and BG02 cells was compared with pooled huRNA that hybridizes with most genes on the array. The array results are shown in Figure 5. Figure 5A and B show the image profiles of BG01 and BG02, Figure 5C and D show scatter plot analyses of BG01 and BG02, and Figure 5E shows a comparison of highly expressed genes (threefold or higher level) among BG01, BG02, and other ES cell lines.

Figure Figure 5..

Expression profiling of BG01 and BG02 hES cell lines.A and B): Representative images after competitive hybridization of oligonucleotide arrays using cy5-labeled RNA from BG01 (A) and BG02 (B) hES cell lines and cy3-labeled huRNA. Total RNA (5 μg) isolated from hES cell lines and huRNA was labeled with cy5 and cy3 dyes, respectively, and used to hybridize oligonucleotide arrays containing ∼17,000 features. The images were collected using a GenePix scanner. C and D): Scatter plot analysis of cy5-labeled genes in BG01 (C) and BG02 (D) and cy3-labeled genes in hURNA to show differential gene expression. E). Venn diagram showing similarity of highly expressed genes (threefold and higher) in BG01 and BG02 cell lines at 99% confidence interval. A total of 1,006 genes were highly expressed in BG01, 406 were highly expressed in BG02, and 373 of these were common to both cell lines. Of the 373 transcripts common to BG01 and BG02, 92 were also found to be highly expressed in other hES cell lines and 281 were found only in BG01 and BG02.

A total of 373 genes common to both BG01 and BG02 were identified as being differentially expressed, defined as a threefold or greater increase as compared with huRNA (Table 3). Among them, 92 genes, including several stemness genes known to be expressed in mES or hES cells such as OCT-3/4, NANOG, Cripto/TDGF1, Cx43, and galanin, are also differentially expressed in an additional four hES lines (TE06, GE01, GE09, and a pooled set of subclones derived from GE01, GE09, and GE07). Expression of several of these 92 genes in BG01 and BG02 was confirmed by RT-PCR (Fig. 6). Nanog (a recently identified hypothetical protein FLJ12581 critical for maintaining pluripotency of mES cells) and three other hypothetical proteins, FLJ13072, KIAA1265, and MGC27165, were all expressed in both BG01 and BG02 (Fig. 6A). ZNF342, DNMT3L, DAX-1, and Eras transcripts were detected by RT-PCR (Fig. 6B).

Table Table 3.. Highly expressed genes in BG01 and BG02 cells (> threefold)
GeneDescriptionUniGeneBG02BG01
GALgalaninHs.27895932.729730.6676
LIN-28RNA-binding protein LIN-28Hs.8615427.738120.2924
POU5F1POU domain, class 5, transcription factor 1Hs.286027.621515.1775
SEMA6Asema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6AHs.26339525.122613.9032
FLJ12505hypothetical protein FLJ12505Hs.12574123.517516.8017
NPM1nucleophosmin (nucleolar phosphoprotein B23, numatrin)Hs.35571923.335114.0028
KRT18keratin 18Hs.40601322.983712.7228
SNRPFsmall nuclear ribonucleoprotein polypeptide FHs.10546522.79245.2743
ACTCactin, alpha, cardiac muscleHs.11812722.208626.4846
SSBSjogren syndrome antigen B (autoantigen La)Hs.8371519.66829.5376
DLG7discs, large homolog 7 (Drosophila)Hs.7769519.20457.7198
SLC16A1solute carrier family 16 (monocarboxylic acid transporters), member 1Hs.7523119.203410.0484
ELOVL6

ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2,

SUR4/Elo3-like, yeast)

Hs.21155619.00979.6355
CRABP2cellular retinoic acid binding protein 2Hs.18365018.585418.7416
 Human HL14 gene encoding beta-galactoside-binding lectin, 3′ end, clone 2 18.175419.5927
EIF4A1eukaryotic translation initiation factor 4A, isoform 1Hs.35612918.13368.3636
LEFTBleft-right determination, factor BHs.27823918.01468.4236
CST4cystatin SHs.5631917.98194.0157
FABP5fatty acid binding protein 5 (psoriasis-associated)Hs.40806117.88589.4236
CYP26A1cytochrome P450, family 26, subfamily A, polypeptide 1Hs.15059517.84545.4796
 Human DNA sequence from clone RP11-248N6 on chromosome 13. 17.37412.933
LECT1leukocyte cell derived chemotaxin 1Hs.9793217.36087.3421
Nup37nucleoporin Nup37Hs.515217.13156.0084
DKFZP586L072DKFZP586L0724 proteinHs.2676117.05677.5128
RPL6ribosomal protein L6Hs.40904516.83286.7963
KRT8keratin 8Hs.24246316.516410.2776
GPC4glypican 4Hs.5836715.59437.2993
LDHBlactate dehydrogenase BHs.23448915.26575.63
RPS24ribosomal protein S24Hs.18045014.7565.6245
DKC1dyskeratosis congenita 1, dyskerinHs.474714.52614.5643
PODXLpodocalyxin-likeHs.1642614.385311.2914
SMSspermine synthaseHs.8971814.35446.0537
 Human DNA sequence from clone RP11-392A19 on chromosome 13. 14.19756.539
SPSselenophosphate synthetaseHs.12402713.95269.9908
NME1non-metastatic cells 1, protein (NM23A)Hs.11863813.68616.6279
DDX21DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21Hs.16953113.5365.9288
PDHBpyruvate dehydrogenase (lipoamide) betaHs.97913.52644.9302
HSPCAheat shock 90kDa protein 1, alphaHs.35653113.42547.5954
HUMAUANTIGnucleolar GTPaseHs.7552813.32354.9662
GDF3growth differentiation factor 3Hs.8623212.67558.1771
 Human DNA sequence from clone RP11-438F9 on chromosome 13. 12.6176.9879
NUP107nuclear pore complex proteinHs.23620412.5885.1862
HNRPABheterogeneous nuclear ribonucleoprotein A/BHs.8136112.39177.5878
SSBP1single-stranded DNA binding proteinHs.92312.33315.6571
CCT2chaperonin containing TCP1, subunit 2 (beta)Hs.43297012.26484.877
 

Human DNA sequence from clone 167F1 on chromosome 6p22.1–22.3.

Contains a KRT18 (Keratin, type 1 Cyt)

 12.24974.5162
HMGIYhigh-mobility group (nonhistone chromosomal) protein isoforms I and Y 12.146513.1788
CCT8chaperonin containing TCP1, subunit 8 (theta)Hs.1507112.13466.7962
RBBP6retinoblastoma binding protein 6Hs.9106511.49265.2396
KIF4Akinesin family member 4AHs.27976611.21566.5153
PIR51RAD51-interacting proteinHs.2459611.00083.3822
TRA1tumor rejection antigen (gp96) 1Hs.8268910.9894.4254
C1GALT1core 1 UDP-galactose:N-acetylgalactosamine-alpha-R beta 1,3-galactosyltransferaseHs.4674410.90544.3861
KPNA2karyopherin alpha 2 (RAG cohort 1, importin alpha 1)Hs.15955710.87857.32
LDHAlactate dehydrogenase AHs.279510.69968.6252
UGP2UDP-glucose pyrophosphorylase 2Hs.7783710.69416.2481
PGK1phosphoglycerate kinase 1Hs.7877110.68045.4813
CCT4chaperonin containing TCP1, subunit 4 (delta)Hs.7915010.67415.645
NME2non-metastatic cells 2, protein (NM23B)Hs.43341610.62927.9767
DKFZP564O046DKFZP564O0463 proteinHs.27334410.41183.9574
ABCE1ATP-binding cassette, sub-family E (OABP), member 1Hs.1201310.35816.1063
HSPD1heat shock 60kDa protein 1 (chaperonin)Hs.7903710.34135.49
HSPCBheat shock 90kDa protein 1, betaHs.7433510.29045.7852
TBCAtubulin-specificHs.43325410.25763.9957
KPNB1karyopherin (importin) beta 1Hs.18044610.25165.2268
SAS10disrupter of silencing 10Hs.32290110.21583.0576
SNRPA1small nuclear ribonucleoprotein polypeptide A′Hs.8050610.11385.3005
 Human DNA sequence from clone RP3-447F3 on chromosome 20. 10.08737.0067
SLC38A1solute carrier family 38, member 1Hs.182729.99385.2499
PSMA2proteasome (prosome, macropain) subunit, alpha type, 2Hs.4117739.95586.847
NASPnuclear autoantigenic sperm protein (histone-binding)Hs.3804009.78357.2138
NUDT5nudix (nucleoside diphosphate linked moiety X)-type motif 5Hs.3019579.70826.7425
CCNB1cyclin B1Hs.239609.69419.3155
PPATphosphoribosyl pyrophosphate amidotransferaseHs.3119.61173.728
GJA1gap junction protein, alpha 1, 43kDa (connexin 43)Hs.744719.519115.2909
PRO2013hypothetical protein PRO2013Hs.2382059.49744.537
XRCC5

X-ray repair complementing defective repair in Chinese hamster cells 5

(double-strand-break rejoining; Ku autoantigen, 80kDa)

Hs.849819.41094.0437
TD-60RCC1-likeHs.2841469.31615.5608
CDC2cell division cycle 2, G1 to S and G2 to MHs.3345629.24096.5016
NSnucleosteminHs.2799239.2015.3758
PWP1nuclear phosphoprotein similar to S. cerevisiae PWP1Hs.1725899.14893.7634
FLJ21908hypothetical protein FLJ21908Hs.267509.11633.8205
RPL23Aribosomal protein L23aHs.4066169.07184.3649
CCNCcyclin CHs.1184429.05914.5857
HCA66hepatocellular carcinoma-associated antigen 66Hs.306709.04323.8016
LMNB1lamin B1Hs.894978.99283.0784
MRPL1mitochondrial ribosomal protein L1Hs.2836938.96695.0821
KIAA1573KIAA1573 proteinHs.247908.93365.9659
SFRS1splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)Hs.737378.82514.3408
 Homo sapiens hypothetical gene supported by XM_010918 (LOC65365), mRNA 8.79164.2526
RAI14retinoic acid induced 14Hs.151658.75844.0056
HSPA8heat shock 70kDa protein 8Hs.1804148.75445.3559
ID3inhibitor of DNA binding 3, dominant negative helix-loop-helix proteinHs.768848.6623.0338
PAK1IP1PAK1 interacting protein 1Hs.522568.64266.2093
HNRPA1heterogeneous nuclear ribonucleoprotein A1 8.59584.1419
PRDX4peroxiredoxin 4Hs.833838.57214.1822
RPL38ribosomal protein L38Hs.4256688.54043.8961
NBR2neighbor of BRCA1 gene 2Hs.3211708.50977.8422
IMP-2IGF-II mRNA-binding protein 2Hs.302998.36436.3037
PUNCputative neuronal cell adhesion moleculeHs.1898478.35884.7637
LAMR1laminin receptor 1 (67kD, ribosomal protein SA) 8.3485.3035
USP28ubiquitin specific protease 28Hs.1428568.31874.1314
PRDX1peroxiredoxin 1Hs.1809098.28663.8715
PIGPC1p53-induced protein PIGPC1Hs.3031258.22624.7181
SFRP2secreted frizzled-related protein 2Hs.313868.1866.1167
 Homo sapiens alpha-NAC gene for nascent polypeptide-associated complex component 8.16163.4958
PSIP1PC4 and SFRS1 interacting protein 1Hs.821108.13695.8686
MCM2MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)Hs.571018.13326.9535
ERHenhancer of rudimentary homolog (Drosophila)Hs.4334138.04483.5812
FLJ10377hypothetical protein FLJ10377Hs.2742638.02923.585
C15orf15chromosome 15 open reading frame 15Hs.2841628.00094.2542
RPL36ALribosomal protein L36a-likeHs.4194657.97653.1525
PHC1polyhomeotic-like 1 (Drosophila)Hs.3059857.94513.1202
 Homo sapiens similar to laminin receptor 1 (67kD, ribosomal protein SA) 7.94315.8083
 Human DNA sequence from clone RP3-334F4 on chromosome 6 7.93295.8647
LRRN1leucine rich repeat neuronal 1Hs.1260857.88556.1145
GRP58glucose regulated protein, 58kDaHs.137517.87883.634
DSPdesmoplakinHs.3494997.87224.792
CDC20CDC20 cell division cycle 20 homolog (S. cerevisiae)Hs.829067.84237.0917
HSPA4heat shock 70kDa protein 4Hs.900937.82135.0903
PSMD11proteasome (prosome, macropain) 26S subunit, non-ATPase, 11Hs.907447.80843.1033
 

Human DNA sequence from clone 522P13 on chromosome 6p21.31–22.3.

Contains a 60S Ribosomal Protein L2.

 7.73914.3755
KRT19keratin 19Hs.1822657.73324.3622
TRIP13thyroid hormone receptor interactor 13Hs.65667.70753.2397
C20orf1chromosome 20 open reading frame 1Hs.93297.65124.8848
F2RL1coagulation factor II (thrombin) receptor-like 1Hs.1542997.62434.5514
 

Homo sapiens similar to 60S RIBOSOMAL PROTEIN L23A (H. sapiens)

(LOC65880), mRNA

 7.61893.9503
NOLA3nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs)Hs.143177.56244.1481
 

Human DNA sequence from clone RP11-352D3 on chromosome 20. Contains a 60S

ribosomal protein L21 (RPL2).

 7.5393.7055
Jade-1PHD protein Jade-1Hs.2382467.51644.3428
MRPL27mitochondrial ribosomal protein L27Hs.77367.5053.6855
SEC61GSec61 gammaHs.99507.44844.0145
SNRPD3small nuclear ribonucleoprotein D3 polypeptide 18kDaHs.15757.44323.6238
PCNPPEST-containing nuclear proteinHs.716187.42493.2268
PRO1855hypothetical protein PRO1855Hs.2835587.41454.523
PHIPpleckstrin homology domain interacting proteinHs.101777.40534.5647
HMG1L10high-mobility group (nonhistone chromosomal) protein 1-like 10 7.40484.2296
LASP1LIM and SH3 protein 1Hs.3348517.36984.3823
GART

phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase,

phosphoribosylaminoimidazole synthetase

Hs.822857.35713.0676
ENO1enolase 1, (alpha)Hs.2541057.34145.1802
ADAM19a disintegrin and metalloproteinase domain 19 (meltrin beta)Hs.2786797.30834.2188
GA17dendritic cell protein 7.28774.1859
MCM7MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)Hs.771527.27925.6728
VDAC2voltage-dependent anion channel 2Hs.789027.24334.6981
KIAA0179KIAA0179 proteinHs.1526297.214.1183
RPLP0ribosomal protein, large, P0 7.16635.8115
MGST1microsomal glutathione S-transferase 1Hs.3897007.1584.587
TAF15TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDaHs.3810447.09723.2039
API5apoptosis inhibitor 5Hs.2279137.05714.3763
RPL19ribosomal protein L19Hs.4269777.05434.395
CCNA2cyclin A2Hs.851377.03513.3263
 Homo sapiens c33.42 unnamed HERV-H protein mRNA, partial cds 7.021820.4077
PSMB6proteasome (prosome, macropain) subunit, beta type, 6Hs.770607.01263.9363
RPA1replication protein A1, 70kDaHs.843187.00754.8865
TK1thymidine kinase 1, solubleHs.1050976.99656.953
NPM3nucleophosmin/nucleoplasmin, 3Hs.906916.98064.0789
 

Human DNA sequence from clone RP1-269M15 on chromosome 20q12–13.12.

Contains a gene similar to peptid.

 6.97895.0146
FLJ12484hypothetical protein FLJ12484Hs.377476.9764.7357
HAND1heart and neural crest derivatives expressed 1Hs.1525316.95673.178
IF2translation initiation factor IF2Hs.1586886.94573.8838
TEBPunactive progesterone receptor, 23 kDHs.2782706.94193.1811
KIAA0020minor histocompatibility antigen HA-8Hs.24716.93093.7341
 Homo sapiens similar to ribosomal protein L23a (H. sapiens) (LOC65638), mRNA 6.92194.203
TNNT1troponin T1, skeletal, slowHs.739806.87955.5485
PITX2paired-like homeodomain transcription factor 2Hs.922826.80323.0306
RPS23ribosomal protein S23Hs.34636.7824.0483
 Homo sapiens putative human HLA class II associated protein I (PHAP1), mRNA 6.75273.7135
IFITM1interferon induced transmembrane protein 1 (9–27)Hs.4582866.72127.3063
DKFZp762L031hypothetical protein DKFZp762L0311Hs.3516236.63413.6789
PFN1profilin 1Hs.4089436.61893.9552
PA2G4proliferation-associated 2G4, 38kDaHs.3432586.61063.6266
HNRPLheterogeneous nuclear ribonucleoprotein LHs.27306.60883.2105
ACTA1actin, alpha 1, skeletal muscleHs.12886.58976.8379
METAP1methionyl aminopeptidase 1Hs.820076.56384.303
PLOD2procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2Hs.412706.53323.9661
 

Homo sapiens similar to 60S RIBOSOMAL PROTEIN L23A (H. sapiens)

(LOC65417), mRNA

 6.50144.0788
SDCCAG8serologically defined colon cancer antigen 8Hs.3006426.48823.5579
FLJ11046hypothetical protein FLJ11046Hs.169866.48053.0127
CKAP2cytoskeleton associated protein 2Hs.246416.47194.2204
MTHFD2

methylene tetrahydrofolate dehydrogenase (NAD+ dependent),

methenyltetrahydrofolate cyclohydrolase

Hs.1546726.45664.8834
PIF1DNA helicase homolog PIF1Hs.1121606.44466.6647
MRPS7mitochondrial ribosomal protein S7Hs.717876.41133.5154
LYPLA1lysophospholipase IHs.3933606.38844.1219
GARSglycyl-tRNA synthetaseHs.2938856.38793.9937
C7orf14chromosome 7 open reading frame 14Hs.847906.37414.1663
PRO1068Hypothetical protein PRO1068 6.34293.31
MPB1MYC promoter-binding protein 1 6.33546.4887
RPL4ribosomal protein L4Hs.2866.32396.2255
Nanoghomeobox transcription factor NanogHs.3262906.31735.1194
MAK3Plikely ortholog of mouse Mak3p homolog (S. cerevisiae)Hs.2889326.31493.1316
RPS3Aribosomal protein S3AHs.770396.31083.1347
CBX3chromobox homolog 3 (HP1 gamma homolog, Drosophila)Hs.4063846.273.8758
 Human endogenous retrovirus pHE.1 (ERV9) 6.26054.4253
C21orf45chromosome 21 open reading frame 45Hs.499326.23914.0354
CKS1BCDC28 protein kinase regulatory subunit 1BHs.3486696.20833.5537
SETSET translocation (myeloid leukemia-associated)Hs.1452796.19236.4237
FLJ10326hypothetical protein FLJ10326Hs.2628236.17253.0784
LOC84549RNA binding proteinHs.771356.16893.5191
KPNB3karyopherin (importin) beta 3Hs.1135036.16355.2102
ZNF117zinc finger protein 117 (HPF9)Hs.1330116.1234.5006
TEAD4TEA domain family member 4Hs.948656.11493.9091
HSPC117hypothetical protein HSPC117Hs.107296.0893.5708
RAD21RAD21 homolog (S. pombe)Hs.818486.08753.3005
CCT3chaperonin containing TCP1, subunit 3 (gamma)Hs.17086.08345.028
HSPC163HSPC163 proteinHs.1088546.07694.0512
RAMPRA-regulated nuclear matrix-associated proteinHs.1267746.06764.5875
RPL10Aribosomal protein L10a 6.06624.7655
FRSBphenylalanyl-tRNA synthetase beta-subunitHs.90816.04123.546
SSRP1structure specific recognition protein 1Hs.791626.01723.0172
H2AFXH2A histone family, member XHs.1470976.01155.4197
ENTHenthoprotinHs.1328536.00274.2103
 Human DNA sequence from clone RP13-178D16 on chromosome X. 5.99153.0462
HMGB2high-mobility group box 2Hs.806845.98614.3673
HMGN2high-mobility group nucleosomal binding domain 2Hs.1811635.95993.9082
 Human DNA sequence from clone RP11-16L21 on chromosome 9. 5.95883.3106
PTTG1pituitary tumor-transforming 1Hs.2525875.9585.3201
DRIL1dead ringer-like 1 (Drosophila)Hs.1985155.93944.9808
FLJ20641hypothetical protein FLJ20641Hs.1215535.92755.8264
FLJ21841hypothetical protein FLJ21841Hs.290765.91333.757
SNRPD2small nuclear ribonucleoprotein D2 polypeptide 16.5kDaHs.4243275.91123.7928
BRIXBRIXHs.381145.90774.2369
PBEFpre-B-cell colony-enhancing factorHs.2391385.86093.3468
SERPINH1

serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1,

(collagen binding protein 1)

Hs.99305.84935.7781
B3GNT7UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7Hs.2993295.83933.1599
PSMD14proteasome (prosome, macropain) 26S subunit, non-ATPase, 14Hs.1787615.82124.1797
ANP32Aacidic (leucine-rich) nuclear phosphoprotein 32 family, member AHs.4579885.79824.0879
GALNT1

UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1

(GalNAc-T1)

Hs.801205.78824.6825
 Human DNA sequence from clone RP1-34P24 on chromosome 22. 5.78473.1726
FUSIP1FUS interacting protein (serine-arginine rich) 1Hs.35305.75923.3965
PSMB5proteasome (prosome, macropain) subunit, beta type, 5 5.75734.5482
RPL24ribosomal protein L24Hs.1845825.74094.6246
IMPDH2IMP (inosine monophosphate) dehydrogenase 2Hs.754325.71855.5777
RPL31ribosomal protein L31Hs.1840145.68713.3864
 Human DNA sequence from clone RP11-102J14 on chromosome 20. 5.68313.3922
PSMA3proteasome (prosome, macropain) subunit, alpha type, 3Hs.3469185.67035.5412
EEF1B2eukaryotic translation elongation factor 1 beta 2Hs.4216085.66353.9278
 Human DNA sequence from clone 391O22 on chromosome 6p21.2–21.31. 5.65964.217
 Human DNA sequence from clone RP11-371L19 on chromosome 20. 5.62543.5281
RPL35Aribosomal protein L35aHs.2885445.61973.3447
HSPC111hypothetical protein HSPC111Hs.2799185.58073.3189
COPBcoatomer protein complex, subunit betaHs.30595.55713.3839
MGC5627hypothetical protein MGC5627Hs.2379715.5545.3964
PPP2CAprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoformHs.917735.54843.4562
RRM2ribonucleotide reductase M2 polypeptideHs.753195.53753.8071
 Sapiens thioredoxin delta 3 (TXN delta 3) mRNA, partial cdsHs.3953095.53263.1614
RPL9ribosomal protein L9Hs.4264605.53073.1146
CRABP1cellular retinoic acid binding protein 1Hs.3469505.48326.6444
CCNB2cyclin B2Hs.1946985.47424.1123
BAF53ABAF53Hs.2743505.45813.4022
MRPL32mitochondrial ribosomal protein L32Hs.502525.4554.2648
ITGB5integrin, beta 5Hs.1498465.44193.8255
 Homo sapiens thymosin beta-10 gene, 3′ end 5.43873.8365
EPRSglutamyl-prolyl-tRNA synthetaseHs.559215.4285.7694
HNOEL-isoHNOEL-iso proteinHs.93155.42664.0303
RRM1ribonucleotide reductase M1 polypeptideHs.29345.42385.5373
FLJ10006hypothetical protein FLJ10006Hs.55705.37523.5915
PGAM1phosphoglycerate mutase 1 (brain)Hs.4579385.35773.9171
PFASphosphoribosylformylglycinamidine synthase (FGAR aminotransferase)Hs.1054785.34983.4139
FEN1flap structure-specific endonuclease 1Hs.47565.34386.2717
NMUneuromedin UHs.4183675.29723.925
 Human DNA sequence from clone RP3-406P24 on chromosome 6. 5.28363.2444
C20orf129chromosome 20 open reading frame 129Hs.707045.27955.2988
ATP1B3ATPase, Na+/K+ transporting, beta 3 polypeptideHs.769415.25963.1735
HN1hematological and neurological expressed 1Hs.1097065.25584.6087
DTYMKdeoxythymidylate kinase (thymidylate kinase)Hs.790065.24323.8048
TDGF1teratocarcinoma-derived growth factor 1Hs.755615.22917.5328
CALUcalumeninHs.77535.22793.6995
HMBShydroxymethylbilane synthaseHs.826095.21535.5948
TMSB10thymosin, beta 10Hs.762935.18793.9498
FBLfibrillarinHs.998535.17984.6536
HDAC2histone deacetylase 2Hs.33525.16944.1544
RAB38RAB38, member RAS oncogene familyHs.1089235.13763.3122
K-ALPHA-1tubulin, alpha, ubiquitousHs.3348425.10323.4594
IDH1isocitrate dehydrogenase 1 (NADP+), solubleHs.112235.09565.1678
PPpyrophosphatase (inorganic)Hs.1840115.09073.0886
TUBB-5beta 5-tubulinHs.1796615.0755.281
 Human DNA sequence from clone RP4-753D5 on chromosome 6p12.1–12.3. 5.01873.1236
CCT-5chaperonin containing TCP1, subunit 5 (epsilon)Hs.16005.01797.4194
MCM5MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)Hs.771714.9994.8933
CDT1DNA replication factorHs.1229084.96763.1369
SLC39A1solute carrier family 39 (zinc transporter), member 1Hs.78544.96323.9787
SCYE1small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)Hs.3335134.94983.8042
PIM1pim-1 oncogeneHs.811704.90633.4099
PMSCL1polymyositis/scleroderma autoantigen 1, 75kDaHs.917284.90173.4002
ADSLadenylosuccinate lyaseHs.755274.89694.5402
CGI-94comparative gene identification transcript 94Hs.1114494.86383.0047
HSSG1Heat-shock suppressed protein 1 4.86324.3132
ZNF257zinc finger protein 257Hs.2839004.85023.6248
EEF1A1eukaryotic translation elongation factor 1 alpha 1Hs.4221184.84753.4583
FKBP3FK506 binding protein 3, 25kDaHs.3795574.83024.0163
SLC7A5solute carrier family 7 (cationic amino acid transporter, y+ system), member 5Hs.1846014.82775.7672
UHRF1ubiquitin-like, containing PHD and RING finger domains, 1Hs.1081064.8273.0648
PIK3CAphosphoinositide-3-kinase, catalytic, alpha polypeptideHs.857014.82133.0922
RPS19ribosomal protein S19Hs.2982624.8094.4312
PAI-RBP1PAI-1 mRNA-binding proteinHs.1659984.80593.8869
TACSTD1tumor-associated calcium signal transducer 1Hs.6924.77313.6411
 Human DNA sequence from clone RP5-843L14 on chromosome 20. 4.69333.1038
PCNT1pericentrin 1Hs.1843524.58643.2607
LOC51685prothymosin a14Hs.4577434.55843.8078
MTHFD1

methylenetetrahydrofolate dehydrogenase (NADP+ dependent),

methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase

Hs.1726654.54995.8678
 Human endogenous retrovirus mRNA for ORF 4.54584.4232
PSMB3proteasome (prosome, macropain) subunit, beta type, 3Hs.827934.53794.6985
MRPL12mitochondrial ribosomal protein L12Hs.1090594.53735.2112
MAD2L2MAD2 mitotic arrest deficient-like 2 (yeast)Hs.194004.50476.3397
FUSfusion, derived from t(12;16) malignant liposarcomaHs.999694.49533.1476
 Human DNA sequence from clone 551E13 on chromosome Xp11.2–11.3 4.47993.7248
RPS18ribosomal protein S18Hs.2758654.4364.8116
NIF3L1NIF3 NGG1 interacting factor 3-like 1 (S. pombe)Hs.219434.43513.293
MRPL17mitochondrial ribosomal protein L17Hs.100264.32393.6726
TRIP8thyroid hormone receptor interactor 8Hs.66854.30653.7629
FADS2fatty acid desaturase 2Hs.1846414.29053.2499
CTBP2C-terminal binding protein 2Hs.1713914.27073.1375
AGTRL1angiotensin II receptor-like 1Hs.93054.26383.7687
PDLIM1PDZ and LIM domain 1 (elfin)Hs.758074.25815.2093
UQCRHubiquinol-cytochrome c reductase hinge proteinHs.738184.24823.1334
UCHL1ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)Hs.761184.21853.151
 Sapiens mRNA; cDNA DKFZp434O1317 (from clone DKFZp434O1317)Hs.253624.20963.8012
 Homo sapiens prothymosin alpha (PTMA) gene, complete cds 4.20813.0005
 Human DNA sequence from clone RP5-1028D15 on chromosome 20. 4.20253.588
STK12serine/threonine kinase 12Hs.1806554.198811.5657
RNASEH2Aribonuclease H2, large subunitHs.252924.19794.9723
CENPHcentromere protein HHs.2003954.19383.1486
SEMA3A

sema domain, immunoglobulin domain (Ig), short basic domain, secreted,

(semaphorin) 3A

Hs.24144.15493.0951
TOMM40translocase of outer mitochondrial membrane 40 homolog (yeast)Hs.309284.14673.7005
 Homo sapiens chromosome 19, cosmid R31449 4.10363.6413
DDX36DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36Hs.94144.06073.3047
MSFMLL septin-like fusionHs.1810024.05463.1321
WDR12WD repeat domain 12Hs.732914.03184.2461
SLC1A5solute carrier family 1 (neutral amino acid transporter), member 5Hs.1835564.01083.3858
CHC1chromosome condensation 1Hs.847463.96213.2663
RPL7ribosomal protein L7Hs.1533.9563.6098
UACAuveal autoantigen with coiled-coil domains and ankyrin repeatsHs.497533.9133.338
 Human DNA sequence from clone 38C16 on chromosome 6q22.33–24.1. 3.87263.1904
MFAP2microfibrillar-associated protein 2Hs.3891373.83184.87
DNAJB6DnaJ (Hsp40) homolog, subfamily B, member 6Hs.1811953.82673.746
KIAA0117KIAA0117 proteinHs.3224783.81653.3667
NXNnucleoredoxinHs.3745343.80653.2577
PSMA4proteasome (prosome, macropain) subunit, alpha type, 4Hs.2515313.80523.7093
KIAA1553KIAA1553 proteinHs.1848523.8024.4838
ZNF43zinc finger protein 43 (HTF6)Hs.741073.74433.7323
COL18A1collagen, type XVIII, alpha 1Hs.784093.71023.741
RPS5ribosomal protein S5Hs.3560193.67543.8684
CTSL2cathepsin L2Hs.874173.63674.304
VDPvesicle docking protein p115Hs.3259483.62934.4329
MRPL37mitochondrial ribosomal protein L37Hs.42093.61283.3022
TUBB-4tubulin beta-4Hs.2743983.58273.3015
ALPLalkaline phosphatase, liver/bone/kidneyHs.2507693.57463.8268
SLC3A2solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2Hs.797483.55873.3374
GNA11guanine nucleotide binding protein (G protein), alpha 11 (Gq class)Hs.16863.55293.4664
EIF2S1eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDaHs.1517773.52423.9213
FLJ14502TRAF4 associated factor 1Hs.1814663.52043.222
MGC14480hypothetical protein MGC14480Hs.376163.5193.4166
SAD1SnRNP assembly defective 1 homologHs.128203.51343.3234
ABCF1ATP-binding cassette, sub-family F (GCN20), member 1Hs.95733.49523.1965
SMC6L1SMC6 structural maintenance of chromosomes 6-like 1 (yeast)Hs.344973.43393.0684
CGI-30CGI-30 proteinHs.4060513.42263.466
OSBPL9oxysterol binding protein-like 9Hs.219383.39993.0572
FLJ23091putative NFkB activating protein 373Hs.2507463.38943.6872
SC5DLsterol-C5-desaturase (ERG3 delta-5-desaturase homolog, fungal)-likeHs.2880313.37693.1688
TACC3transforming, acidic coiled-coil containing protein 3Hs.1040193.36823.1189
APEX1APEX nuclease (multifunctional DNA repair enzyme) 1Hs.737223.30864.0841
CHORDC1cysteine and histidine-rich domain (CHORD)-containing, zinc binding protein 1Hs.228573.28373.4777
GDI2GDP dissociation inhibitor 2Hs.568453.25163.0181
LAPTM4Blysosomal associated protein transmembrane 4 betaHs.2963983.2424.8001
NAV2neuron navigator 2Hs.234673.17513.6536
RPL29ribosomal protein L29Hs.4302073.17323.2301
TKTtransketolase (Wernicke-Korsakoff syndrome)Hs.896433.17173.9633
FDPS

farnesyl diphosphate synthase (farnesyl pyrophosphate synthetase,

dimethylallyltranstransferase, geranyltranstransferase)

Hs.3359183.15913.1378
EIF3S9eukaryotic translation initiation factor 3, subunit 9 eta, 116kDaHs.577833.13293.374
HSPC242hypothetical protein HSPC242Hs.251993.10024.3694
DSG2desmoglein 2Hs.3597843.08973.0869
HT007uncharacterized hypothalamus protein HT007Hs.243713.08663.6356
SLC5A6solute carrier family 5 (sodium-dependent vitamin transporter), member 6Hs.3215793.05953.4608
Figure Figure 6..

RT-PCR confirmation of representative genes detected by the large-scale microarray analysis of BG01 and BG02.A) Nanog, a recently identified hypothetical protein FLJ12581, that is critical for maintaining pluripotency of mES cells and three other hypothetical proteins, FLJ13072, KIAA1265, and MGC27165, were expressed in both BG01 and BG02. B) ZNF342, DNMT3L, DAX-1, and Eras were also expressed. C) Expression of keratin 8, 14, and 19; cardiac actin; and tubulin (genes associated with differentiation) were also detected by RT-PCR.

The remaining 281 of the 373 genes that were found to be differentially expressed by threefold or greater in BG01 and BG02 were not found to be differentially expressed in the other hES cell lines. These included metabolic-related genes, ribosomal proteins, histone proteins, and many hypothetical proteins. In addition, 19 novel genes were also identified and are listed separately (Table 4). We noted that a few genes that are considered as markers of differentiation were expressed at high levels in both undifferentiated BG01 and BG02 cells. These included keratin 8, 14, and 19; cardiac actin; and tubulin. Expression of these genes in undifferentiated ES cells was also found by RT-PCR (Fig. 6C).

Table Table 4.. Nineteen novel genes highly expressed (> threefold) identified by a large-scale microarray
SymbolGenebankFoldDescription
FLJ12519AL1220974hypothetical protein FLJ12519 high ests in testes, cervix and tumors. Chr 2.
MGC5627NM_0240965hypothetical protein MGC5627 predicted protein
FLJ20105AK0001124hypothetical protein FLJ20105 X chr unknown function in B cell tumors
 AL1336114Homo sapiens mRNA; cDNA DKFZp434O1317 (from clone DKFZp434O1317) Chr11 has poly A in tumors and est no predicted function
FLJ20641AK0006486hypothetical protein FLJ20641 Chr 12 hyothetical protein with helicase domains, highly enriched in EC libraries
AD024NM_0206758AD024 protein unknown function full length
 AL0315776Human DNA sequence from clone RP3-391O22 on chromosome 6p21.2–21.31, complete sequence
HSPC163NM_0141846HSPC163 protein INTEGRAL MEMBRANE PROTEIN (POTENTIAL). [TISSUE SPECIFICITY] EXPRESSED IN OOCYTES and adult brain member of the cornichon family (37% homology)
FLJ12505NM_02474923hypothetical protein FLJ12505 Chr1 290 aa found in ES est library
 AL3564147Human DNA sequence from clone RP11-352D3 on chromosome 20 contains an 0S ribosomal protein L21
FLJ10156AK00101814hypothetical protein FLJ10156 Chr 9 enriched in neuroblastomas
DKFZP586L0724AL11027117DKFZP586L0724 protein Chr 7
HT007NM_0184803uncharacterized hypothalamus protein HT007
M55914 6MYC promoter binding protein 1
FLJ12684NM_0245343hypothetical protein FLJ12684 Chr 4563aa very weakly similar to env protein
CGI-94NM_0160375comparative gene identification transcript 94
HSPC117AL0502556hypothetical protein HSPC117 Chr22 505 aa a family of uncharacterized proteins
HSPC111NM_0163915hypothetical protein HSPC111 Chr 5 178aa conserved in c-elegans
FLJ21841NM_0246096hypothetical protein FLJ21841 63% homology to nestin

Nodal Signaling

Among the genes that were differentially expressed are the TGF-β superfamily member Nodal and its antagonist Lefty. Nodal signaling is known to play an important role in endoderm formation, early embryonic patterning, and left-right axis positioning. To further examine expression of genes related to the Nodal signaling pathway in undifferentiated cells, we employed a focused microarray (96 genes) containing probes of the TGF-β superfamily and key proteins involved in the TGF-β signal-transduction pathway. Figure 7A shows a hybridization profile of BG01 and BG02, and Figure 7B summarizes the genes detected in both BG01 and BG02.

Figure Figure 7..

Gene expression profile of BG01 and BG02 by a focused human stem cell microarray.A) Images of arrays hybridized using BG01 and BG02 RNA. B) Summary of genes expressed by BG01 and BG02.

Of the 96 transcripts examined, 31 transcripts were detected in both BG01 and BG02 and 65 transcripts were not detected in either line (Fig. 7B). Nodal, LeftyA, LeftyB, Cripto-1 (TDGF-1), Cerberus, activin receptor ALK-3, and SMAD (3, 5, and 6), all involved in the Nodal signaling pathway, were expressed in both BG01 and BG02. Several bone morphogenetic proteins (BMPs), BMP2, BMP4, and BMP9 were detected in undifferentiated ES cells; however, BMP1, BMP3, BMP5, BMP6, BMP7, BMP8, BMP10, and BMP11 were not expressed in BG01 or BG02. Basic helix-loop-helix transcription factor ID2, ID3, and ID4, but not ID1 were also found to be expressed in BG01 and BG02.

Gene Expression Profile by Human Stem Cell Array

A focused array with genes related to human stem cell populations was used to analyze gene expression in undifferentiated BG01 and BG02 cells. The array contains 266 known genes, including 86 that encode markers expressed by stem cells at various stages of differentiation, 96 growth factors and cytokines known to regulate stem cell growth, 36 genes encoding extracellular matrix molecules expressed at appropriate developmental stages, and genes encoding proteins such as cell cycle regulators that are thought to be involved in stem cell division. Positive controls and housekeeping genes were also included for normalization to generate relative expression profiles.

The results of the human stem cell array analysis are summarized in Figure 8. Of the 266 genes represented by the array, 102 genes were detected in BG01 and BG02. Genes highly expressed included 12 transcription factors, 7 cell cycle-related genes, 25 markers for stem and differentiated cells, 44 growth factors, adhesion molecules and cytokines, and 14 others. In particular, telomerase (TERT), telomerase-associated protein 1, sonic hedgehog, five members of the TGF-β superfamily and receptors, seven members of the FGF family and receptors, 3 WNT genes, and ESG1, an expressed sequence tag that is weakly similar to embryonic stem cell-specific gene 1, were highly expressed. Members of the FGF and leukemia inhibitory factor (LIF) families and their receptors (LIFR) that were expressed are listed in Table 5. Expression of LIF and LIFR was below the limit of detection, and expression of gp130 was very low. The spots for these transcripts, which can be identified in the array [27], are not visible in Figure 8.

Table Table 5.. BG01 and BG02 cells express several FGFs and their receptors but not LIF and its receptor LIFR using a human stem cell array
GeneDescriptionExpressed
FGF9Fibroblast growth factor 9+
FGF18Fibroblast growth factor 18+
FGF19Fibroblast growth factor 19+
FGF20Fibroblast growth factor 20+
FGFR2Fibroblast growth factor receptor 2+
FGFR3Fibroblast growth factor receptor 3+
IL-6STInterleukin 6 signal transducer (gp130)+
FGF1Fibroblast growth factor 1 (acidic)
FGF2Fibroblast growth factor 2 (basic)
FGF3Fibroblast growth factor 3
FGF4Fibroblast growth factor 4
FGF5Fibroblast growth factor 5
FGF6Fibroblast growth factor 6
FGF7Fibroblast growth factor 7
FGF8Fibroblast growth factor 8
FGF10Fibroblast growth factor 10
FGF11Fibroblast growth factor 11
FGF12Fibroblast growth factor 12
FGF14Fibroblast growth factor 14
FGF16Fibroblast growth factor 16
FGF17Fibroblast growth factor 17
FGF21Fibroblast growth factor 21
FGF23Fibroblast growth factor 23
FGFR1Fibroblast growth factor receptor 1±
FGFR4Fibroblast growth factor receptor 4±
LIFLeukemia inhibitory factor
LIFRLeukemia inhibitory factor (LIFR)
Figure Figure 8..

Gene expression profile of BG01 and BG02 by a focused TGF-β/BMP microarray.A) Images of arrays hybridized using BG01 and BG02 RNA. B) Summary of genes expressed by BG01 and BG02.

Discussion

Despite the many potential uses of hES cell lines, only a limited number of lines are available and the properties of only a few of these have been described in the literature [5]. These include the lines available from Wicell (http://www.wicell.org/index.jsp) with more limited data available on lines from ESI (http://www.escellinternational.com) and from the Israel Institute of Technology (http://www.technion.ac.il). Of the four hES cell lines BG01, BG02, BG03, and BG04, derived by BresaGen from discarded embryos [6], two of them, BG01 and BG02, are currently available for academic research. In the present study, we report on characterization of these two hES cell lines. Both BG01 and BG02 express markers for undifferentiated ES cells, similar to other hES cell lines that have previously been described. BG01 and BG02 appear to be virtually identical in their ability to differentiate into ectodermal, mesodermal, and endodermal derivatives in vitro and in expression of cell surface antigens and transcription factors. Using a large-scale oligonucleotide microarray and small focused microarrays, we have confirmed expression of common markers and identified numerous additional genes that are expressed in undifferentiated BG01 and BG02 cells.

The potential of hES cells to contribute to the germline of chimeric organisms cannot be tested in humans and is not readily tested in nonhuman primates [24], and thus additional criteria for evaluating human and primate ES cells need to be used [4]. Human and subhuman primate ES cells have been defined as cells that are derived from preimplantation of peri-implantation embryos, and can be maintained in culture for prolonged periods in an undifferentiated state, while retaining the capacity to differentiate into cells of all three embryonic germ layers [4]. Our results show that like the hES cell lines, BG01 and BG02 appear morphologically and antigenically similar to the previously described hES cell lines. Like other hES cell lines [26] and unlike mouse ES cells, BG01 and BG02 cells are larger, grow more slowly, and grow in fewer layers. BG01 and BG02 express markers of undifferentiated ES cells like Sox-2, Oct-3/4, Nanog, TERT, SSEA-3, and SSEA-4; lack expression of markers of differentiation; can be maintained in culture for over 40 passages; and retain the ability to differentiate and express markers characteristic of ectoderm (TuJ1), endoderm (AFP), and mesoderm (cTnI). Like other cell lines tested [26, 28], BG01 and BG02 express galanin, Keratin 8 and 18, and several additional novel markers of the ES state such as Nanog and ZFN342. Similar to other ES lines, BG01 and BG02 can be cryopreserved and propagated extensively, and preliminary results suggest that clonal derivatives can be isolated. Like other ES cells that have been described, BG01 and BG02 do not appear to require LIF for their propagation and survival, and expression of LIFR or gp130 is low or absent (Fig. 7; Table 5; data not shown).

Thus BG01 and BG02, like the limited number of other hES lines, fulfill the minimal definition of an ES cell. It is important to note that although the NIH hES cell registry includes 78 derivations (http://www.stemcells.nih.gov/registry/eligibilityCriteria.asp), most have not been demonstrated to meet the minimal definition of stem cells. A subset of the derivations have, however, been described as hES cell lines in the literature, primarily those from Wicell and ESI, that can be cryopreserved and maintained in culture, undifferentiated, for several months.

Direct comparison with other lines and publicly available databases suggest that BG01 and BG02 have properties that are very similar to other hES cells [4, 26]. However, BG01 and BG02 cells in vitro require a much higher density of MEFs in the feeder layer in order to maintain in an undifferentiated state. In contrast to other hES cell lines, BG01 and BG02 can be passaged by the use of trypsin, which works as well as nonenzymatic cell dissociation buffers. More importantly, BG01 and BG02 recovered more rapidly from frozen vials (within 2–3 days) as compared with GE01 and GE04 cell lines. In general, these cells are easy to grow and maintain in vitro, which could be an advantage of these lines as compared with other hES cells that require mechanical dissociation or special handling.

Gene expression patterns for the BG01 and BG02 lines were analyzed by immunocytochemistry, RT-PCR, and two separate microarray platforms. Three hundred seventy-three genes were identified as being highly expressed in both BG01 and BG02. Included were 92 stemness genes known to be expressed in mES or hES cells such as OCT-3/4, NANOG, Cripto/TDGF1, Cx43, and galanin [28]. The same genes were also overexpressed in an additional four hES lines (TE06, GE01, GE09, and a pooled set of subclones derived from GE01, GE09, and GE07). Differentially expressed genes include Nanog (a recently identified protein FLJ12581 critical for maintaining pluripotency of mouse ES cells) and other hypothetical proteins, KIAA1573 and MGC27165, which were all highly expressed in both BG01 and BG02. Both cell lines also expressed ZNF342, DNMT3L, and DAX-1, which were also confirmed by RT-PCR. Genes highly expressed in BG01 and BG02 also included numerous cell signaling/cell cycle/cell development-related genes, metabolism genes including DNA replication and DNA repair enzymes, RNA-related ribosomal genes, metabolic activity-related genes, transcription factors, and immune response genes. Also present were 19 novel genes with unknown function, illustrating the value of a large-scale gene expression analysis and the potential for identifying novel pathways of regulation.

Among the genes that were differentially expressed between BG01 and BG02 are members of the TGF-β superfamily member Nodal and its antagonist Lefty. Nodal signaling plays important roles in early embryonic development, patterning, and left-right axis positioning, as well as in the early stages of ES cell development [2932]. Expression of genes related to the Nodal signaling pathway in undifferentiated BG01 and BG02 cells was studied with a focused microarray containing probes for TGF-β superfamily members and key proteins involved in the TGF-β signal-transduction pathway. Nodal; LeftyA; LeftyB; Cripto-1 (TDGF-1); Cerberus; activin receptors ALK-3; and SMAD3, SMAD5 and SMAF6, all molecules of the Nodal signaling pathway [33, 34], were expressed in both BG01 and BG02. While all components are present, this pathway is actively inhibited by negative regulators such as TDGF-1 and Nodal. Surprisingly, noggin does not appear to play as important a role in hES cell differentiation as has been proposed in rodent and xenopus studies [3537]. Overall, the expression patterns for the TGF-β superfamily were virtually identical in BG01 and BG02, further reinforcing the similarity of the two lines.

Human ES cells are likely to be an important resource for biomedical research over the next decade, since these cells will allow studies of differentiation, gene expression, and biochemical pathways to be performed using human material. Cells that have been differentiated from hES cells are also likely to be useful for a wide range of mundane but valuable purposes such as screening drugs and antiviral agents. Thus, in addition to the therapeutic possibilities, there are important potential uses of hES cells for basic research. Although it is potentially possible to generate a large number of hES cell lines, the number of lines that will be needed to be representative is unclear. Human ES cell lines may differ from each other due to differences in conditions and developmental stage under which they were isolated, in addition to male-female differences and differences related to genetic variations. While it is expected that the similarities among hES cell lines would be much greater than their differences, even small differences between hES cell lines may be critical in determining their utility. Although the NIH registry contains 78 putative stem cell lines(http://stemcells.nih.gov/registry/eligibilityCriteria.asp), very few of these lines have been described in the literature.

Our results show that BG01 and BG02 are generally similar to the other hES cell lines for which data on characterization are available. Both cell lines can be easily maintained in an undifferentiated state, grow rapidly, and readily differentiate into all major phenotypes, suggesting that these lines can be added to the short list of validated, potentially useful hES cell lines.

Acknowledgements

We thank members of our laboratories for constant stimulating discussions. We acknowledge the support of NIH grant R24DK063689 to BresaGen Inc.

Ancillary