Photochemistry and Photobiology

Cover image for Vol. 90 Issue 6

Early View (Online Version of Record published before inclusion in an issue)

Edited By: Jean Cadet

Impact Factor: 2.684

ISI Journal Citation Reports © Ranking: 2013: 36/74 (Biophysics); 161/291 (Biochemistry & Molecular Biology)

Online ISSN: 1751-1097

VIEW

  1. 1 - 46
  1. Special Issue Research Articles

    1. Regulation and Disregulation of Mammalian Nucleotide Excision Repair: A Pathway to Nongermline Breast Carcinogenesis

      Jean J. Latimer, Vongai J. Majekwana, Yashira R. Pabón-Padín, Manasi R. Pimpley and Stephen G. Grant

      Article first published online: 19 DEC 2014 | DOI: 10.1111/php.12387

      Thumbnail image of graphical abstract

      We have shown profound variation in NER (Nucleotide Excision Repair) capacity in humans, between cell-types and during carcinogenesis. As NER is intimately related to both replication and transcription, it shows a narrow range of functional viability. NER activity and gene expression are epigenetically regulated, although this epigenetic modulation is disregulated during sporadic breast carcinogenesis. We now demonstrate differences in NER capacity in eight adult mouse tissues, including a complete lack of activity in brain, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.

  2. Research Articles

    1. Photophysics of Acetophenone Interacting with DNA: Why the Road to Photosensitization is Open

      Miquel Huix-Rotllant, Elise Dumont, Nicolas Ferré and Antonio Monari

      Article first published online: 16 DEC 2014 | DOI: 10.1111/php.12395

      Thumbnail image of graphical abstract

      Using a combination of Molecular Dynamics and QM/MM modeling we have characterized stable interaction modes between acetophenone and DNA. The effects of the macromolecular environment on the acetophenone photophysics have been elucidated, confirming that it is still able to efficiently photosensitize DNA by energy transfer from triplet state. In particular this is due to the maintaining of the quasidegenerescence between the first two acetophenone triplet states that are moreover characterized by a high spin-orbit coupling with the ground state. Our work gives important insights in the triplet sensitization mechanism and on the effect of the environment.

  3. Invited Reviews

    1. You have free access to this content
      Recent Advances in the Application of Chlorophyll a Fluorescence from Photosystem II

      Ya Guo and Jinglu Tan

      Article first published online: 16 DEC 2014 | DOI: 10.1111/php.12362

      Thumbnail image of graphical abstract

      This review summarizes the literature on the applications of chlorophyll a fluorescence from photosystem II of plants published in the latest 10 years. Areas of application covered include: (1) plant senescence, damage, virus and diseases; (2) nutrient status; (3) salt stress; (4) chilling stress; (5) heat stress; (6) herbicides; (7) metal pollution; (8) aquatic ecosystems; (9) drought stress and (10) selection of stress-resistant species.

  4. Special Issue Invited Reviews

    1. You have free access to this content
      MicroRNAs and Photocarcinogenesis

      Rahul K. Lall, Hasan Mukhtar and Deeba N. Syed

      Article first published online: 16 DEC 2014 | DOI: 10.1111/php.12346

      Thumbnail image of graphical abstract

      The modulation of gene expression in UV exposed human skin under the regulatory control of small noncoding miRNAs adds an additional layer of complexity to the process of skin carcinogenesis. An in-depth knowledge of the functionality of miRNAs in the human skin will have enormous implications to risk assessment, and to target interventions against signaling events involved in photocarcinogenesis.

  5. Invited Reviews

    1. You have free access to this content
      Light-Regulated MicroRNAs

      Ashika Jayanthy and Vijayasaradhi Setaluri

      Article first published online: 11 DEC 2014 | DOI: 10.1111/php.12386

      Thumbnail image of graphical abstract

      Exposure to different types of electromagnetic radiation is sensed by cells through various light-absorbing molecules such as opsins, cryptochromes and DNA. Activation of specific second messengers and signaling pathways lead to changes in expression of several genes including microRNAs (miRNA) and miRNA processing enzymes. Altered levels of miRNAs produce pleotropic effects by fine-tuning cellular levels of multitude of mRNAs leading to manifestation of EM radiation-induced phenotypes.

    2. You have free access to this content
      Beyond Xeroderma Pigmentosum: DNA Damage and Repair in an Ecological Context. A Tribute to James E. Cleaver

      Deneb Karentz

      Article first published online: 11 DEC 2014 | DOI: 10.1111/php.12388

      Thumbnail image of graphical abstract

      Sunlight is one of the most ubiquitous hazards for life on Earth. Although some aspects of solar radiation are beneficial (e.g. photosynthesis, vision, vitamin D synthesis), the ultraviolet B (UVB) component causes substantial damage to DNA resulting in debilitating and lethal effects. All organisms are capable of repairing DNA photoproducts and repair pathways are remarkably similar. While DNA repair research often focuses on human diseases and the development of cancer; solar DNA damage is also an important component of ecosystem health and stability. This review provides an overview of DNA repair in non-mammalian taxa relative to ambient UVB stress.

  6. Research Articles

    1. The Efficient Photocatalytic Degradation of Methyl Tert-butyl Ether Under Pd/ZnO and Visible Light Irradiation

      Zaki S. Seddigi, Saleh A. Ahmed, Ali Bumajdad, Ekram Y. Danish, Ahmed M. Shawky, Mohammed A. Gondal and Mustafa Soylak

      Article first published online: 11 DEC 2014 | DOI: 10.1111/php.12391

      Thumbnail image of graphical abstract

      The photocatalytic degradation of aqueous MTBE solution was studied using zinc oxide as a photocatalyst. Complete MTBE removal was achieved within 9 h under visible light irradiation using ZnO particles. MTBE removal is attributed to the visible light excitation of the photocatalyst resulting in the generation of photoexcited electron/hole pairs. This method can be considered as an efficient and complete removal system of MTBE from water.

    2. Minimum Exposure Limits and Measured Relationships Between the Vitamin D, Erythema and International Commission on Non-Ionizing Radiation Protection Solar Ultraviolet

      Nathan Downs, Alfio Parisi, Harry Butler, Joanna Turner and Lisa Wainwright

      Article first published online: 11 DEC 2014 | DOI: 10.1111/php.12394

      Thumbnail image of graphical abstract

      The relationship between vitamin D dose and the International Commission on Non-Ionizing Radiation Protection (ICNIRP) UV exposure is studied from measurements made in Southern Queensland, Australia. The measurements take into account all weather and atmospheric conditions including a major continental dust storm event (NASA MODIS Terra image, 23 September 2009). Personal minimum exposure guidelines for the optimal production of vitamin D are presented for each of the internationally recognized UV index ranges relative to the received ICNIRP exposure. The measured data show that the healthy production of vitamin D can be maintained at subtropical latitude without exceeding ICNIRP exposure guidelines.

    3. Ultraviolet Index and Location are Important Determinants of Vitamin D Status in People with Human Immunodeficiency Virus

      Karen M. Klassen, Christopher K. Fairley, Michael G. Kimlin, Mark Kelly, Tim R.H. Read, Jennifer Broom, Darren B. Russell and Peter R. Ebeling

      Article first published online: 9 DEC 2014 | DOI: 10.1111/php.12390

      Thumbnail image of graphical abstract

      Low vitamin D is commonly found in people with HIV. This figure presents the unadjusted proportions of people with 25(OH)D <75 nmol L−1 grouped by UV index categories and the four different study locations in Australia [Cairns (latitude 17°S), Nambour (27°S), Brisbane (28°S) and Melbourne (38°S)]. In this study, we describe these and other factors contributing to serum 25(OH)D levels in people with HIV in Australia. Antiretroviral therapy was also associated with 25(OH)D <75 nmol L−1 which appeared to be modified by cholesterol and warrants further exploration in future studies.

  7. Special Issue Research Articles

    1. Transition from Charge-Transfer to Largely Locally Excited Exciplexes, from Structureless to Vibrationally Structured Emissions

      Ralph H. Young, Adam M. Feinberg, Joseph P. Dinnocenzo and Samir Farid

      Article first published online: 8 DEC 2014 | DOI: 10.1111/php.12380

      Thumbnail image of graphical abstract

      Exciplexes of 9,10-dicyanoanthracene with low oxidation potential (Eox) alkylbenzenes in cyclohexane show structureless emission spectra suggesting ideal charge-transfer (CT) states. With higher Eox donors, vibrational structure emerges. A theoretical model of mixing with a locally excited (LE) state reproduces the spectra and radiative rate constants. The fractional CT character of a highly mixed exciplex varies widely with fluctuations in the microscopic environment and/or librational geometry. Fluctuations favoring the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. The “ideal CT” appearance of the low-Eox spectra is illusory, resulting instead from several compensating factors.

  8. Special Issue Invited Reviews

    1. You have free access to this content
      Vitamin D and Skin Cancer

      Erin M. Burns, Craig A. Elmets and Nabiha Yusuf

      Article first published online: 8 DEC 2014 | DOI: 10.1111/php.12382

      Thumbnail image of graphical abstract

      Vitamin D production and supplementation have been shown to exert protective effects in several diseases and cancers, including skin cancer. While ultraviolet B (UVB) radiation is the main etiologic factor for skin cancer, UVB also induces cutaneous vitamin D production. This paradox has been the subject of contradictory findings in the literature in regards to amount of sun exposure necessary for appropriate vitamin D production, as well as any beneficial or detrimental effects of vitamin D supplementation for disease prevention. Further clinical and epidemiological studies are necessary to elucidate the role of vitamin D in skin carcinogenesis.

  9. Erratum

    1. You have free access to this content
  10. Research Articles

    1. In Vitro Photodynamic Inactivation Effects of Ru(II) Complexes on Clinical Methicillin-resistant Staphylococcus aureus Planktonic and Biofilm Cultures

      Yucheng Wang, Qianxiong Zhou, Ying Wang, Jie Ren, Hongyou Zhao, Sumin Wu, Jiyong Yang, Jie Zhen, Yanping Luo, Xuesong Wang and Ying Gu

      Article first published online: 5 DEC 2014 | DOI: 10.1111/php.12378

      Thumbnail image of graphical abstract

      Photodynamic inactivation (PDI) is a compelling alternative treatment for infections, especially those caused by multidrug-resistant bacteria. In this study, a novel class of cationic photosensitizers, Ru(II) complexes, has been tested in their PDI effects against clinical methicillin-resistant Staphylococcus aureus (MRSA) strains, both in planktonic and biofilm cultures. Mechanisms of the PDI process were also investigated. It was demonstrated that PDI of planktonic bacteria was achieved primarily through damage to the cell envelope. Biofilms were eliminated through both the destruction of their structure and inactivation of the individual bacteria.

    2. Combination of Er:YAG Laser and CO2 Laser Treatment on Skin Tissue

      Sana Mohammed Anayb Baleg, Noriah Bidin, Lau Pik Suan, Muhammad Fakarruddin Sidi Ahmad, Ganesan Krishnan, Abd Rahman Johari and Asmah Hamid

      Article first published online: 5 DEC 2014 | DOI: 10.1111/php.12369

      Thumbnail image of graphical abstract

      The skin is an important body-organ, protecting us from external environmental effects. Studies concerning the ability of skin to stretch and histological examinations of irradiated tissues have significant values for scientific and medical applications. Only few studies have been done to study the correlation between epidermis ablation and the changes that occur at dermal levels when using dual lasers in ablative resurfacing mode. The aim of this work is to determine this correlation and to estimate the effects of multiple pulses on induced collagen remodeling and the strength of skin exposed to dual lasers in an in vivo rat model.

    3. ß-Ga2O3 Nanorod Synthesis with a One-step Microwave Irradiation Hydrothermal Method and its Efficient Photocatalytic Degradation for Perfluorooctanoic Acid

      Baoxiu Zhao, Xiang Li, Long Yang, Fen Wang, Jincheng Li, Wenxiang Xia, Weijiang Li, Li Zhou and Colin Zhao

      Article first published online: 5 DEC 2014 | DOI: 10.1111/php.12383

      Thumbnail image of graphical abstract

      ß-Ga2O3 was first synthesized via the microwave irradiation hydrothermal way and then was used to degrade PFOA under the UV light. Decomposition procedure involved the adsorption of PFOA on the surface of ß-Ga2O3 and the degradation. ß-Ga2O3 prepared by the microwave irradiation hydrothermal method owned the powerful photocatalytic degradation performance for PFOA and degradation kinetics constant was 0.0425 min−1.

  11. Invited Reviews

    1. You have free access to this content
      UV Signature Mutations

      Douglas E. Brash

      Article first published online: 28 NOV 2014 | DOI: 10.1111/php.12377

      Thumbnail image of graphical abstract

      Inverse relationship of canonical mutation patterns and mutation signatures for inferring the mutagen from mutations. Two mutagens are illustrated. A mutagen's canonical mutations deviate from random base changes, establishing a pattern typical for that mutagen. Different mutagens can produce the same canonical mutations (non-informative mutations). Signature mutations are the subset of canonical mutations that, in addition, are unique to that mutagen and permit inference backward from mutations to mutagen. A mutagen therefore produces signature mutations plus non-informative mutations. The latter are real and are produced by the mutagen, but are not useful for identifying that mutagen or carcinogen.

  12. Special Issue Research Articles

    1. Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study

      Pascale Changenet-Barret, Ying Hua, Thomas Gustavsson and Dimitra Markovitsi

      Article first published online: 28 NOV 2014 | DOI: 10.1111/php.12379

      Thumbnail image of graphical abstract

      G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K+ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.

    2. Following Oxygen Consumption in Singlet Oxygen Reactions via Changes in Sensitizer Phosphorescence

      Tingting Feng, Tod A. Grusenmeyer, Max Lupin and Russell H. Schmehl

      Article first published online: 28 NOV 2014 | DOI: 10.1111/php.12381

      Thumbnail image of graphical abstract

      Photolysis of a Ruthenium-pyrene complex in oxygenated aqueous solutions results in efficient sensitization of singlet oxygen. In the presence of substrates, large increases in the orange luminescence of the Ruthenium-pyrene complex are observed as dissolved oxygen reacts with the substrate. Luminescence intensity changes allow determination of rate constants for singlet oxygen reaction with substrates.

  13. Special Issue Invited Reviews

    1. You have free access to this content
      Oxidatively Generated Damage to Cellular DNA by UVB and UVA Radiation

      Jean Cadet, Thierry Douki and Jean-Luc Ravanat

      Article first published online: 27 NOV 2014 | DOI: 10.1111/php.12368

      Thumbnail image of graphical abstract

      UVA predominantly generates singlet oxygen that selectively oxidize guanine leading to 8-oxo-7,8-dihydroguanine. Superoxide anion radical (inline image) is also produced as the precursor of H2O2 and subsequently of highly reactive hydroxyl radical (OH) that induces oxidized bases and single-strand breaks. Both UVA and UVB are able to trigger delayed biochemical responses including activation of enzymes, inflammation and bystander effects. As a result inline image and nitric oxide are released leading to the formation of OH and peroxynitrite. The latter species is expected through reaction with CO2 to produce the carbonate anion radical, an efficient one-electron oxidant of guanine.

  14. Special Issue Research Articles

    1. Interspecific Variation in the Repair of UV Damaged DNA in the Genus Xiphophorus as a Factor in the Decline of the Rio Grande Platyfish

      David Mitchell, Lakshmi Paniker, Kevin Lin and André Fernandez

      Article first published online: 25 NOV 2014 | DOI: 10.1111/php.12358

      Thumbnail image of graphical abstract

      Geographical distribution of 26 species of the genus Xiphophorus with three northern species is highlighted. The three species comprising the Rio Grande Platyfish are the only Xiphophorus listed on the IUCN Red List of Threatened Species and this clade as a whole displays significantly reduced DNA repair compared to the other species in the genus.

  15. Special Issue Research Article

    1. Effective Photoprotection of Human Skin against Infrared A Radiation by Topically Applied Antioxidants: Results from a Vehicle Controlled, Double-Blind, Randomized Study

      Susanne Grether-Beck, Alessandra Marini, Thomas Jaenicke and Jean Krutmann

      Article first published online: 24 NOV 2014 | DOI: 10.1111/php.12375

      Thumbnail image of graphical abstract

      Topical application of an SPF30 sunscreen containing an antioxidant mixture consisting of grape seed extract, vitamin E, ubiquinone and vitamin C significantly protects human skin (n = 30) against IRA radiation-induced MMP-1 mRNA expression.

  16. Special Issue Research Articles

    1. o-Amino Analogs of Green Fluorescence Protein Chromophore: Photoisomerization, Photodimerization and Aggregation-induced Emission

      Guan-Jhih Huang, Che-Jen Lin, Yi-Hung Liu, Shie-Ming Peng and Jye-Shane Yang

      Article first published online: 24 NOV 2014 | DOI: 10.1111/php.12373

      Thumbnail image of graphical abstract

      The GFP-like chromophore O0 undergoes solid-state [2 + 2] photodimerization to form a head-to-tail syn-oriented photodimer OD that is confirmed by X-ray crystallography. The excited-state “meta-ortho effect” of the amino analogs of GFP chromophore in solutions and aggregates is also established and discussed.

  17. Research Articles

    1. Synthesis, Structure and Photophysical Properties of Ferrocenyl or Mixed Sandwich Cobaltocenyl Ester Linked meso-Tetratolylporphyrin Dyads

      Sabapathi Gokulnath, Balahoju Shivaprasad Achary, Chakka Kiran Kumar, Rajiv Trivedi, Balasubramanian Sridhar and Lingamallu Giribabu

      Article first published online: 24 NOV 2014 | DOI: 10.1111/php.12372

      Thumbnail image of graphical abstract

      We have designed two new porphyrin–metallocene dyads, in which either ferrocene or mixed cobaltocenyl connected at meso position of porphyrin through ester linkage. Ground-state properties showed that there exists minimum π−π interactions between porphyrin and metallocene. Singlet state properties reveal that there is a photoinduced electron transfer from metallocene to singlet state of porphyrin.

    2. You have full text access to this OnlineOpen article
      DNA Damage Checkpoint Responses in the S Phase of Synchronized Diploid Human Fibroblasts

      Paul D. Chastain II, Bruna P. Brylawski, Yingchun C. Zhou, Shangbang Rao, Haitao Chu, Joseph G. Ibrahim, William K. Kaufmann and Marila Cordeiro-Stone

      Article first published online: 24 NOV 2014 | DOI: 10.1111/php.12361

      Thumbnail image of graphical abstract

      When cells are exposed to UV, the ATR-Chk1-Cdc7-Dbf4 arm of the intra-S checkpoint is activated. In early and mid S, the checkpoint response is robust and DNA origin initiation is inhibited. However, this DNA damage effect is not seen in late-S phase cells.

    3. In Situ FTIR Spectroscopy Study of the Photodegradation of Acetaldehyde and azo Dye Photobleaching on Bismuth-Modified TiO2

      Jiří Henych, Václav Štengl, Andreas Mattsson and Lars Österlund

      Article first published online: 21 NOV 2014 | DOI: 10.1111/php.12374

      Thumbnail image of graphical abstract

      The low-temperature process avoiding organometallic precursors and nonwater solvents was employed to produce Bi-doped titania nanoparticles. This method proceeds via peroxotitanium complexes and can be easily used for solution doping. Acetaldehyde adsorption and its photoinduced degradation was observed by in situ FTIR spectroscopy and revealed different photocatalytic behavior of doped samples compared to pure TiO2.

  18. Special Issue Research Articles

    1. Photoisomerization of cis-1,2-di(1-Methyl-2-naphthyl)ethene at 77 K in Glassy Media

      Christopher Redwood, V. K. Ratheesh Kumar, Stuart Hutchinson, Frank B. Mallory, Clelia W. Mallory, Ronald J. Clark, Olga Dmitrenko and Jack Saltiel

      Article first published online: 21 NOV 2014 | DOI: 10.1111/php.12367

      Thumbnail image of graphical abstract

      One bond twist photoisomerization of cis-I,2-di(1-methyl-2-naphthyl)ethene in glassy media.

  19. Research Articles

    1. Analysis of Oxyluciferin Photoluminescence Pathways in Aqueous Solutions

      Miyabi Hiyama, Toshimitsu Mochizuki, Hidefumi Akiyama and Nobuaki Koga

      Article first published online: 17 NOV 2014 | DOI: 10.1111/php.12370

      Thumbnail image of graphical abstract

      The pathways for photoluminescence of oxyluciferin, which is well known as the emitter of firefly bioluminescence, in aqueous solutions of different pH values were theoretically investigated by estimating free energies of possible species with consideration of protonation/deprotonation.

    2. You have full text access to this OnlineOpen article
      Opsin Expression in Human Epidermal Skin

      Kirk Haltaufderhyde, Rana N. Ozdeslik, Nadine L. Wicks, Julia A. Najera and Elena Oancea

      Article first published online: 13 NOV 2014 | DOI: 10.1111/php.12354

      Thumbnail image of graphical abstract

      Human epidermal skin is exposed to a wide range of light wavelengths, raising the question whether it uses opsins, light-activated receptors that mediate photoreception in the eye, as photosensors. We found that the two major human epidermal cell types, melanocytes and keratinocytes, express mRNA for four opsins—OPN1-SW, OPN2, OPN3 and OPN5. OPN2 and OPN3 mRNA were significantly more abundant than other opsins and encoded full-length proteins. Future studies will determine the function of these opsins in melanocytes and keratinocytes.

    3. N4-Methylation of Cytosine Drastically Favors the Formation of (6-4) Photoproducts in a TCG Context

      Thierry Douki, Jarah A. Meador, Izabel Bérard and Aude Wack

      Article first published online: 10 NOV 2014 | DOI: 10.1111/php.12365

      Thumbnail image of graphical abstract

      Methylation of cytosine at position C5 is known to favor the formation of UVB-induced cyclobutane pyrimidine dimers in DNA. We report here that methylation at another position, namely the N4 exocyclic amino group, enhances the photoreactivity of cytosine both in the UVB and UVC range, and drastically increases the formation of (6-4) photoproducts.

    4. Solar UV Irradiances Modulate Effects of Ocean Acidification on the Coccolithophorid Emiliania huxleyi

      Kai Xu and Kunshan Gao

      Article first published online: 10 NOV 2014 | DOI: 10.1111/php.12363

      Thumbnail image of graphical abstract

      The coccolithophorid Emiliania huxleyi may be calcifying less with progressive ocean acidification (OA). However, little is known about the physiological responses of E. huxleyi to OA under the natural solar irradiances, including UV radiation (280–400 nm, UVR). We found UVR could modulate the effects of OA on growth, photosynthesis, and calcification of E. huxleyi. This work emphasizes that UVR needs to be considered as a key factor when evaluating the impacts of OA on E. huxleyi.

  20. Invited Reviews

    1. You have free access to this content
      Oculocutaneous Albinism in Sub-Saharan Africa: Adverse Sun-Associated Health Effects and Photoprotection

      Caradee Y. Wright, Mary Norval and Richard W. Hertle

      Article first published online: 8 NOV 2014 | DOI: 10.1111/php.12359

      Thumbnail image of graphical abstract

      Oculocutaneous albinism (OCA) is a genetically inherited autosomal recessive condition. Individuals with OCA lack melanin and therefore are susceptible to the harmful effects of solar ultraviolet radiation, including extreme sun sensitivity, photophobia and skin cancer. OCA is a grave public health issue in sub-Saharan Africa with a prevalence as high as one in 1000 in some tribes. Given the extent of adverse sun-related health effects experienced among individuals with OCA, commitment to prevention and treatment regimens should be raised as a priority to curb the impact of OCA as a major health problem in sub-Saharan Africa.

    2. You have free access to this content
      UVA Irradiation Induced Heme Oxygenase-1: A Novel Phototherapy for Morphea

      Muhammad Farrukh Nisar, Kimberly Suzanne George Parsons, Chun Xiang Bian and Julia Li Zhong

      Article first published online: 8 NOV 2014 | DOI: 10.1111/php.12342

      Thumbnail image of graphical abstract

      The possible mechanism of UVA1-induced antifibrotic HO-1 and MMP-1 expressions in UVA1 phototherapy of morphea. Regulation of HMOX-1 gene upon UVA irradiation in human skin cells to induce cytoprotection: UVA1-induced ROS activation of Nrf2 and release of Keap1 for ubiquitination, translocation of Nrf2 to the nucleus to switch on the ARE‘s to evoke HO-1 expression. UVA1 generated ROS lead to the MMP-1 expression directly via ERK, TNFα, IL-1, and IL-6, or indirectly through HO-1 expression. Both antifibrotic effects of MMP-1 and HO-1 may, through TGFβ1, rebuild the ECM.

  21. Special Issue Research Articles

    1. Comparison of Templating Abilities of Urea and Thioruea During Photodimerization of Bipyridylethyelene and Stilbazole Crystals

      Balakrishna R. Bhogala, Burjor Captain and Vaidhyanathan Ramamurthy

      Article first published online: 7 NOV 2014 | DOI: 10.1111/php.12353

      Thumbnail image of graphical abstract

      Templating properties of urea in solid-state photodimerization of stilbazoles and bispyridylethylenes have been established through a study that combined photochemistry and X-ray crystallography. The templating ability of urea derives from its ability to form hydrogen bond with itself and with coguests stilbazoles and bispyridylethylenes. At this stage, it is not easy to predict when urea will and when will not function as a template.

  22. Invited Reviews

    1. You have free access to this content
      MC1R, Eumelanin and Pheomelanin: Their Role in Determining the Susceptibility to Skin Cancer

      Tahseen H. Nasti and Laura Timares

      Article first published online: 7 NOV 2014 | DOI: 10.1111/php.12335

      Thumbnail image of graphical abstract

      Animal models indicate that the presence of pheomelanin is a required component for elaborating the increased melanoma risk in MCR1mutant mouse strains. This review examines the properties of pheomelanin and eumelanin with respect to the generation of toxic byproducts, depletion of scavenger pools, photoinstability and poor UVR absorption properties. Furthermore, a new understanding of MC1R function in cells of innate and adaptive immunity, suggests that the mutant receptor also causes altered responses, in terms of high inflammatory responses, contributing toward increasing the risk of melanoma development in light or red-headed individuals.

  23. Special Issue Research Articles

    1. Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins

      Almaz S. Jalilov, Ryan M. Young, Samuel W. Eaton, Michael R. Wasielewski and Frederick D. Lewis

      Article first published online: 30 OCT 2014 | DOI: 10.1111/php.12360

      Thumbnail image of graphical abstract

      The behavior of DNA conjugates having Michler's ketone hairpin linkers is dependent upon the ground state conformation of the linker. Linkers in which there is little interaction with the adjacent base pair undergo fluorescence and intersystem crossing to form a long-lived triplet state; whereas linkers that are stacked with an adjacent purine base undergo fast, reversible electron transfer.

  24. Research Articles

    1. Photostability of Cosmetic UV Filters on Mammalian Skin Under UV Exposure

      Constanze Stiefel, Wolfgang Schwack and Yen-Thi Hai Nguyen

      Article first published online: 25 OCT 2014 | DOI: 10.1111/php.12357

      Thumbnail image of graphical abstract

      Previous studies showed that common UV filter substances like BP-3, BM-DBM, EHS, OCR, EHMC and EHT were able to react with amino side chains of different proteins in vitro. The present work confirms that also in the case of real skin samples, differences in the recoveries could be observed when sunscreen samples were irradiated on either glass plates or pig skin, indicating the occurrence of certain skin-typical reactions, as the formation of protein adducts. The results were in good accordance with a recently developed HPTLC screening method, indicating a different photocontact allergenic potential of the UV filters.

    2. Highly Efficient Photodegradation of Organic Pollutants Assisted by Sonoluminescence

      Anna V. Volkova, Silke Nemeth, Ekaterina V. Skorb and Daria V. Andreeva

      Article first published online: 20 OCT 2014 | DOI: 10.1111/php.12352

      Thumbnail image of graphical abstract

      The kinetics of dye degradation via ultrasonication was studied. It was shown that Light emitted in cavitated liquid was essential for initiation of the photoreactions on the surface of the semiconductor particles. Direct attack of dye molecules by sonochemically formed reactive oxygen species causes relatively slow degradation of azo dyes. The mechanism of ultrasound-assisted degradation of azo dyes is mostly based on the activation of photocatalysts by sonoluminescence.

    3. Inspection of Feasible Calibration Conditions for UV Radiometer Detectors with the KI/KIO3 Actinometer

      Zhimin Qiang, Wentao Li, Mengkai Li, James R. Bolton and Jiuhui Qu

      Article first published online: 18 OCT 2014 | DOI: 10.1111/php.12356

      Thumbnail image of graphical abstract

      Under feasible calibration conditions, the KI/KIO3 actinometer can be easily applied to calibrate UV radiometer detectors at 254 nm in a quasi-collimated beam apparatus in ordinary laboratories, which saves the cost and time for periodic detector recalibrations.

  25. Special Issue Research Articles

    1. Interleukin-17 Mediated Inflammatory Responses Are Required for Ultraviolet Radiation-Induced Immune Suppression

      Hui Li, Ram Prasad, Santosh K. Katiyar, Nabiha Yusuf, Craig A. Elmets and Hui Xu

      Article first published online: 13 OCT 2014 | DOI: 10.1111/php.12351

      Thumbnail image of graphical abstract

      Ultraviolet radiation (UVR) causes immune suppression which is associated with an increased risk of skin cancers. Exposure to UVR induces inflammation with an increased level of interleukin-17 in the skin. Our data show that blockade of interleukin-17 inhibits UVR-induced immune suppression. The lack of interleukin-17-mediated inflammation reduces the infiltration and development of suppressive myeloid cells in the ultraviolet-irradiated skin and development of regulatory T cells. The results implicate that interleukin-17 is an important mediator for UVR-induced immune suppression and may be a target for development of new strategies for the prevention of UVR-induced skin cancers.

  26. Research Articles

    1. Fisetin Inhibits UVB-induced Cutaneous Inflammation and Activation of PI3K/AKT/NFκB Signaling Pathways in SKH-1 Hairless Mice

      Harish Chandra Pal, Mohammad Athar, Craig A. Elmets and Farrukh Afaq

      Article first published online: 7 OCT 2014 | DOI: 10.1111/php.12337

      Thumbnail image of graphical abstract

      Exposure to solar UVB radiation has been implicated as the main cause for skin cancer. In this study, we investigated whether fisetin, a flavonoid abundantly present in fruits and vegetables, reduces inflammatory responses and modulates PI3K/AKT/NFκB cell survival signaling pathways in UVB-exposed SKH-1 hairless mouse skin. Our data demonstrated that topical application of fisetin to SKH-1 mice inhibited UVB-induced inflammation and proliferation by modulating PI3K/AKT/NFκB signaling pathways. In addition, fisetin treatment augmented UVB-induced protein expression of p53 and p21 as well as reduced DNA damage caused by UVB exposure. Overall, these findings suggest that fisetin could be developed as a novel photochemopreventive agent.

  27. Special Issue Research Articles

    1. Photo-Wolff Rearrangement of 2-Diazo-1,2-naphthoquinone: Stern–Volmer Analysis of the Stepwise Reaction Pathway

      Manfred Ladinig, Markus Ramseier and Jakob Wirz

      Article first published online: 30 SEP 2014 | DOI: 10.1111/php.12341

      Thumbnail image of graphical abstract

      A quantitative assessment of the stepwise versus concerted photodeazotization pathways of 2-diazo-1,2-naphthoquinone (1) forming ketene 3 is provided. Trapping of the carbene intermediate 2 by methanol yields 2-methoxy-1-naphthol (4) in up to 12% yield. [3+2]Cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was also observed. The lifetime of the thermalized carbene 2 is at least 200 ps. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

  28. Invited Reviews

    1. You have free access to this content
      Proanthocyanidins from Grape Seeds Inhibit UV–Radiation-Induced Immune Suppression in Mice: Detection and Analysis of Molecular and Cellular Targets

      Santosh K. Katiyar

      Article first published online: 8 SEP 2014 | DOI: 10.1111/php.12330

      Thumbnail image of graphical abstract

      Prevention of UV–radiation-induced immunosuppression by dietary grape seed proanthocyanidins is mediated through: (i) alterations in immunoregulatory cytokines, such as, IL-10 and IL-12, (ii) stimulation of DNA repair and (iii) DNA repair-dependent functional activation of dendritic cells in mice.

  29. Special Issue Research Articles

    1. A New Series of Fluorescent Indicators for Super Acids

      I-Chih Shih, Yu-Shan Yeh, I-Che Wu, You-Hua Chen, Jiun-Yi Shen, Yi-An Chen, Mei-Lin Ho and Pi-Tai Chou

      Article first published online: 6 SEP 2014 | DOI: 10.1111/php.12326

      Thumbnail image of graphical abstract

      A new series of fluorescent indicators are developed for sensing super acids. The fluorescence intensity switches from the nonemissive state (the diprotonated form) to the intense emissive state (the triprotonated form) with pKa as low as −3.16. This super acid indicator with the highly emissive intensity, great chemical stability and excitation/emission wavelengths in the visible region may find potential applications in industry.

    2. Effect of Immunosuppressants Tacrolimus and Mycophenolate Mofetil on the Keratinocyte UVB Response

      Mei Ming, Baozhong Zhao, Lei Qiang and Yu-Ying He

      Article first published online: 12 AUG 2014 | DOI: 10.1111/php.12318

      Thumbnail image of graphical abstract

      This study investigated the effects of the newer generation of immunosuppressants including tacrolimus and mycophenolate mofetil (MMF) on keratinocyte UVB response. Tacrolimus and MMF impairs UVB-induced DNA repair and apoptosis in human keratinocytes. In addition, tacrolimus inhibits UVB-induced checkpoint signaling, while MMF had no effect. Our findings have demonstrated that tacrolimus and MMF compromises proper keratinocyte UVB response, suggesting an immunosuppression-independent mechanism in the tumor-promoting action of these immunosuppressants.

  30. Research Articles

    1. ROS and p53 in Regulation of UVB-induced HDM2 Alternative Splicing

      Lingying Tong and Shiyong Wu

      Article first published online: 26 JUL 2014 | DOI: 10.1111/php.12306

      Thumbnail image of graphical abstract

      Hdm2, the human homologue of mdm2 (murine double minute oncogene 2), is an oncogene for its role in suppression of p53. Hdm2 alternative splicing, occurs in both tumor and normal tissues, is suggested to be a response of cells for cellular stress, and thus modulate p53 activity. In this study, we demonstrated that UVB is weaker inducer of alternative splicing than UVC is. We also provided evidences that the UV-induced alternative splicing is promoted by DNA-damage, but suppressed by ROS formation and p53 activity of the irradiated cells.

  31. Research Notes

    1. Xeroderma Pigmentosum in the United Kingdom

      Alan R. Lehmann

      Article first published online: 14 JUL 2014 | DOI: 10.1111/php.12301

      Thumbnail image of graphical abstract

      Early diagnosis and rigorous protection from daylight can completely prevent the skin problems in XP. Patient XP59BR (left) has had poor protection from daylight and has developed many skin cancers. In contrast, patient XPJCLO was diagnosed in his first year of life, has been rigorously protected from sunlight and has not developed any significant skin lesions. Curiously, despite having similar mutations in the XPD gene, XP59BR has no severe neurological problems, whereas XPJCLO has shown features of neurological degeneration since the age of 2. Photographs published with consent of patient or their family.

VIEW

  1. 1 - 46

SEARCH

SEARCH BY CITATION