Photochemistry and Photobiology

Cover image for Vol. 91 Issue 1

Early View (Online Version of Record published before inclusion in an issue)

Edited By: Jean Cadet

Impact Factor: 2.684

ISI Journal Citation Reports © Ranking: 2013: 36/74 (Biophysics); 161/291 (Biochemistry & Molecular Biology)

Online ISSN: 1751-1097

VIEW

  1. 1 - 39
  1. Research Articles

    1. Measurement of Photosynthesis Using PAM Technology in a Purple Sulfur Bacterium Thermochromatium tepidum (Chromatiaceae)

      Raymond J. Ritchie and Nutsara Mekjinda

      Article first published online: 31 JAN 2015 | DOI: 10.1111/php.12413

      Thumbnail image of graphical abstract

      Blue-Diode PAM Fluorescence technology can be used to monitor photosynthetic electron transport in Purple Sulfur Photosynthetic Bacteria. This is an important advance for bacterial photosynthetic studies because now photosynthesis of both purple sulfur and purple nonsulfur photosynthetic bacteria can be easily monitored without recourse to 14C methods in the laboratory and in lakes and microbial mats.

    2. Spectroscopic Properties of Morin in Various CH3OH–H2O and CH3CN–H2O Mixed Solvents

      Hyoung-Ryun Park, Seo-Eun Im, Jung-Ja Seo, Bong-Gon Kim, Jin Ah Yoon and Ki-Min Bark

      Article first published online: 31 JAN 2015 | DOI: 10.1111/php.12407

      Thumbnail image of graphical abstract

      Steady-state fluorescence emission spectra of morin in CH3OH-H2O (A), and CH3CN-H2O mixed solvents (B). (A) λex = 390 nm; (1) 100% CH3OH (image), (2) 80% CH3OH (image), (3) 60% CH3OH (image), (4) 40% CH3OH (image); (B) λex = 365 nm; (1) 100% CH3CN (image), (2) 90% CH3CN (image), (3) 70% CH3OH (image), (4) 50% CH3OH (image).

  2. Special Issue Research Articles

    1. Opening Enediyne Scissors Wider: pH-Dependent DNA Photocleavage by meta-Diyne Lysine Conjugates

      Kemal Kaya, Madeleine Johnson and Igor V. Alabugin

      Article first published online: 29 JAN 2015 | DOI: 10.1111/php.12412

      Thumbnail image of graphical abstract

      Upon photochemical activation, meta-bis-tetrafluoropyridinylalkyne-lysine conjugates induce pH-dependent DNA ds-photocleavage. Efficiency of DNA damage is strongly enhanced at pH < 7. The observed pH-dependence of the DNA photocleavage activity stems from change in the protonation states of lysine amino groups. The ROS (Reactive Oxygen Species) scavenger experiments suggest that singlet oxygen is partially involved in the DNA damage.

  3. Research Articles

    1. Low Level Light Therapy Modulates Inflammatory Mediators Secreted by Human Annulus Fibrosus Cells during Intervertebral Disc Degeneration In Vitro

      Min Ho Hwang, Jae Hee Shin, Kyoung Soo Kim, Chang Min Yoo, Ga Eun Jo, Joo Han Kim and Hyuk Choi

      Article first published online: 26 JAN 2015 | DOI: 10.1111/php.12415

      Thumbnail image of graphical abstract

      The aim of this study is to mimic the inflammatory microenvironment and investigate the anti-inflammatory effect of LLLT at a range of wavelengths (405, 532 and 650 nm) on the AF treated with macrophage-like THP-1 cells conditioned medium (MCM) containing proinflammatory cytokines and chemokines. AF cells exposed to MCM secreted significantly higher concentrations of IL-6, IL-8, IL-1β and TNF-α. LLLT markedly inhibited secretion of IL-6 at 405 nm in a time-dependent manner. Level of IL-8 was significantly decreased at all wavelengths in a time-dependent manner. We showed that MCM can induce the inflammatory microenvironment in AF cells and LLLT selectively suppressed IL-6 and 8 levels.

    2. Interaction of Crown Ether-Annelated Styryl Dyes with Double-Stranded DNA

      Daria V. Berdnikova, Olga A. Fedorova, Elena V. Tulyakova, Haixing Li, Sarah Kölsch and Heiko Ihmels

      Article first published online: 23 JAN 2015 | DOI: 10.1111/php.12405

      Thumbnail image of graphical abstract

      Binding of 15-crown-5-derived mono- and bis-styryl dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54.

    3. Intramolecular Proton Transfer in 2-(2′-hydroxyphenyl)oxazolo[4,5-b]pyridine: Evidence for Tautomer in the Ground State

      Francis A. S. Chipem, Ashim Malakar and Govindarajan Krishnamoorthy

      Article first published online: 20 JAN 2015 | DOI: 10.1111/php.12411

      Thumbnail image of graphical abstract

      Unlike its analogs 2-(2′-hydroxyphenyl)oxazolo[4,5-b]pyridine exists as keto tautomer along as enol in the ground state in several solvents.

    4. Influence of Trans Fat on Skin Damage in First-Generation Rats Exposed to UV Radiation

      Raquel Cristine S. Barcelos, Luciana T. Vey, Hecson Jesser Segat, Dalila M. Benvegnú, Fabíola Trevizol, Karine Roversi, Katiane Roversi, Verônica T. Dias, Geisa S. Dolci, Fábio T. Kuhn, Jaqueline Piccolo, Juliana CristinaVeit, Tatiana Emanuelli and Marilise E. Bürger

      Article first published online: 20 JAN 2015 | DOI: 10.1111/php.12414

      Thumbnail image of graphical abstract

      Metabolism of trans fat by COX and LOX: The dietary intake of trans fat favors the synthesis of biologically active prostanoids produced during inflammatory processes. After ultraviolet radiation exposure, trans fat supplementation, which is rich in trans fatty acids (TFA), increases the skin thickness, reactive species generation and decreases the skin antioxidant defenses.

    5. Growth under Visible Light Increases Conidia and Mucilage Production and Tolerance to UV-B Radiation in the Plant Pathogenic Fungus Colletotrichum acutatum

      Henrique D. de Menezes, Nelson S. Massola Jr, Stephan D. Flint, Geraldo J. Silva Jr, Luciano Bachmann, Drauzio E. N. Rangel and Gilberto U. L. Braga

      Article first published online: 15 JAN 2015 | DOI: 10.1111/php.12410

      Thumbnail image of graphical abstract

      Light conditions influence the development of the plant pathogenic fungus Colletotrichum acutatum. Exposures to visible light during fungal growth increased production of conidia and mucilage as well as conidial tolerance to UV. Conidia embedded in the mucilage on sporulating colonies were more tolerant of UV than conidia in suspension that were washed free of mucilage.

  4. Invited Reviews

    1. You have free access to this content
      Molecular Regulation of UV-Induced DNA Repair

      Palak Shah and Yu-Ying He

      Article first published online: 14 JAN 2015 | DOI: 10.1111/php.12406

      Thumbnail image of graphical abstract

      UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing affected individuals to carcinogenesis as well as to premature aging. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors.

  5. Research Articles

    1. Synthesis of Bi2WO6/Bi2O3 Composite with Enhanced Photocatalytic Activity by a Facile One-step Hydrothermal Synthesis Route

      Tianye Wang, Fengjun Zhang, Guosheng Xiao, Shuang Zhong and Cong Lu

      Article first published online: 14 JAN 2015 | DOI: 10.1111/php.12409

      Thumbnail image of graphical abstract

      Bi2WO6/Bi2O3 can be synthesized by a facile one-pot hydrothermal route with sodium oleate using a super big 200 mL Teflon-lined autoclave. The as-prepared composites possessed smaller band gap and higher visible-light responsive than the pure Bi2WO6. The as-prepared composites exhibited enhanced photocatalytic activity for the degradation of RhB under visible-light irradiation, which could be ascribed to their improved light absorption property and the reduced recombination of the photogenerated electrons and holes during the photocatalytic reaction.

    2. Response of Growth and Photosynthesis of Emiliania huxleyi to Visible and UV Irradiances under Different Light Regimes

      Tao Xing, Kunshan Gao and John Beardall

      Article first published online: 14 JAN 2015 | DOI: 10.1111/php.12403

      Thumbnail image of graphical abstract

      We grew calcifying Emiliania huxleyi under indoor constant light and fluctuating sunlight regimes with or without UV radiation. The growth rate was the highest under the indoor, significantly decreased under fluctuating outdoor solar radiation, especially in the presence of UV radiation. When the UV-exposed cells were regrown under indoor light, the growth recovered slowly, which were predicted to take a month to catch the previous indoor growth rate. The results indicate that the cells, while growing under fluctuating light, require additional energy and resources for maintaining photosynthetic machinery and synthesizing UV-absorbing compounds at the cost of decreased growth rate.

    3. Effects of Substituents on Synthetic Analogs of Chlorophylls. Part 4: How Formyl Group Location Dictates the Spectral Properties of Chlorophylls b, d and f

      Jonathan M. Yuen, Michelle A. Harris, Mengran Liu, James R. Diers, Christine Kirmaier, David F. Bocian, Jonathan S. Lindsey and Dewey Holten

      Article first published online: 12 JAN 2015 | DOI: 10.1111/php.12401

      Thumbnail image of graphical abstract

      The location of the formyl group at the perimeter of the chlorin ring has a profound effect on the position of the long-wavelength chlorin absorption band. Photophysical studies of synthetic formyl chlorins combined with DFT calculations and use of the tetrapyrrole four-orbital model have identified the molecular physical origin of the observed spectral shifts.

    4. Nobiletin, a Polymethoxy Flavonoid, Reduced Endothelin-1 Plus SCF-Induced Pigmentation in Human Melanocytes

      Hyo Jung Kim, Takayuki Yonezawa, Toshiaki Teruya, Je-Tae Woo and Byung-Yoon Cha

      Article first published online: 12 JAN 2015 | DOI: 10.1111/php.12400

      Thumbnail image of graphical abstract

      Nobiletin inhibited ET plus SCF-triggered production of melanin and expression of MITF/tyrosinase in human melanocytes and a three-dimensional human epidermal model. This is the first research emphasizing the antimelanogenesis potential of nobiletin isolated from citrus and its possibility of beneficial applications in the cosmetic industry.

    5. Effects of Ultraviolet Radiation (UVA+UVB) and Copper on the Morphology, Ultrastructural Organization and Physiological Responses of the Red Alga Pterocladiella capillacea

      Éder C. Schmidt, Marianne Kreusch, Marthiellen R. de L. Felix, Debora T. Pereira, Giulia B. Costa, Carmen Simioni, Luciane C. Ouriques, Francine L. Farias-Soares, Neusa Steiner, Fungyi Chow, Fernanda Ramlov, Marcelo Maraschin and Zenilda L. Bouzon

      Article first published online: 8 JAN 2015 | DOI: 10.1111/php.12396

      Thumbnail image of graphical abstract

      This study shows that both ultraviolet radiation (UVR) and copper (Cu) have deleterious effects on the macroalgae Pterocladiella capillacea, which toxicity led to drastic cellular changes and failure of protective mechanisms. Although UV radiation demonstrated to be more harmful than Cu, our results clearly indicate a synergistic interaction between the two stressors.

  6. Special Issue Invited Reviews

    1. You have free access to this content
      Forty Years of Research on Xeroderma Pigmentosum at the US National Institutes of Health

      Kenneth H. Kraemer and John J. DiGiovanna

      Article first published online: 8 JAN 2015 | DOI: 10.1111/php.12345

      Thumbnail image of graphical abstract

      James Cleaver's 1968 report of defective DNA repair in patients with xeroderma pigmentosum (XP) inspired scientists at the National Institutes of Health to initiate long-term studies of patients with XP and related disorders. These have led to a better understanding of the role of DNA repair in protection from sunlight-induced cancer of the skin and eyes, in maintaining the integrity of the nervous system and in human development. XP serves as a model of the effectiveness of sun protection and of oral retinoids in prevention of skin cancers.

  7. Research Articles

    1. Thioredoxin Reductase Activity may be More Important than GSH Level in Protecting Human Lens Epithelial Cells against UVA Light

      Vanita A. Padgaonkar, Victor R. Leverenz, Aparna V. Bhat, Sara E. Pelliccia and Frank J. Giblin

      Article first published online: 8 JAN 2015 | DOI: 10.1111/php.12404

      Thumbnail image of graphical abstract

      Exposure of cultured human lens epithelial cells (LECs) to UVA light (25 J cm−2), or pretreatment of the cells with an inhibitor (1-chloro-2,4-dinitrobenzene) of thioredoxin reductase (TrxR), produced no damaging cellular effects. However, a combination of the two challenges produced substantial loss of LECs and cell damage, including death (arrows) and threadlike structures (arrowheads). In contrast, depletion of reduced glutathione (GSH) by L-buthionine-(S,R)-sulfoximine, combined with exposure to UVA light, produced only a slight cell loss, with no apparent morphological effects. The results demonstrate an important role for TrxR activity, possibly more so than GSH level, in defending the lens epithelium against UVA light.

    2. Unveiling the Triplet State of a 4-Amino-7-Nitrobenzofurazan Derivative in Cyclohexane

      Christopher Sveen, Nicolas Macia, Vanina Zaremberg and Belinda Heyne

      Article first published online: 8 JAN 2015 | DOI: 10.1111/php.12402

      Thumbnail image of graphical abstract

      While NBD derivatives are very popular fluorogenic compounds and their first excited states are well characterized, no study had investigated the ability of these compounds to undergo intersystem crossing. As many other intramolecular charge transfer molecules, NBD derivatives present a triplet state in a nonpolar solvent such as cyclohexane.

    3. Improved Efficiency and Stability of Flexible Dye Sensitized Solar Cells on ITO/PEN Substrates Using an Ionic Liquid Electrolyte

      Yu Han, Jennifer M. Pringle and Yi-Bing Cheng

      Article first published online: 30 DEC 2014 | DOI: 10.1111/php.12399

      Thumbnail image of graphical abstract

      Flexible dye-sensitized solar cells (DSSCs) with enhanced stability, built on ITO/PEN substrates and using an ionic liquid (IL) electrolyte, have been developed. A 12 nm thick blocking layer, produced by atomic layer deposition, was used to reduce electron recombination, and a 1 μm thick TiO2 film sensitized with the hydrophobic MK-2 dye was used to improve charge collection and extraction. These flexible DSSCs exhibit comparable efficiency to those cells using a solvent based electrolyte plus significantly improved stability, with a <10% drop in performance after 1000 h aging at 60°C under continuous light illumination.

    4. Application of CdTe/ZnSe Quantum Dots in In Vitro Imaging of Chicken Tissue and Embryo

      Amitava Moulick, Iva Blazkova, Vedran Milosavljevic, Zdenka Fohlerova, Jaromir Hubalek, Pavel Kopel, Marketa Vaculovicova, Vojtech Adam and Rene Kizek

      Article first published online: 30 DEC 2014 | DOI: 10.1111/php.12398

      Thumbnail image of graphical abstract

      CdTe/ZnSe core/shell quantum dots (QDs) were prepared using microwave irradiation with different temperatures which is a very easy and less time-consuming method. The QDs were characterized by spectrofluorimetry, TEM, X-ray fluorescence analysis and Dynamic Light Scattering measurement. A blueshifting of the emission was found when ZnSe was deposited on CdTe QDs. All the QDs were able to visualize in in vitro imaging of chicken tissue and embryo and the QDs prepared at 100°C showed the best result.

    5. Low-level Laser (Light) Therapy Increases Mitochondrial Membrane Potential and ATP Synthesis in C2C12 Myotubes with a Peak Response at 3–6 h

      Cleber Ferraresi, Beatriz Kaippert, Pinar Avci, Ying-Ying Huang, Marcelo V. P. de Sousa, Vanderlei S. Bagnato, Nivaldo A. Parizotto and Michael R. Hamblin

      Article first published online: 30 DEC 2014 | DOI: 10.1111/php.12397

      Thumbnail image of graphical abstract

      Mechanism of action of LLLT or LEDT on mitochondria in muscle cells. There is an increased flux of electrons through all the complexes of the electron transport chain, increased pumping of H+, increased synthesis of ATP and increased mitochondrial membrane potential as shown by TMRM fluorescence. The result is that muscles can perform much more work when light is delivered 3–6 h before exercise.

  8. Special Issue Research Articles

    1. Absorption and Emission Sensitivity of 2-(2′-Hydroxyphenyl)benzoxazole to Solvents and Impurities

      Zhao Yuan, Qing Tang, Kesavapillai Sreenath, J. Tyler Simmons, Ali H. Younes, De-en Jiang and Lei Zhu

      Article first published online: 23 DEC 2014 | DOI: 10.1111/php.12393

      Thumbnail image of graphical abstract

      Minor long-wavelength absorption bands of the excited state intramolecular proton transfer (ESIPT) dye 2-(2′-hydroxyphenyl)benzoxazole (HBO) have been observed in DMSO by us and others. These bands might have been caused by base or metal salt impurities introduced by glass Pasteur pipettes that are equipped with latex rubber bulbs. Without the interference of extraneous bases or metal salts, solvent-mediated deprotonation fails to occur. The propensity of HBO to deprotonation is much higher in DMSO than in less polar solvents. The solvatochromic shifts of HBO suggest that the ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

    2. Steric and Electronic Factors Associated with the Photoinduced Ligand Exchange of Bidentate Ligands Coordinated to Ru(II)

      Bryan A Albani, Tyler Whittemore, Christopher B. Durr and Claudia Turro

      Article first published online: 23 DEC 2014 | DOI: 10.1111/php.12392

      Thumbnail image of graphical abstract

      In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT) with easily tunable excited state properties, the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complex 1 undergoes photoinduced ligand dissociation of the dpb ligand in coordinating solvent in the PCT window, however, the bimetallic complex is photoinert but does absorb lower energy light. The differences in the photophysical properties and the crystal structures of the complexes are discussed and used to explain the differences in photoreactivity.

    3. Regulation and Disregulation of Mammalian Nucleotide Excision Repair: A Pathway to Nongermline Breast Carcinogenesis

      Jean J. Latimer, Vongai J. Majekwana, Yashira R. Pabón-Padín, Manasi R. Pimpley and Stephen G. Grant

      Article first published online: 19 DEC 2014 | DOI: 10.1111/php.12387

      Thumbnail image of graphical abstract

      We have shown profound variation in NER (Nucleotide Excision Repair) capacity in humans, between cell-types and during carcinogenesis. As NER is intimately related to both replication and transcription, it shows a narrow range of functional viability. NER activity and gene expression are epigenetically regulated, although this epigenetic modulation is disregulated during sporadic breast carcinogenesis. We now demonstrate differences in NER capacity in eight adult mouse tissues, including a complete lack of activity in brain, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.

  9. Research Articles

    1. Photophysics of Acetophenone Interacting with DNA: Why the Road to Photosensitization is Open

      Miquel Huix-Rotllant, Elise Dumont, Nicolas Ferré and Antonio Monari

      Article first published online: 16 DEC 2014 | DOI: 10.1111/php.12395

      Thumbnail image of graphical abstract

      Using a combination of Molecular Dynamics and QM/MM modeling we have characterized stable interaction modes between acetophenone and DNA. The effects of the macromolecular environment on the acetophenone photophysics have been elucidated, confirming that it is still able to efficiently photosensitize DNA by energy transfer from triplet state. In particular this is due to the maintaining of the quasidegenerescence between the first two acetophenone triplet states that are moreover characterized by a high spin-orbit coupling with the ground state. Our work gives important insights in the triplet sensitization mechanism and on the effect of the environment.

  10. Invited Reviews

    1. You have free access to this content
      Beyond Xeroderma Pigmentosum: DNA Damage and Repair in an Ecological Context. A Tribute to James E. Cleaver

      Deneb Karentz

      Article first published online: 11 DEC 2014 | DOI: 10.1111/php.12388

      Thumbnail image of graphical abstract

      Sunlight is one of the most ubiquitous hazards for life on Earth. Although some aspects of solar radiation are beneficial (e.g. photosynthesis, vision, vitamin D synthesis), the ultraviolet B (UVB) component causes substantial damage to DNA resulting in debilitating and lethal effects. All organisms are capable of repairing DNA photoproducts and repair pathways are remarkably similar. While DNA repair research often focuses on human diseases and the development of cancer; solar DNA damage is also an important component of ecosystem health and stability. This review provides an overview of DNA repair in non-mammalian taxa relative to ambient UVB stress.

  11. Research Articles

    1. The Efficient Photocatalytic Degradation of Methyl Tert-butyl Ether Under Pd/ZnO and Visible Light Irradiation

      Zaki S. Seddigi, Saleh A. Ahmed, Ali Bumajdad, Ekram Y. Danish, Ahmed M. Shawky, Mohammed A. Gondal and Mustafa Soylak

      Article first published online: 11 DEC 2014 | DOI: 10.1111/php.12391

      Thumbnail image of graphical abstract

      The photocatalytic degradation of aqueous MTBE solution was studied using zinc oxide as a photocatalyst. Complete MTBE removal was achieved within 9 h under visible light irradiation using ZnO particles. MTBE removal is attributed to the visible light excitation of the photocatalyst resulting in the generation of photoexcited electron/hole pairs. This method can be considered as an efficient and complete removal system of MTBE from water.

    2. Minimum Exposure Limits and Measured Relationships Between the Vitamin D, Erythema and International Commission on Non-Ionizing Radiation Protection Solar Ultraviolet

      Nathan Downs, Alfio Parisi, Harry Butler, Joanna Turner and Lisa Wainwright

      Article first published online: 11 DEC 2014 | DOI: 10.1111/php.12394

      Thumbnail image of graphical abstract

      The relationship between vitamin D dose and the International Commission on Non-Ionizing Radiation Protection (ICNIRP) UV exposure is studied from measurements made in Southern Queensland, Australia. The measurements take into account all weather and atmospheric conditions including a major continental dust storm event (NASA MODIS Terra image, 23 September 2009). Personal minimum exposure guidelines for the optimal production of vitamin D are presented for each of the internationally recognized UV index ranges relative to the received ICNIRP exposure. The measured data show that the healthy production of vitamin D can be maintained at subtropical latitude without exceeding ICNIRP exposure guidelines.

    3. Ultraviolet Index and Location are Important Determinants of Vitamin D Status in People with Human Immunodeficiency Virus

      Karen M. Klassen, Christopher K. Fairley, Michael G. Kimlin, Mark Kelly, Tim R.H. Read, Jennifer Broom, Darren B. Russell and Peter R. Ebeling

      Article first published online: 9 DEC 2014 | DOI: 10.1111/php.12390

      Thumbnail image of graphical abstract

      Low vitamin D is commonly found in people with HIV. This figure presents the unadjusted proportions of people with 25(OH)D <75 nmol L−1 grouped by UV index categories and the four different study locations in Australia [Cairns (latitude 17°S), Nambour (27°S), Brisbane (28°S) and Melbourne (38°S)]. In this study, we describe these and other factors contributing to serum 25(OH)D levels in people with HIV in Australia. Antiretroviral therapy was also associated with 25(OH)D <75 nmol L−1 which appeared to be modified by cholesterol and warrants further exploration in future studies.

  12. Special Issue Research Articles

    1. Transition from Charge-Transfer to Largely Locally Excited Exciplexes, from Structureless to Vibrationally Structured Emissions

      Ralph H. Young, Adam M. Feinberg, Joseph P. Dinnocenzo and Samir Farid

      Article first published online: 8 DEC 2014 | DOI: 10.1111/php.12380

      Thumbnail image of graphical abstract

      Exciplexes of 9,10-dicyanoanthracene with low oxidation potential (Eox) alkylbenzenes in cyclohexane show structureless emission spectra suggesting ideal charge-transfer (CT) states. With higher Eox donors, vibrational structure emerges. A theoretical model of mixing with a locally excited (LE) state reproduces the spectra and radiative rate constants. The fractional CT character of a highly mixed exciplex varies widely with fluctuations in the microscopic environment and/or librational geometry. Fluctuations favoring the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. The “ideal CT” appearance of the low-Eox spectra is illusory, resulting instead from several compensating factors.

    2. Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study

      Pascale Changenet-Barret, Ying Hua, Thomas Gustavsson and Dimitra Markovitsi

      Article first published online: 28 NOV 2014 | DOI: 10.1111/php.12379

      Thumbnail image of graphical abstract

      G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K+ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.

    3. Following Oxygen Consumption in Singlet Oxygen Reactions via Changes in Sensitizer Phosphorescence

      Tingting Feng, Tod A. Grusenmeyer, Max Lupin and Russell H. Schmehl

      Article first published online: 28 NOV 2014 | DOI: 10.1111/php.12381

      Thumbnail image of graphical abstract

      Photolysis of a Ruthenium-pyrene complex in oxygenated aqueous solutions results in efficient sensitization of singlet oxygen. In the presence of substrates, large increases in the orange luminescence of the Ruthenium-pyrene complex are observed as dissolved oxygen reacts with the substrate. Luminescence intensity changes allow determination of rate constants for singlet oxygen reaction with substrates.

    4. Interspecific Variation in the Repair of UV Damaged DNA in the Genus Xiphophorus as a Factor in the Decline of the Rio Grande Platyfish

      David Mitchell, Lakshmi Paniker, Kevin Lin and André Fernandez

      Article first published online: 25 NOV 2014 | DOI: 10.1111/php.12358

      Thumbnail image of graphical abstract

      Geographical distribution of 26 species of the genus Xiphophorus with three northern species is highlighted. The three species comprising the Rio Grande Platyfish are the only Xiphophorus listed on the IUCN Red List of Threatened Species and this clade as a whole displays significantly reduced DNA repair compared to the other species in the genus.

    5. o-Amino Analogs of Green Fluorescence Protein Chromophore: Photoisomerization, Photodimerization and Aggregation-induced Emission

      Guan-Jhih Huang, Che-Jen Lin, Yi-Hung Liu, Shie-Ming Peng and Jye-Shane Yang

      Article first published online: 24 NOV 2014 | DOI: 10.1111/php.12373

      Thumbnail image of graphical abstract

      The GFP-like chromophore O0 undergoes solid-state [2 + 2] photodimerization to form a head-to-tail syn-oriented photodimer OD that is confirmed by X-ray crystallography. The excited-state “meta-ortho effect” of the amino analogs of GFP chromophore in solutions and aggregates is also established and discussed.

    6. Photoisomerization of cis-1,2-di(1-Methyl-2-naphthyl)ethene at 77 K in Glassy Media

      Christopher Redwood, V. K. Ratheesh Kumar, Stuart Hutchinson, Frank B. Mallory, Clelia W. Mallory, Ronald J. Clark, Olga Dmitrenko and Jack Saltiel

      Article first published online: 21 NOV 2014 | DOI: 10.1111/php.12367

      Thumbnail image of graphical abstract

      One bond twist photoisomerization of cis-I,2-di(1-methyl-2-naphthyl)ethene in glassy media.

    7. Comparison of Templating Abilities of Urea and Thioruea During Photodimerization of Bipyridylethyelene and Stilbazole Crystals

      Balakrishna R. Bhogala, Burjor Captain and Vaidhyanathan Ramamurthy

      Article first published online: 7 NOV 2014 | DOI: 10.1111/php.12353

      Thumbnail image of graphical abstract

      Templating properties of urea in solid-state photodimerization of stilbazoles and bispyridylethylenes have been established through a study that combined photochemistry and X-ray crystallography. The templating ability of urea derives from its ability to form hydrogen bond with itself and with coguests stilbazoles and bispyridylethylenes. At this stage, it is not easy to predict when urea will and when will not function as a template.

    8. Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins

      Almaz S. Jalilov, Ryan M. Young, Samuel W. Eaton, Michael R. Wasielewski and Frederick D. Lewis

      Article first published online: 30 OCT 2014 | DOI: 10.1111/php.12360

      Thumbnail image of graphical abstract

      The behavior of DNA conjugates having Michler's ketone hairpin linkers is dependent upon the ground state conformation of the linker. Linkers in which there is little interaction with the adjacent base pair undergo fluorescence and intersystem crossing to form a long-lived triplet state; whereas linkers that are stacked with an adjacent purine base undergo fast, reversible electron transfer.

    9. Photo-Wolff Rearrangement of 2-Diazo-1,2-naphthoquinone: Stern–Volmer Analysis of the Stepwise Reaction Pathway

      Manfred Ladinig, Markus Ramseier and Jakob Wirz

      Article first published online: 30 SEP 2014 | DOI: 10.1111/php.12341

      Thumbnail image of graphical abstract

      A quantitative assessment of the stepwise versus concerted photodeazotization pathways of 2-diazo-1,2-naphthoquinone (1) forming ketene 3 is provided. Trapping of the carbene intermediate 2 by methanol yields 2-methoxy-1-naphthol (4) in up to 12% yield. [3+2]Cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was also observed. The lifetime of the thermalized carbene 2 is at least 200 ps. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

    10. A New Series of Fluorescent Indicators for Super Acids

      I-Chih Shih, Yu-Shan Yeh, I-Che Wu, You-Hua Chen, Jiun-Yi Shen, Yi-An Chen, Mei-Lin Ho and Pi-Tai Chou

      Article first published online: 6 SEP 2014 | DOI: 10.1111/php.12326

      Thumbnail image of graphical abstract

      A new series of fluorescent indicators are developed for sensing super acids. The fluorescence intensity switches from the nonemissive state (the diprotonated form) to the intense emissive state (the triprotonated form) with pKa as low as −3.16. This super acid indicator with the highly emissive intensity, great chemical stability and excitation/emission wavelengths in the visible region may find potential applications in industry.

  13. Research Notes

    1. Xeroderma Pigmentosum in the United Kingdom

      Alan R. Lehmann

      Article first published online: 14 JUL 2014 | DOI: 10.1111/php.12301

      Thumbnail image of graphical abstract

      Early diagnosis and rigorous protection from daylight can completely prevent the skin problems in XP. Patient XP59BR (left) has had poor protection from daylight and has developed many skin cancers. In contrast, patient XPJCLO was diagnosed in his first year of life, has been rigorously protected from sunlight and has not developed any significant skin lesions. Curiously, despite having similar mutations in the XPD gene, XP59BR has no severe neurological problems, whereas XPJCLO has shown features of neurological degeneration since the age of 2. Photographs published with consent of patient or their family.

VIEW

  1. 1 - 39

SEARCH

SEARCH BY CITATION