SEARCH

SEARCH BY CITATION

Keywords:

  • Leydig cells;
  • male reproductive tract;
  • steroid hormones;
  • estradiol;
  • nandrolone

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References

ABSTRACT: The early neonatal development of boars is characterized by significant testicular production of androgens and estrogens, including an anabolic steroid hormone, 19-nortestosterone. The present study was conducted to determine the expression and presence of steroidogenic and steroid hormone metabolism—related enzymes in the testes of neonatal and 4-month-old prepubertal pigs. Quantitative analyses with real-time polymerase chain reaction and Western blotting were utilized to reveal mRNA and protein expression, respectively. The localization of the molecules in the testes was determined by immunohistochemistry. mRNA expressions of the molecules tested were mostly significantly increased between 1 and 3 weeks of age and decreased at 4 months of age, compared with those at 0 weeks of age. The protein levels of cytochrome P450 aromatase and carbonyl reductase 1 were significantly increased between 1 and 3 weeks of age and decreased at 4 months of age. However, protein expression patterns of other molecules differed from those of mRNA expression, which implied the existence of posttranscriptional gene regulation. Immunohistochemical analysis revealed that all of the molecules were present in Leydig cells of the pig testis, regardless of age, except cytochrome P450 side chain cleavage in germ cells and 17β-hydroxysteroid dehydrogenase 4 on the blood-testis barrier at 4 months of age. Aldose reductase and 3β-hydroxysteroid dehydrogenase were localized in both Leydig and Sertoli cells. We postulate that marked rises in the expression of steroidogenic enzymes in the pig testis during early neonatal development could be associated with peak production of 19-nortestosterone, thus eventually leading to the early growth of male pigs.

Aremarkable feature of the domestic boar (Sus scrofa) is high circulating estrogen concentrations (Claus and Hoffman, 1980; Setchell et al, 1983). Estrogen concentrations peak during neonatal development, between 1 and 3 weeks of age, and transiently decrease and remain at low level until pubertal development (Ford, 1983). Changes in the serum levels of free androgens and conjugated steroids also show similar patterns to those of estrogens during postnatal development of male pigs (Colenbrander et al, 1978; Schwarzenberger et al, 1993). Along with androgens and estrogens, 19-nortestosterone (17β-hydroxy-19-nor-4-androsten-3-one, also known as nandrolone) is normally found at high levels in pig serum during early neonatal development (Schwarzenberger et al, 1993). Particular attention is paid to nandrolone because of its high anabolic activity (Kuhn, 2002). Because the production of steroid hormone requires actions of a number of steroidogenic enzymes, it is suggested that there is a strong association between elevated steroid production and enhanced expression of steroidogenic enzymes during the early neonatal period.

Dynamic morphologic and histochemical changes in the pig testis appear during the early neonatal period. Increases of Sertoli cell proliferation and Leydig cell volume occur during the first month after birth (França et al, 2000). In addition, the majority of testicular volume is made up of Leydig cells in the early neonatal pig, predominantly between 2 and 3 weeks of age (van Straaten and Wensing, 1978). In mammal testes, syntheses of androgens and estrogens occur mostly in Leydig cells, and require a number of steroidogenic enzymes. In fact, the expression and presence of steroidogenic enzymes in the domestic pig testis are well documented (Sasano et al, 1989; Hall, 1991; Clark et al, 1996; Conley et al, 1996; Conley and Bird, 1997; Moran et al, 2002). A number of investigations have demonstrated that the expressions and activities of steroidogenic enzymes in pig testis are dependent on a variety of extragonadal and intragonadal factors (Chuzel et al, 1996; Clark et al, 1996; Lejeune et al, 1998; Moran et al, 2002). Estrogens are synthesized from the aromatization of androgens through the action of cytochrome P450 aromatase (CYP19). Differential expression of CYP19 has been found during different stages of pig development. In fetal pig testis, CYP19 is present in Leydig cells and/or gonocytes (Conley et al, 1996; Parma et al, 1999; Haeussler et al, 2007), whereas the expression of CYP19 is exclusively limited to Leydig cells of immature and mature pigs (Fraczek et al, 2001; Mutembei et al, 2005). During early neonatal development, an increase of CYP19 activity has been detected between 1 and 7 days after birth (Moran et al, 2002). However, the ontogeny of CYP19 expression in the pig testis during early neonatal development has not yet been determined, in spite of the peak production of estrogen during the first month after birth (Schwarzenberger et al, 1993). Differential expressions of other steroidogenic enzymes in the pig testis during fetal and postnatal development have also been reported (Conley et al, 1994; Moran et al, 2002; Haeussler et al, 2007). However, a detailed examination of the expression of these steroidogenic enzymes during early neonatal development is needed, because of the significant production of steroid hormones in pigs during the neonatal period (Schwarzenberger et al, 1993).

As noted above, nandrolone is a potent anabolic steroid that is found at high levels in male pig serum, particularly during early neonatal development and after puberty (Schwarzenberger et al, 1993; Choi et al, 2007). Endogenous production of nandrolone is also detected in mares (Sterk et al, 1998) and some ruminants, including goat, cow, and sheep (Mayer et al, 1992; De Brabander et al, 1994; Sterk et al, 1998). The mechanism of nandrolone synthesis in the pig testis has not been revealed in detail. Kao et al (2000) showed that the porcine CYP19 is capable of converting testosterone into nandrolone via demethylation. In addition, Corbin et al (1999) demonstrated the catalytic activity of the porcine CYP19 on the formation of nandrolone using testosterone as a substrate. These findings imply that the presence of a high serum level of nandrolone in the male pig during early neonatal development would be associated with the expression of CYP19, as well as other steroidogenic enzymes, in the pig testis.

Comprehensive evaluation of differential gene expression in the pig testis during postnatal development has not been studied. Our recent, unpublished cDNA microarray data have shown dramatic expressional changes of a variety of molecules in pig testis between 2 weeks of age and prepuberty. Based on preliminary data and other investigations, we hypothesized that peak production of steroid hormones in the male pig during early neonatal development would relate to increases of gene expression of steroidogenic enzymes in the pig testis. To test this hypothesis, based on our cDNA microarray results, we selected a total of 7 genes that are involved in the synthesis and metabolism of steroid hormones in the pig testis. These molecules were CYP19, cytochrome P450 side chain cleavage (CYP11A1), 17β-hydroxysteroid dehydrogenase 4 (HSD17B4), 3β-hydroxysteroid dehydrogenase (HSD3B), carbonyl reductase 1 (CBR1), aldose reductase (ALR2), and 17α-hydroxylase (CYP17A). In the present study, we first attempted to evaluate the differential expression of mRNA and protein by real-time polymerase chain reaction (PCR) and Western blot analyses, respectively. In addition, immunohistochemical analysis was performed to localize the molecules in the pig testis at different neonatal ages (0, 1, 2, and 3 weeks of age). We also included the testis at 4 months of age for comparison in the present study, because steroid hormones were present at the basal level in circulating blood at this age (Schwarzenberger et al, 1993).

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References

Animals and Tissue Collection

Male reproductive tracts were obtained from boars (Sus scrofa domestica; Yorkshire × Landrace × Duroc) during routine castrations at the local animal farm and the National Institute of Animal Science, Republic of Korea. Five experimental groups were used at the following ages: 1) 0 weeks (within 3 days of age after birth: n = 4), 2) 1 week (n = 5), 3) 2 weeks (n = 5), 4) 3 weeks (n = 4), and 5) 4 months (n = 3). One side of the male reproductive tract from each pig was fixed in Bouin fixative for the detection of steroidogenic enzymes in the testes by immunohistochemistry. The other side of the male reproductive tract was rapidly dissected in ice-cold phosphate-buffered saline (PBS), and the testes were separated from the rest of the reproductive tract. The testes were quickly frozen in liquid nitrogen and stored at −80°C until isolation of total RNA or protein for real-time PCR or Western blotting, respectively.

Total RNA and Protein Isolation

Total RNA was isolated according to the instructions provided with TRIzol RNA extraction solution (Invitrogen, Carlsbad, California). In brief, 50–100 mg of fresh testis tissue was homogenized in 1 mL of extraction buffer using a Polytron homogenizer (Fisher Scientific, Pittsburgh, Pennsylvania), followed by chloroform and isopropanol total RNA precipitation. The isolated RNA pellets were dissolved in RNA storage buffer (Ambion, Austin, Texas) and stored at −80°C until used for the reverse transcription (RT) reaction. The purity and yield of the total RNA were determined by an ultraviolet (UV) spectrophotometer (Eppendorf, New York, New York), and the qualities of the total RNAs were checked by gel electrophoresis prior to the RT reaction.

The protein from the testes was prepared in ProPrep protein extraction solution (iNtRON Biotech, Sungnam, Republic of Korea). The 10–20 mg of testicular tissue was homogenized in 600 μL of lysis buffer using a Polytron homogenizer (Fisher Scientific), followed by incubation at −20°C for 20–30 minutes and centrifugation at 16 609× g (4°C) for 10 minutes. The total protein concentration of the supernatant was determined by the Bradford method (BioRad, Hercules, California), with bovine serum albumin (BSA) as standard. Isolated protein was kept at −80°C until used for Western blot analysis.

RT and Real-time PCR

RT was carried out according to the instructions in the ImProm-II RT system (Promega, Madison, Wisconsin). Briefly, 1 μg of total RNA was reverse-transcribed in a total volume of 20 μL using oligo-dT primer. The RT reaction was performed at 25°C for 5 min, 42°C for 1 hour, and 70°C for 15 minutes. One microliter of cDNA was used as a template for real-time PCR in a 25 μL reaction mixture, including 0.75 U of GoTaq DNA polymerase (Promega), 5 μL of 5× buffer, 0.2 mM of deoxyribonucleotide triphosphate (Promega), 2.5 μL of 3000× SYBR Green I (BMA, Rockland, Maine), and 10 pmol of each primer. Oligonucleotide primers for real-time PCR were prepared either by using Primer 3 software (Whitehead Institute/MIT Center for Genomes Research, Cambridge, Massachusetts; http:www.bioneer.co.krcgi-binprimerprimer3.cgi) or utilizing published information. Information and sequences of primers of steroidogenic enzymes tested in the present study are summarized in Table 1. The PCR program employed an initial step of 95°C for 5 minutes for predenaturation, followed by denaturation at 94°C, annealing, and extension at 72°C using the PTC-200 Chromo 4 real-time system (Bio-Rad Laboratories). The final extension was carried out for 10 minutes at 72°C. No RNA, no cDNA template, and no primer controls were included for PCR control purposes. The PCR products were visualized on 1.2% agarose gel and photo-captured under UV light using an image documentation system (Vilber Loumat, Marne-la-Vallée, France). Cyclophilin (PPIA) was included as an internal PCR control. For quantification of real-time PCR results, the relative standard curve method was used to obtain quantitative values. Each sample was replicated 3 or 4 times, and the normalized mean value to PPIA was used for final comparison.

Table 1. . Primer sequences and expected product sizes of steroidogenic enzymes tested for real-time PCR
MoleculeForward Primer Sequence, 5′-3′aReverse Primer Sequence, 5′-3′aTemperature, °CExpected Product Size, bpGenBank Accession Number
  1. Abbreviations: ALR2, aldose reductase; CBR1, carbonyl reductase 1; CYP11A1, cytochrome P450 side-chain cleavage; CYP17A, 17α-hydroxylase; CYP19, cytochrome P450 aromatase; HSD17B4, 17β-hydroxysteroid dehydrogenase 4; HSD3B, 3β-hydroxysteroid dehydrogenase; PPIA, cyclophilin.

  2. aNumbers in parentheses indicate the positions of bases in GenBank.

CYP19GTCCTGGCTATTTTCTGGGAATTGG (216–240)TGGAATCGGCACAGACGGTCACCAT (548–572)50356U37312
CYP11A1TTTACAGGGAGAAGCTCGGCAAC (297–319)TTACCTCCGTGTTCAGGACCAAC (487–509)53213X13768
HSD17B4TGCAGATCGTGATGTGTTGA (1716–1735)TTCTTCACCATTTCTTGCCC (1987–2006)53291X78201
CBR1ACCAGCTGGACATCATAGAC (286–305)AGATCCTGGACAACACAGAG (710–729)53444M80709
CYP17ACACTGTTGCGGACATCTTTG (979–998)CTGATAGATGGGGCACGATT (1112–1131)50152M63507
ALR2GGCAAAAGCAACGAAGAGAC (875–894)CTGCCATAGTCCAGTGGGTT (1148–1167)53293AF202775
HSD3BTCCACACCAGCAGCATAGAG (534–553)ATACATGGGCCTCAGAGCAC (720–739)53206NM_001004049
PPIAAGCACTGGGGAGAAAGGATT (122–141)GCCATCCAACCACTCAGTCT (357–375)61255AY266299

Immunohistochemistry

The male reproductive tract was fixed in Bouin fixative for 18–24 hours. The testes were separated from other parts of the reproductive tract. The testes were dehydrated in a serial of ethanol, cleared in xylene, and infiltrated with paraffin. Paraffin-embedded testes were sectioned at thicknesses of 4–5 μm. For immunohistochemistry, tissue sections were deparaffinized in xylene and rehydrated in a series of ethanol. After microwaving in 0.01 M citrate buffer, pH 6.0, for 10 minutes for antigen retrieval, tissue sections were placed in 0.3% H2O2/methanol for 15 minutes to inactivate endogenous peroxidase. After washing in PBS, tissue sections were incubated in 10% normal goat (Chemicon International, Temecula, California) or rabbit serum (Jackson ImmunoResearch Laboratories Inc, West Grove, Pennsylvania), for 30 minutes at room temperature to block nonspecific binding. Diluted primary antibodies were applied on the tissue sections and incubated in a humidified chamber at 4°C overnight. The dilutions of the primary antibodies were selected after a series of multiple preliminary trials for each antibody. We used dilutions of 1:1000 for CYP19 (polyclonal rabbit anti-CYP19; a generous gift from Dr Nobuhiro Harada, Fujita Health University, Japan), 1:400 for CYP11A1 (AB1244; Chemicon), 1:2000 for HSD17B4 (monoclonal mouse anti-HSD17B4; a kind gift from Dr Gabriele Möller, GSF-Research Center for Environment and Health, Neuherberg, Germany), 1:500 for CBR1 (ab4148; Abcam Ltd, Cambridge, United Kingdom), 1:500 for CYP17A (polyclonal rabbit anti-CYP17A; a generous gift from Dr Anita Payne, Stanford University, Stanford, California), 1:200 for ALR2 (polyclonal rabbit anti-ALR2; a gracious gift from Dr Motoko Takahashi, Saga University, Saga, Japan), and 1:500 for HSD3B (polyclonal rabbit anti-HSD3B; a benevolent gift from Dr Ian Mason, University of Edinburgh, Edinburgh, United Kingdom). Excess primary antibodies were washed off the tissue sections using PBS. Tissue sections were then incubated with biotinylated goat anti-rabbit IgG (DAKO Corporation, Carpinteria, California) for CYP19, CYP11A1, CYP17A, ALR2, and HSD3B, biotinylated goat anti-mouse IgG (DAKO) for HSD17B4, or biotinylated rabbit anti-goat IgG secondary antibody (DAKO) for CRB1 in a humidified chamber at room temperature for 1 hour. Unbound secondary antibodies were washed off with PBS, and elite avidin-biotin peroxidase (Vector Laboratories, Burlingame, California) was placed on slides in a humidified chamber at room temperature for 30 minutes. After three 5-minute washes in PBS, the tissue sections were treated with a mixture of 3,3′-diaminobenzidine (Sigma, St Louis, Missouri), 0.05 M Tris-HCl buffer, and 5% hydrogen peroxide to detect the peroxidase. The tissue sections were then counterstained with hematoxylin, followed by dehydration in ethanol and mounting. For negative controls, tissue sections were treated with normal rabbit, mouse (Chemicon), or goat serum at the same dilutions in the place of primary antibodies. Immunostaining was evaluated with digitalized images captured with an Olympus-CoolSNAP cf color/OL camera (Olympus America, Melville, New York) using RSImage version 1.1 software (Roper Scientific, Duluth, Georgia). The photographic images were processed in Photo-Shop software (Adobe Systems, San Jose, California).

Western Blotting Analysis

Forty micrograms of protein were fractionated on 12% SDS-PAGE polyacrylamide gel (Invitrogen) and electrotransferred to a nitrocellulose membrane. After rinsing in Tris-buffered saline with Tween (TBST; 0.2M Tris, 1.37M NaCl, 0.05% Tween-20), nonspecific binding was blocked by incubation of the membrane in TBST with 1% BSA (Sigma) for 1 hour at room temperature. Blotting membranes were incubated with primary antibodies diluted in TBST at 4°C overnight. The same antibodies used for immunohistochemistry were employed, but at different dilutions: 1:2500 for CYP19, 1:5000 for CYP11A1, 1:10 000 for HSD17B4, 1:10 000 for CBR1, 1:5000 for CYP17A, 1:5000 for ALR2, and 1:5000 for HSD3B. After washing in TBST, blotting membranes were incubated with a goat anti-rabbit or anti-mouse HRP-conjugated IgG or rabbit anti-goat HRP-conjugated IgG antibody (Santa Cruz Biotechnology, Inc, Santa Cruz, California) diluted at 1:2000 in TBST at room temperature for 1 hour. The membranes were then washed 5 times with TBST, and blotting results were detected with the enhanced chemiluminescence detection system (Amersham Biosciences, Pittsburgh, Pennsylvania). β-actin (SC-47778; Santa Cruz Biotechnology) served as an internal control for Western blot analysis. Blotting results were analyzed using image analysis software, Image J, released from the National Institutes of Health (Bethesda, Maryland; http:rsb.info.nih.govijdownload.html). Each sample was analyzed 3 times, and a mean value that was normalized to β-actin was used in the final comparison.

Data Presentation and Statistical Analysis

Data for mRNA and protein abundance were expressed relative to 0 weeks of age as arbitrary units. In the figures, data are presented as mean ± SD. A lack of bars indicates an insignificant SD. Comparison of mean differences among neonatal and prepubertal ages were made using 1-way analysis of variance, followed by Tukey's test, using SPSS software (SPSS Inc, Chicago, Illinois). In all cases, results were considered significant if P < .05.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References

Expression and Immunohistochemical Localization of CYP19 Transcript and Protein

The presence and expression of CYP19 mRNA and protein were detected in neonatal and prepubertal pig testes (Figure 1). The level of CYP19 mRNA expression was not significantly different between 0 and 1 weeks of age (Figure 1A). However, a significant increase in the CYP19 mRNA level was observed at 2 weeks of age (Figure 1A). The abundance of CYP19 transcript at 3 weeks of age was similar to that seen at 0 and 1 weeks of age (Figure 1A). A significant decrease in the CYP19 mRNA level was detected at 4 months of age, when the level was approximately 20-fold lower than the abundance of CYP19 mRNA at 0 weeks of age (Figure 1A). A similar expression pattern was found for the protein level (Figure 1B). A significant increase of the CYP19 protein level was observed at 2 weeks of age (Figure 1B). Compared with the level at 0 weeks of age, the levels of CYP19 (∼50 kDa) at 1 week and 3 weeks of age were not significantly changed (Figure 1B). However, the abundance of CYP19 was significantly lower at 4 months of age than at 0 weeks of age (Figure 1B). Immunohistochemical analysis showed an exclusive localization of CYP19 in Leydig cells of the testis, regardless of the postnatal ages (Figure 1C; Table 2). Sex cords (SCs) in the neonatal testis and seminiferous tubules (STs) in the prepubertal testis were devoid of CYP19 staining (Figure 1C). Strong immunopositive staining of CYP19 in Leydig cells was found at all neonatal ages (Figure 1C). However, the immunoreactivity of CYP19 was visibly reduced in Leydig cells at 4 months of age (Figure 1C; Table 2).

image

Figure 1. . Expression and immunolocalization of cytochrome P450 aromatase in pig testes. CYP19 mRNA (A) and protein (B) were detected in neonatal and prepubertal pig testes. Different letters indicate significant differences among groups (P < .05). M indicates 100-bp size marker; CYP19, cytochrome P450 aromatase; PPIA, cyclophilin, an internal control for real-time PCR analysis. (C) Immunohistochemical localization of CYP19 in neonatal and prepubertal pig testes. At all ages, Leydig cells (L) were immunopositive for CYP19 protein, whereas the sex cords (SC) in the neonatal pig testes and seminiferous tubules (ST) at 4 months of age were immunonegative. Bars = 100 μm. 0w indicates 0 weeks of age; 1w, 1 week of age; 2w, 2 weeks of age; 3w, 3 weeks of age; and 4M, 4 months of age.

Download figure to PowerPoint

Table 2. . Summary of immunohistochemical analyses of molecules tested
 
 
MoleculeLSCGLSCGLSCGLSCGLSG
  1. Abbreviations: +, positive; +/−, weakly positive; -, negative. ALR2, aldose reductase; CBR1, carbonyl reductase 1; CYP11A1, cytochrome P450 side-chain cleavage; CYP17A, 17α-hydroxylase; CYP19, cytochrome P450 aromatase; G, germ cell; HSD17B4, 17β-hydroxysteroid dehydrogenase 4; HSD3B, 3β-hydroxysteroid dehydrogenase; L, Leydig cell; S, Sertoli cell; SC, sex cord.

  2. aPositive immunoreaction on blood-testis barrier at 4 months of age.

  3. bNot all cells immunopositive.

CYP19+++++/−
CYP11A1++++++/−
HSD17B4a++++
CBR1+++++
CYP17A+++++
ALR2+++++++++/−+
HSD3Ba+/−++++++/−++/−+/−b

Differential Expression and Immunolocalization of CYP11A1 mRNA and Protein

The expression level of CYP11A1 mRNA was significantly increased at 1 week of age, compared with the expression level at 0 weeks of age (Figure 2A). The abundance of CYP11A1 mRNA remained significantly high at 2 and 3 weeks of age (Figure 2A), but the expression of CYP11A1 mRNA was significantly reduced at 4 months of age (Figure 2A). In contrast to the mRNA expression pattern, the highest level of CYP11A1 protein (∼52 kDa) was found at 0 weeks of age, followed by significantly decreased levels of CYP11A1 at 1, 2, and 3 weeks of age (Figure 2B). At 4 months of age, the testes possessed the lowest level of CYP11A1 (Figure 2B). Restricted immunoreactivity of CYP11A1 was found in Leydig cells (Figure 2C; Table 2). No positive immunostaining of CYP11A1 was observed in SCs during the neonatal period (Figure 2C). However, at 4 months of age, CYP11A1 was immunolocalized in some germ cells, including secondary spermatocytes and round spermatids, as well as Leydig cells (Figure 2C; Table 2).

image

Figure 2. . Expression and immunolocalization of cytochrome P450 side chain cleavage transcript and protein in pig testes. CYP11A1 mRNA (A) and protein (B) were detected in neonatal and prepubertal pig testes. Different letters indicate significant differences among groups (P < .05). M indicates 100-bp size marker; CYP11A1, cytochrome P450 side chain cleavage; PPIA, cyclophilin, an internal control for real-time PCRanalysis. (C) Immunohistochemical localization of CYP11A1 in neonatal and prepubertal pig testes. Leydig cells (L) in the neonatal pig testes were immunopositive for CYP11A1 protein, whereas the sex cords (SC) were immunonegative. At 4 months of age, spermatids (Sp) in seminiferous tubules (ST) became weakly immunopositive, whereas Leydig cells were still strongly immunopositive. Bars = 100 μm. Bar in 4M (E) = 20 μm. 0w indicates 0 weeks of age; 1w, 1 week of age; 2w, 2 weeks of age; 3w, 3 weeks of age; 4M, 4 months of age; 4M (E), enlarged picture of the testis at 4 months of age.

Download figure to PowerPoint

Immunohistochemical Localization and Expression of CBR1 mRNA and Protein

The abundance of CBR1 mRNA increased with age during the neonatal period (Figure 3A). The highest expression of CBR1 mRNA was detected at 3 weeks of age, and the testes expressed the lowest level of CBR1 mRNA at 4 months of age (Figure 3A). Western blot analysis also showed significant increases of CBR1 protein (∼30 kDa) at 2 and 3 weeks of age (Figure 3B). As in CBR1 mRNA, the expression of CBR1 protein in the testis was significantly reduced at 4 months of age (Figure 3B). Regardless of age, the strong immunoreactivity of CBR1 was exclusively localized in Leydig cells, but not in SCs or Sertoli or germ cells in STs (Figure 3C; Table 2).

image

Figure 3. . Expression and immunolocalization of carbonyl reductase 1 in pig testes. CBR1 mRNA (A) and protein (B) were detected in neonatal and prepubertal pig testes. Different letters indicate significant differences among groups (P < .05). M indicates 100-bp size marker; PPIA, cyclophilin, an internal control for real-time PCR analysis. (C) Immunohistochemical localization of CBR1 in neonatal and prepubertal pig testes. At all ages, Leydig cells (L) were strongly immunopositive for CBR1 protein, whereas the sex cords (SC) in the neonatal pig testes and seminiferous tubules (ST) at 4 months of age were devoid of immunoreactivity for CBR1. Bars =100 μm. 0w indicates 0 weeks of age; 1w, 1 week of age; 2w, 2 weeks of age; 3w, 3 weeks of age; and 4M, 4 months of age.

Download figure to PowerPoint

Expression and Immunohistochemical Localization of HSD17B4 Transcript and Protein

The expression and immunohistochemical localization of HSD17B4 mRNA and protein are shown in Figure 4. The level of HSD17B4 mRNA was increased with neonatal age, followed by a significant decrease at 4 months of age (Figure 4A). The highest mRNA expression of HSD17B4 was found at 3 weeks of age (Figure 4A). Western blot analysis showed a single band of HSD17B4 protein (∼32 kDa) in the testis (Figure 4B). Interestingly, the highest level of HSD17B4 protein was found at 0 weeks of age, followed by a significant decrease at 1 week of age (Figure 4B). However, the amounts of HSD17B4 protein at 2 and 3 weeks of age were not significantly different from the level at 0 weeks of age (Figure 4B). As seen in mRNA expression, the lowest expression of HSD17B4 protein was found at 4 months of age (Figure 4B). During the neonatal period, HSD17B4 expression was localized in Leydig cells, as determined by immunohistochemistry (Figure 4C; Table 2). However, at 4 months of age, the Leydig cells were devoid of HSD17B4 (Figure 4C), and the blood-testis barrier (BTB) along the Sertoli cells was strongly immunostained for HSD17B4 (Figure 4C; Table 2). Neither Sertoli cells nor germ cells were immunopositive for HSD17B4 at 4 months of age (Figure 4C; Table 2).

image

Figure 4. . Expression and immunolocalization of 17β-hydroxysteroid dehydrogenase 4 in pig testes. HSD17B4 mRNA (A) and protein (B) were detected in neonatal and prepubertal pig testes. Different letters indicate significant differences among groups (P < .05). M indicates 100-bp size marker; PPIA, cyclophilin, an internal control for real-time PCR analysis. (C) Immunohistochemical localization of HSD17B4 in neonataland prepubertal pig testes. Leydig cells (L) in the neonatal pig testes were immunopositive for HSD17B4 protein, whereas the sex cords (SC) were immunonegative. At 4 months of age, strong immunoreactivity of HSD17B4 was found on the blood-testis barrier (BTB, blue arrows), whereas Leydig cells and cells in seminiferous tubules (ST) were immunonegative for HSD17B4 protein. Bars = 100 μm. Bar in 4M (E) = 20 μM. 0w indicates 0 weeks of age; 1w, 1 week of age; 2w, 2 weeks of age; 3w, 3 weeks of age; 4M, 4 months of age; and 4M (E), enlarged picture of the testis at 4 months of age.

Download figure to PowerPoint

Expression and Localization of CYP17A Transcript and Protein

The expression of CYP17A mRNA was significantly increased at 1, 2, and 3 weeks of age, compared with that at 0 weeks of age (Figure 5A). A significant decrease in the CYP17A mRNA level was detected in the testis at 4 months of age (Figure 5A). The expression pattern of CYP17A protein (∼50 kDa) during the neonatal period differed from that of mRNA expression (Figure 5B). A significant reduction of the CYP17A protein level was found at 2 weeks of age, whereas the levels of CYP17A protein at 1 and 3 weeks of age were not significantly different from the CYP17A protein level at 0 weeks of age (Figure 5B). A significant decrease in the CYP17A protein level was also detected at 4 months of age (Figure 5B). Immunohistochemical analysis showed strong immunoreactivity of CYP17A in Leydig cells of the testis at all ages (Figure 5C; Table 2). The Sertoli cells and germ cells were immunonegative for CYP17A (Figure 5C; Table 2).

image

Figure 5. . Expression and immunolocalization of 17α-hydroxylase in pig testes. CYP17A mRNA (A) and protein (B) were detected in neonatal and prepubertal pig testes. Different letters indicate significant differences among groups (P < .05). M indicates 100-bp size marker. CYP17A, 17α-hydroxylase. PPIA, cyclophilin, an internal control for real-time PCR analysis. (C) Immunohistochemical localization of CYP17A in neonataland prepubertal pig testes. At all ages, Leydig cells (L) were strongly immunopositive for CYP17A protein, whereas the sex cords (SC) in the neonatal pig testes and seminiferous tubules (ST) at 4 months of age were devoid of immunoreactivity for CYP17A. Bars = 100 μm. 0w indicates 0 weeks of age; 1w, 1 week of age; 2w, 2 weeks of age; 3w, 3 weeks of age; and 4M, 4 months of age.

Download figure to PowerPoint

Changes of Expression and Localization of HSD3B mRNA and Protein

The expression of HSD3B mRNA was significantly increased at 1 week of age (Figure 6A). The abundance of HSD3B mRNA at 2 and 3 weeks of age was significantly decreased compared with that at 1 week of age (Figure 6A). A significant decrease of HSD3B mRNA expression was seen at 4 months of age (Figure 6A). Western blot analysis showed that the level of HSD3B protein (∼45 kDa) was the highest at 0 weeks of age (Figure 6B). A significant decrease of HSD3B level was found at 1 week of age, followed by further significant decrease at 3 weeks of age (Figure 6B). The lowest level of HSD3B protein in the boar testis was detected at 4 months of age (Figure 6B). Immunohistochemistry revealed the localization of HSD3B in Leydig cells and SCs at neonatal ages (Figure 6C; Table 2). Strong immunoreactivity of HSD3B was detected in SCs at all neonatal ages, whereas the intensity of the positive reaction of HSD3B in Leydig cells varied to some extent with age (Figure 6C; Table 2). At 4 months of age, the immunoreactivity of HSD3B became visibly weaker and was found in Leydig cells and Sertoli cells, as well as the BTB (Figure 6C; Table 2).

image

Figure 6. . Expression and immunolocalization of 3β-hydroxysteroid dehydrogenase in pig testes. HSD3B mRNA (A) and protein (B) were detected in neonatal and prepubertal pig testes. Different letters indicate significant differences among groups (P < .05). M indicates 100-bp size marker; PPIA, cyclophilin, an internal control for real-time PCR analysis. (C) Immunohistochemical localization of HSD3B in neonatal andprepubertal pig testes. Leydig cells (L) and sex cords (SC) in the neonatal pig testes were immunopositive for HSD3B protein. At 4 months of age, positive immunoreactivity of HSD3B was found on the blood-testis barrier (BTB, black arrows) and Sertoli cells (S, blue arrows) in seminiferous tubules (ST), as well as Leydig cells. Bars = 100 μm. Bar in 4M (E) = 20 μM. 0w indicates 0 weeks of age; 1w, 1 week of age; 2w, 2 weeks of age; 3w, 3 weeks of age; 4M, 4 months of age; and 4M (E), enlarged picture of the testis at 4 months of age.

Download figure to PowerPoint

Expression and Localization of ALR2 mRNA and Protein in the Pig Testis

The expressions of ALR2 mRNA and protein are shown in Figure 7A and 7B, respectively. Compared with 0 weeks of age, significant increases of ALR2 mRNA expression were noticed at 1 and 2 weeks of age, whereas no change of the ALR2 mRNA level was found at 3 weeks of age (Figure 7A). A significant decrease of ALR2 mRNA abundance was detected at 4 months of age (Figure 7A). Western blot analysis revealed that there was no significant change of the ALR2 protein (∼36 kDa) level until 2 weeks of age (Figure 7B). A significant decrease of the protein level was found at 3 weeks of age, and the lowest level of ALR2 protein was observed at 4 months of age (Figure 7B). Immunohistochemical analysis showed a strong positive reaction of ALR2 in Leydig cells and SCs at all neonatal ages (Figure 7C; Table 2). At 4 months of age, the immunoreactivity of ALR2 in Leydig cells was visibly reduced, whereas a strong immunostaining of ALR2 was found in Sertoli cells (Figure 7C; Table 2).

image

Figure 7. . Expression and immunolocalization of aldose reductase in pig testes. ALR2 mRNA (A) and protein (B) were detected in neonatal and prepubertal pig testes. Different letters indicate significant differences among groups (P < .05). M indicates 100-bp size marker; ALR2, aldose reductase; PPIA, cyclophilin, an internal control for real-time PCR analysis. (C) Immunohistochemical localization of aldose reductase inneonatal and prepubertal pig testes. Leydig cells (L) and sex cords (SC) in the neonatal pig testes were immunopositive for ALR2 protein. At 4 months of age, positive immunoreactivity of ALR2 was found in Sertoli cells (S, blue arrows) in seminiferous tubules (ST), as well as Leydig cells. Bars = 100 μm. Bar in 4M (E) = 20 μM. 0w indicates 0 weeks of age; 1w, 1 week of age; 2w, 2 weeks of age; 3w, 3 weeks of age; 4M, 4 months of age; and 4M (E), enlarged picture of the testis at 4 months of age.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References

This study examined the expression and localization of the enzymes involved in steroidogenesis and metabolism of steroid hormone in the early neonatal and prepubertal pig testes. Quantitative real-time PCR and Western blotting analyses were used to determine the expressions of the mRNA and proteins of enzymes, respectively. In addition, the localization of these molecules in the pig testes was evaluated by immunohistochemistry. Criteria used to select the molecules tested in the present study were based on our unpublished DNA microarray analysis, which showed differential expression of pig testicular genes between 2 weeks of age and prepuberty. To our knowledge, this is the first time that the expression and localization patterns of a number of enzymes related to the synthesis and metabolism of steroid hormones in the pig testis have been investigated during early neonatal development. Significant increases of the mRNA levels of all of the molecules examined were clearly observed between 1 and 3 weeks of age. Interestingly, except in the cases of CYP19 and CBR1, changes of protein abundance during early neonatal development were not consistent with the patterns of mRNA expression. However, the expression pattern of mRNA in the prepubertal pig testis at 4 months of age was similar to the protein expression pattern. Thus, these results suggest the existence of posttranscriptional regulatory mechanisms on the expression of steroidogenic enzymes in the pig testis during early neonatal development. Results of immunohistochemical analysis are summarized in Table 2. Immunohistochemistry revealed the presence of steroidogenic enzymes in Leydig cells, and Sertoli cells in the cases of ALR2 and HSD3B, during neonatal development. However, as seen in CYP11A1 and HSD17B4, differential localization of molecular expression was found in the prepubertal pig testis, indicating a change and/or addition to the functional roles of these molecules in the pig testis during postnatal development.

The synthesis and metabolism of steroid hormones require a variety of steroidogenic enzymes. The boars have extraordinarily high plasma and testicular levels of estrogens, compared with the males of other species and females of the same species (Claus and Hoffman, 1980; Setchell et al, 1983; Schwarzenberger et al, 1993). During postnatal development, the first peak of estrogen concentration occurs during the first month after birth, followed by transient decreases until the second peak, which occurs after puberty (Christenson et al, 1984; Schwarzenberger et al, 1993). The production of estrogens is catalyzed by the action of CYP19, which results in irreversible conversion of androgens to estrogens (Carreau and Levallet, 1997). Thus, a surge of estrogen production in the pig testis during early neonatal development would result in an increase of CYP19 expression. Indeed, the present study showed marked increases of CYP19 mRNA and protein levels in the pig testis at 2 weeks of age, in parallel with our previous finding (Choi et al, 2007). A slight but significant increase of the CYP19 protein level was observed at 1 and 3 weeks of age. In addition, the present study demonstrated the exclusive localization of CYP19 in Leydig cells, in agreement with the findings of other investigators (Conley et al, 1996; Mutembei et al, 2005; Haeussler et al, 2007). In spite of dramatic increases of plasma estrogen concentrations in the first few weeks (Schwarzenberger et al, 1993), increases of CYP19 mRNA and protein levels were unexpectedly low, 1.7 times or less. A similar finding for CYP19 activity was found in the neonatal pig testes (Moran et al, 2002). However, because the interstitial volume, density, and cytoplasmic volume of Leydig cell in pig testis increase greatly between birth and 1 month of age (van Straaten and Wensing, 1978; França et al, 2000), it is reasonable to consider that overall CYP19 level and activity in the pig testes during early neonatal development would be greater than observed in the findings from the present study, as well as previous studies (Moran et al, 2002). Thus, it is speculated that such increase of CYP19 activity during the first 2 weeks after the birth would strongly correlate with a significant secretion of nandrolone from the neonatal pig testis.

Interconversion of 17-ketosteroids with the corresponding 17β-hydroxysteroids requires the action of HSD17B. Of a number of HSD17B isoforms, HSD17B4 is responsible for the inactivation of estradiol and androstene-3β, 17β-diol into estrone and dehydroepiandrosterone, respectively (Labrie et al, 1997). In the pig testis, HSD17B4 is localized in Leydig cells and predominantly directs the oxidation of estradiol to estrone (De Launoit and Adamski, 1999). High plasma estrone concentrations have been measured in boars during neonatal development (Claus and Hoffmann, 1980; Ford, 1983). In the present study, the lowest level of HSD17B4 mRNA in the pig testis during the early neonatal period was detected at 0 weeks of age, whereas the highest level of HSD17B4 protein was found at the same age. These data indicate the existence of posttranscriptional regulation of HSD17B4 expression. Even though the present study showed lower levels of HSD17B4 protein between 1 and 3 weeks of age compared with that at 0 weeks of age, it is speculated that overall HSD17B4 protein levels would remarkably increase because of apparent increases of Leydig cell volume and density during the neonatal period (van Straaten and Wensing, 1978; França et al, 2000). An unexpected finding was the alternation in HSD17B4 localization in the pig testis at 4 months of age. A strong immunoreactivity of HSD17B4 was localized on the BTB at 4 months of age, whereas only Leydig cells were immunopositive for HSD17B4 during early neonatal development. The role of HSD17B4 on the BTB is not currently known. Booth (1983) showed the stimulatory effect of estrone on the development of male characteristics in the boar. Entry of steroid hormones such as testosterone and dehydroepiandrosterone into rete testis fluid through the BTB has been demonstrated in rats (Cooper and Waites, 1975). Rete testis fluid in the boar testis contains a significant concentration of estrogens (Setchell et al, 1983). Thus, it is presumed that HSD17B4 on the BTB would play a role in the accumulation of estrone in rete testis fluid through the active conversion of estradiol synthesized from Leydig cells. Another possible role of HSD17B4 on the BTB would be a stimulatory effect on spermatogenesis and/or Sertoli cell proliferation by estrone. Additional investigation should be conducted to resolve the role of HSD17B4 on BTB in the pig testis.

The synthesis of androgens from a cholesterol precursor requires a number of steroidogenic enzymes, including CYP11A1, CYP17A, and HSD3B. The CYP11A1 is the rate-limiting enzyme for steroidogenesis and converts cholesterol into pregnenolone, which is then metabolized into progesterone by the action of HSD3B. The CYP17A is a pivotal enzyme that converts pregnenolone or progesterone to 17-hydroxypregnenolone or 17-hydroxyprogesterone, respectively. These 2 intermediates serve as precursors for androstenedione that is further converted into testosterone by the action of HSD17B. The expression and localization of these 3 enzymes in the pig testis have been demonstrated from the findings of other studies (Suzuki et al, 1992; Clark et al, 1996; Moran et al, 2002; Weng et al, 2005). Androstenone, dehydroepiandrosterone, and testosterone are types of androgens that are found in pig plasma at relatively high levels (Sinclair et al, 2001). The initial peaks in plasma androgen concentrations are seen within the first month after birth during postnatal development (Sinclair et al, 2001), which implies a requirement for marked increases of gene expression for CYP11A1, CYP17A, and HSD3B. In fact, the present study showed significant increases of mRNA levels of these enzymes between 1 and 3 weeks of age. However, protein levels during early neonatal development were lower or equivalent to those at 0 weeks of age. The discordance between the mRNA and protein expressions of these enzymes implies the existence of posttranscriptional modulation on gene expression during early neonatal development. In addition, we could not rule out the possibility of posttranslational regulation, leading to the enhancement of enzyme activities during neonatal development. Immunohistochemical analysis revealed the primary localization of CYP11A1, CYP17A, and HSD3B in Leydig cells, regardless of age. Interestingly, we also found a positive immunoreaction of CYP11A1 in germ cells of the prepubertal pig testis. Moreover, positive immunoreactivity of HSD3B was found not only in Leydig cells, but also in Sertoli cells in the neonatal testis and Sertoli cells and BTB in the prepubertal testis. Similar observations were made for CYP11A1 in the bear testis (Tsubota et al, 1993) and for HSD3B in the monkey testis (Liang et al, 1999). Such differential testicular expression would indicate distinguishable roles of steroidogenic enzymes in the pig testes during postnatal development. To our knowledge, the present study is the first report to demonstrate the differential localization of CYP11A1 and HSD3B in the domestic pig testis. Further examinations are needed to determine the functional roles of steroidogenic enzymes in different cell types of the pig testis.

In the present study, we examined the expression and presence of 2 metabolic enzymes, ALR2 and CBR1. ALR2 is a member of the aldo-keto reductase superfamily, whereas CBR1 is a member of the short-chain dehydrogenase/reductase superfamily (Hoffmann and Maser, 2007). Both of these enzymes share a common characteristic: NADPH-dependent reduction. Porcine testicular CBR catalyzes the reduction of ketones on androgens and progesterone (Tanaka et al, 1992). The CBR1 is expressed and localized only in Leydig cells of the neonatal pig testis (Kobayashi et al, 2002), and this is in agreement with our present finding. The expression of CBR1 mRNA and protein during early neonatal development increases according to age, and shows a transient decrease at 4 months of age. Similar findings on CBR1 mRNA expression and activity in the neonatal pig testes have been demonstrated in previous studies (Ohno et al, 1992; Tanaka et al, 1992). It is believed that CBR1 is responsible for the conversion of 17α-hydroxyprogesterone to 17α,20β-dihydroxy-4-pregnen-3-one, which is present in the neonatal pig testis (Ghosh et al, 2001). The CBR has 2 distinct activities, 20β-HSD (Tanaka et al, 1992) and 3α- and 3β-HSDs (Ohno et al, 1992), thus implying a diverse role in the metabolism of steroid hormones. Thus, it is speculated that multifunctional actions of CBR1 in the pig testis would play an important role in metabolic reactions of steroid hormones synthesized in Leydig cells, eventually leading to adequate testicular function during early neonatal development. The expression and localization of ALR2 in the domestic boar testis have not yet been determined. It has been demonstrated that progesterone is a substrate for the reducing activity of ALR2 with 20α-HSD activity (Warren et al, 1993). The present study demonstrates immunolocalization of ALR2 in Leydig and Sertoli cells of the pig testes. In the rat testis, ALR2 is exclusively present in Sertoli and spermatogenic cells (Kobayashi et al, 2002), suggesting species-specific cellular expression of ALR2 in the testis. The functional role of ALR2 in the pig testis is not understood at this point. However, significant increases of mRNA and protein levels during early neonatal development indicate that ALR2 would be involved in the metabolism of steroid hormones in pig testes following exposure to high concentrations of steroid hormones. In fact, Kobayashi et al (2002) suggested a potential role of ALR2 on the reduction of steroid hormones in the rat testis. Detailed information for a role of ALR2 in the pig testis should be addressed in future studies.

A number of investigations have shown a correlation between the remarkable increase of the Leydig cell number and size and steroidogenic activity in the pig testis during the first month after birth (França et al, 2000; Herrera et al, 1983; Schwarzenberger et al, 1993; van Straaten and Wensing, 1978). In addition, van Straaten and Wensing (1977) reported that a marked increase of the volume percentage of the Leydig cells in the pig testis reaches the highest value at 3 weeks of age after the birth. These findings imply that a proportional increase of the Leydig cells relative to the testicular interstitium and STs would contribute to enhanced expression of steroidogenic enzymes in the pig testis during the early neonatal period. In pigs, the total body weight shows an almost 10-fold increase, with maximal growth in the skeletal muscle, during the first month of birth (Sarkar et al, 1977). As stated earlier, nandrolone, an androgen having 10 times higher anabolic activity than testosterone, is found at high concentrations in pigs during early neonatal development (Schwarzenberger et al, 1993). Thus, it is believed that anabolic steroid hormones synthesized from the pig testis may play a role in early postnatal development of pigs. In conclusion, the present study demonstrates that differential gene and protein expressions of various steroidogenic and steroid metabolism—related enzymes in the neonatal pig testes would contribute to the significant increases of plasma and testicular steroid hormone concentrations during early neonatal development, eventually leading to overall growth of the pig.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  • Booth WD. Development of some male characteristics supported by oestrone but not dehydroepiandrosterone in the boar. J Reprod Fertil. 1983;68: 916.
  • Carreau S., Levallet J.. Cytochrome P450 aromatase in male germ cells. Folia Histochem Cytobiol. 1997;35: 195202.
  • Choi NJ, Hyun JH, Choi JM, Lee EJ, Cho KH, Kim Y., Chang J., Chung IB, Chung CS, Choi I.. Testicular expression of steroidogenic enzyme genes is related to a transient increase in serum 19-nortestosterone during neonatal development in pigs. Asian Aust J Anim Sci. 2007;20: 18321842.
  • Christenson RK, Ford JJ, Redmer DA. Estradiol and testosterone metabolic clearance and production rates during pubertal development in boars. Biol Reprod. 1984;31: 905912.
  • Chuzel F., Clark AM, Avallet O., Saez JM. Transcriptional regulation of the lutropin/human choriogonadotropin receptor and three enzymes of steroidogenesis by growth factors in cultured pig Leydig cells. Eur J Biochem. 1996;239: 816.
  • Clark AM, Chuzel F., Sanchez P., Saez JM. Regulation by gonadotropins of the messenger ribonucleic acid for P450 side-chain cleavage, P450(17) alpha-hydroxylase/C17,20-lyase, and 3 beta-hydroxysteroid dehydrogenase in cultured pig Leydig cells. Biol Reprod. 1996;55: 347354.
  • Claus R., Hoffman B.. Oestrogens, compared to other steroids of testicular origin, in blood plasma of boars. Acta Endocrinol. 1980;94: 404411.
  • Colenbrander B., de Jong FH, Wensing CJ. Changes in serum testosterone concentrations in the male pig during development. J Reprod Fertil. 1978;53: 377380.
  • Conley AJ, Bird IM. The role of cytochrome P450 17 α-hydroxylase and 3β-hydroxysteroid dehydrogenase in the integration of gonadal and adrenal steroidogenesis via the δ5 and δ4 pathways of steroidogenesis in mammals. Biol Reprod. 1997;56: 789799.
  • Conley AJ, Corbin CJ, Hinshelwood MM, Liu Z., Simpson ER, Ford JJ, Harada N.. Functional aromatase expression in porcine adrenal gland and testis. Biol Reprod. 1996;54: 497505.
  • Conley AJ, Rainey WE, Mason JI. Ontogeny of steroidogenic enzyme expression in the porcine conceptus. J Mol Endocrinol. 1994;12: 155165.
  • Cooper TG, Waites GM. Steroid entry into rete testis fluid and the blood-testis barrier. J Endocrinol. 1975;65: 195205.
  • Corbin CJ, Trant JM, Walters KW, Conley AJ. Changes in testosterone metabolism associated with the evolution of placental and gonadal isozymes of porcine aromatase cytochrome P450. Endocrinology. 1999;140: 52025210.
  • de Brabander HF, van Hende J., Batjoens P., Hendriks L., Raus J., Smets F., Pottie G., van Ginkel L., Stephany RW. Endogenic nortestosterone in cattle? Analyst. 1994;119: 25812585.
  • de Launoit Y., Adamski J.. Unique multifunctional HSD17B4 gene product: 17β-hydroxysteroid dehydrogenase 4 and D-3-hydroxyacyl-coenzyme A dehydrogenase/hydratase involved in Zellweger syndrome. J Mol Endocrinol. 1999;22: 227240.
  • Ford JJ. Serum estrogen concentrations during postnatal development in male pigs. Proc Soc Exp Biol Med. 1983;174: 160164.
  • Fraczek B., Kotula-Balak M., Wojtusiak A., Pierściński A., Bilińska B.. Cytochrome P450 aromatase in the testis of immature and mature pigs. Reprod Biol. 2001;1: 5159.
  • França LR, Silva VA, Chiarini-Garcia H., Garcia SK, Debeljuk L.. Cell proliferation and hormonal changes during postnatal development of the testis in the pig. Biol Reprod. 2000;63: 16291636.
  • Ghosh D., Sawicki M., Pletnev V., Erman M., Ohno S., Nakajin S., Duax WL. Porcine carbonyl reductase: structural basis for a functional monomer in short chain dehydrogenases/reductases. J Biol Chem. 2001;276: 1845718463.
  • Haeussler S., Wagner A., Welter H., Claus R.. Changes of testicular aromatase expression during fetal development in male pigs (Sus scrofa). Reproduction. 2007;133: 323330.
  • Hall PF. Cytochrome P-450 C21scc: one enzyme with two actions: hydroxylase and lyase. J Steroid Biochem Mol Biol. 1991;40: 527532.
  • Herrera J., Sosa M., Ayala F., Galina C., Hernandez-Jauregui P., Bermudez JA. Morphophysiological correlation of boar Leydig cell development during postnatal stage. Cornell Vet. 1983;73: 6775.
  • Hoffmann F., Maser E.. Carbonyl reductases and pluripotent hydroxysteroid dehydrogenases of the short-chain dehydrogenase/reductase superfamily. Drug Metab Rev. 2007;39: 87144.
  • Kao YC, Higashiyama T., Sun X., Okubo T., Yarborough C., Choi I., Osawa Y., Simmen FA, Chen S.. Catalytic differences between porcine blastocyst and placental aromatase isozymes. Eur J Biochem. 2000;67: 61346139.
  • Kobayashi T., Kaneko T., Iuchi Y., Matsuki S., Takahashi M., Sasagawa I., Nakada T., Fujii J.. Localization and physiological implication of aldose reductase and sorbitol dehydrogenase in reproductive tracts and spermatozoa of male rats. J Androl. 2002;23: 674683.
  • Kuhn CM. Anabolic steroids. Recent Prog Horm Res. 2002;57: 2411434.
  • Labrie F., Luu-The V., Lin SX, Labrie C., Simard J., Breton R., Bélanger A.. The key role of 17β-hydroxysteroid dehydrogenases in sex steroid biology. Steroids. 1997;62: 148158.
  • Lejeune H., Sanchez P., Chuzel F., Langlois D., Saez JM. Time-course effects of human recombinant luteinzing hormone on porcine Leydig cell specific differentiated functions. Mol Cell Endocrinol. 1998;144: 5969.
  • Liang JH, Sankai T., Yoshida T., Cho F., Yoshikawa Y.. Localization of immunoreactive testosterone and 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase in cynomolgus monkey (Macaca fascicularis) testis during postnatal development. J Med Primatol. 1999;28: 6266.
  • Mayer HH, Falchenberg D., Janowski T., Rapp M., Rösel FF, van Look L., Karg H.. Evidence for the presence of endogenous 19-nortestosterone in the cow peripartum and in the neonatal calf. Acta Endocrinol (Copenh). 1992;126: 369373.
  • Moran FM, Ford JJ, Corbin CJ, Mapes SM, Njar VC, Brodie AM, Conley AJ. Regulation of microsomal P450, redox partner proteins, and steroidogenesis in the developing testes of the neonatal pig. Endocrinology. 2002;143: 33613369.
  • Mutembei HM, Pesch S., Schuler G., Hoffmann B.. Expression of oestrogen receptors alpha and beta and of aromatase in the testis of immature and mature boars. Reprod Domest Anim. 2005;40: 2228236.
  • Ohno S., Nakajin S., Shinoda M.. Ontogeny of testicular steroid dehydrogenase enzymes in pig (3 alpha/beta-,20 alpha- and 20 beta-): evidence for two forms of 3 alpha/beta-hydroxysteroid dehydrogenase. J Steroid Biochem Mol Biol. 1992;42: 1721.
  • Parma P., Pailhoux E., Cotinot C.. Reverse transcription-polymerase chain analysis of genes involved in gonadal differentiation in pigs. Biol Reprod. 1999;61: 741748.
  • Sarkar NK, Lodge GA, Friend DW. Hyperplasic and hypertrophic growth in organs and tissues of the neonatal pig. J Anim Sci. 1977;45: 722728.
  • Sasano H., Mason JI, Sasano N.. Immunohistochemical analysis of cytochrome P-450 17α-hydroxylase in pig adrenal cortex, testis and ovary. Mol Cell Endocrinol. 1989;62: 197202.
  • Schwarzenberger F., Toole GS, Christie HL, Raeside JI. Plasma levels of several androgens and estrogens from birth to puberty in male domestic pigs. Acta Endocrinol (Copenh). 1993;128: 173177.
  • Setchell BP, Laurie MS, Flint AP, Heap RB. Transport of free and conjugated steroids from the boar testis in lymph, venous blood and rete testis fluid. J Endocrinol. 1983;96: 127136.
  • Sinclair PA, Squires EJ, Raeside JI, Britt JH, Hedgpeth VG. The effect of early postnatal treatment with a gonadotropin-releasing hormone agonist on the developmental profiles of testicular steroid hormones in the intact male pig. J Anim Sci. 2001;79: 10031010.
  • Sterk S., Herbold H., Blokland M., van Rossum H., van Ginkel L., Stephany R.. Nortestosterone: endogenous in urine of goats, sheep and mares? Analyst. 1998;123: 26332636.
  • Suzuki T., Sasano H., Sawai T., Mason JI, Nagura H.. Immunohistochemistry and in situ hybridization of P-45017α(17α-hydroxylase/17,20-lyase). J Histochem Cytochem. 1992;40: 903908.
  • Tanaka M., Ohno S., Adachi S., Nakajin S., Shinoda M., Nagahama Y.. Pig testicular 20 beta-hydroxysteroid dehydrogenase exhibits carbonyl reductase-like structure and activity. cDNA cloning of pig testicular 20beta-hydroxysteroid dehydrogenase. J Biol Chem. 1992;267: 1345113455.
  • Tsubota T., Nitta H., Osawa Y., Mason JI, Kita I., Tiba T., Bahr JM. Immunolocalization of steroidogenic enzymes, P450scc, 3betaHSD, P450c17, and P450arom in the Hokkaido brown bear (Ursus arctos yesoensis) testis. Gen Comp Endocrinol. 1993;92: 439444.
  • van Straaten HWM, Wensing CJG. Histomorphometric aspects of testicular morphogenesis in the pig. Biol Reprod. 1977;17: 467472.
  • van Straaten HWM, Wensing CJG. Leydig cell development in the testis of the pig. Biol Reprod. 1978;18: 8693.
  • Warren JC, Murdock GL, Ma Y., Goodman SR, Zimmer WE. Molecular cloning of testicular 20 α-hydroxysteroid dehydrogenase: identity with aldose reductase. Biochemistry. 1993;32: 423426.
  • Weng Q., Medan MS, Watanabe G., Tsubota T., Tanioka Y., Taya K.. Immunolocalization of steroidogenic enzymes P450scc, 3betaHSD, P450c17, in Göttingen miniature pig testes. J Reprod Dev. 2005;51: 299304.
Footnotes
  1. Supported by a grant from the Biogreen 21 program (20050401-034-712), Rural Development Administration, Republic of Korea.