Photochemistry and Photobiology

Cover image for Vol. 91 Issue 2

Early View (Online Version of Record published before inclusion in an issue)

Edited By: Jean Cadet

Impact Factor: 2.684

ISI Journal Citation Reports © Ranking: 2013: 36/74 (Biophysics); 161/291 (Biochemistry & Molecular Biology)

Online ISSN: 1751-1097

VIEW

  1. 1 - 40
  1. Invited Reviews

    1. You have free access to this content
      Photosensitizing Activity of Endogenous Eye Lens Chromophores: An Attempt to Unravel Their Contributions to Photo-Aging and Cataract Disease

      Felipe Avila, Bertrand Friguet and Eduardo Silva

      Article first published online: 28 MAR 2015 | DOI: 10.1111/php.12443

      Thumbnail image of graphical abstract

      Human eye lens aging is accompanied with the generation of numerous chromophores, which can be found at higher concentrations in cataractous lenses. In this review we discuss the presence and UVA-visible photosensitizing capacity of the main families of chromophores associated with the etiology and progression of human cataract disease.

  2. Special Issue Research Articles

    1. Improved Spectral Coverage and Fluorescence Quenching in Donor–acceptor Systems Involving Indolo[3-2-b]carbazole and Boron-dipyrromethene or Diketopyrrolopyrrole

      Adis Khetubol, Sven Van Snick, Melissa L. Clark, Eduard Fron, Eduardo Coutiño-González, Arvid Cloet, Koen Kennes, Yuliar Firdaus, Maarten Vlasselaer, Volker Leen, Wim Dehaen and Mark Van der Auweraer

      Article first published online: 28 MAR 2015 | DOI: 10.1111/php.12437

      Thumbnail image of graphical abstract

      We report synthesis and studies of organic compounds incorporating indolo[3,2-b]-carbazole (ICZ), and 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) or diketopyrrolopyrrole (DPP). The spectroscopic studies suggest stronger interaction between ICZ and BODIPY in both ground and excited states as well as more efficient energy transfer from ICZ to BODIPY, compared to those of the ICZ-DPP compound, which could be related to the unfavorable orientation of the transition dipoles of ICZ and DPP chromophores. Furthermore, in a solid film of the ICZ–π–BODIPY triad an aggregate of the triad molecules was observed, resulting in a redshift of the absorption maximum (~100 nm) relative to a solution.

  3. Research Articles

    1. High Final Energy of Low-Level Gallium Arsenide Laser Therapy Enhances Skeletal Muscle Recovery without a Positive Effect on Collagen Remodeling

      Carlos Eduardo Assumpção de Freitas, Raquel Santilone Bertaglia, Ivan José Vechetti Júnior, Edson Assunção Mareco, Rondinelle Artur Simões Salomão, Tassiana Gutierrez de Paula, Gisele Alborghetti Nai, Robson Francisco Carvalho, Francis Lopes Pacagnelli and Maeli Dal-Pai-Silva

      Article first published online: 28 MAR 2015 | DOI: 10.1111/php.12446

      Thumbnail image of graphical abstract

      This study investigated the effects of low-level laser therapy (LLLT) at a high final energy (4.8 J) during muscle regeneration after cryoinjury. Gallium Arsenide (GaAs, 904 nm) laser applied for 5 days in two points of the lesion resulted in a significant decrease in the TNF-α and myogenin, without change in the TGF-β gene expression. The Injured/LLLT group presented a higher number of regenerating fibers and fewer degenerating fibers without changes in the collagen remodeling. The results suggest that the GaAs laser at a high final energy (4.8 J) promotes muscle recovery without changing the collagen remodeling.

    2. A Novel Microsensor for Measuring Angular Distribution of Radiative Intensity

      Thomas E. Murphy, Stuart Pilorz, Leslie Prufert-Bebout and Brad Bebout

      Article first published online: 28 MAR 2015 | DOI: 10.1111/php.12452

      Thumbnail image of graphical abstract

      Measurement of the directional dependence of radiative intensity is essential for understanding light transport in microbial mats, plant leaves, soils and phototrophic biofilms. Previously, measuring the directional intensity in these environments required inserting a field radiance probe with a small acceptance angle into a tissue at multiple angles, which required significant time and labor. This paper presents a novel differential acceptance angle (DAA) light probe, which can measure the directional intensity in light fields from a single location without reorienting the probe. We discuss the construction of the DAA probe and its performance compared to a conventional field radiance probe.

    3. Endogenous Retinoic Acid Required to Maintain the Epidermis Following Ultraviolet Light Exposure in SKH-1 Hairless Mice

      Katherine L. Gressel, F. Jason Duncan, Tatiana M. Oberyszyn, Krista M. La Perle and Helen B. Everts

      Article first published online: 28 MAR 2015 | DOI: 10.1111/php.12441

      Thumbnail image of graphical abstract

      Ultraviolet light B (UVB) exposure alters the expression of some retinoid metabolism proteins; but an analysis of the complete system in vivo is lacking. We analyzed the expression of retinoid metabolism proteins by immunohistochemistry 48 h after UVB treatment of SKH-1 mice. Acute UVB localized retinoic acid (RA) synthesis and signaling to the upper stratum granulosum; localized RA degradation to the lower stratum granulosum and stratum spinosum; and reduced retinoid storage. Inhibition of RA synthesis by disulfiram damaged the epidermis (image). These results suggest that endogenously synthesized RA is important in epidermal differentiation and repair following UVB exposure.

  4. Special Issue Research Articles

    1. Steady-State Spectroscopy of the 2-(N-methylacetimidoyl)-1-naphthol Molecule

      Juan Carlos del Valle and Cristina Díaz-Oliva

      Article first published online: 28 MAR 2015 | DOI: 10.1111/php.12444

      Thumbnail image of graphical abstract

      The steady-state spectroscopy of 2-(N-methylacetimidoyl)-1-naphthol reveals composite absorption and emission spectra from 298 to 193 K in hexane. The S0 state absorption can be assigned to the sum of three molecular structures in chemical equilibrium: the OH normal tautomer and two NH proton transfer tautomers. On photoexcitation of the OH tautomer the excited state intramolecular proton transfer is undergone, and the corresponding NH emission is monitored at 470 nm. On photoexcitation of the NH tautomers the previous emission is monitored in addition to another emission at 600 nm, which is ascribed to intramolecular hydrogen-bonded (IHB) nonplanar NH tautomers generated from the IHB planar NH tautomers.

    2. Nanometal Surface Energy Transfer Optical Ruler for Measuring a Human Telomere Structure

      Rachel E. Armstrong, Ryan A. Riskowski and Geoffrey F. Strouse

      Article first published online: 28 MAR 2015 | DOI: 10.1111/php.12423

      Thumbnail image of graphical abstract

      Through the use of optical quenching of a molecular dye (DY680) by a gold nanoparticle appended to DNA, the conformation of the Hybrid-2 conformer in telomeric DNA sequence was measured. The results clearly demonstrate the versatility of nanometal surface energy transfer (NSET) molecular rulers for measuring biopolymer structures, allowing mapping of the structure and no evidence of nonspecific interactions between the gold and DNA sequence which would lead to perturbation of the folding landscape.

  5. Research Articles

    1. Biomodulation of Inflammatory Cytokines Related to Oral Mucositis by Low-Level Laser Therapy

      Fernanda G. Basso, Taisa N. Pansani, Diana G. Soares, Débora L. Scheffel, Vanderlei S. Bagnato, Carlos Alberto de Souza Costa and Josimeri Hebling

      Article first published online: 28 MAR 2015 | DOI: 10.1111/php.12445

      Thumbnail image of graphical abstract

      This study evaluated the effects of low level laser therapy (LLLT) on the expression of inflammatory cytokines involved in the development and severity of oral mucositis. Human gingival fibroblasts treated with LPS (Escherichia coli, 1 μg mL−1) were subjected to LLLT irradiation (LaserTABLE—InGaAsP diode prototype—780 nm, 25 mW) delivering 0, 0.5, 1.5, or 3 J cm². LLLT promoted significant decreases in the expression of TNF-α, IL-6 and IL-8 at 1.5 J cm−2 and 3 J cm−2. These results demonstrate that LLLT promoted a beneficial biomodulatory effect on the expression of inflammatory cytokines related to oral mucositis by human gingival fibroblasts.

    2. Survey of UV Emissions from Sunbeds in the UK

      Marina Khazova, John B. O'Hagan and Stewart Robertson

      Article first published online: 23 MAR 2015 | DOI: 10.1111/php.12425

      Thumbnail image of graphical abstract

      Spectral irradiance of 195 sunbeds in five areas of the United Kingdom was measured in order to assess the radiant doses as increased use of indoor tanning has led to concerns for its impact on the risk of cutaneous cancers. Use of sunbeds for cosmetic purposes should be discouraged, with effective enforcement of the ban on under-18 use, strict control on tanning duration and promotion of information on health risks of sunbed use. Such an integrated approach on safe equipment, safe use and information should reduce the risk of detrimental impact of sunbed use on public health.

    3. Photocatalytic Activity of LaSr2AlO5:Eu Ceramic Powders

      Carlos R. García, Jorge Oliva and Luis A. Díaz-Torres

      Article first published online: 18 MAR 2015 | DOI: 10.1111/php.12428

      Thumbnail image of graphical abstract

      Europium-doped LaSr2AlO5 (LSA:Eu) has been investigated as photocatalyst for methylene blue degradation in water solutions under UV light. The photograph shows a sequence of the solutions taken each 10 min in the third cycle of use, and achieving total degradation after 360 min of UV irradiation.

    4. Fluorescence Properties of Diphenylthiazolo[4,5-b]pyrazines Tuned by Donor-Acceptor Substituent Effects

      Tatsuki Nakagawa, Minoru Yamaji, Shojiro Maki, Haruki Niwa and Takashi Hirano

      Article first published online: 18 MAR 2015 | DOI: 10.1111/php.12440

      Thumbnail image of graphical abstract

      Fluorescence properties of 2,6- and 2,5-diphenylthiazolo[4,5-b]pyrazines having an electron-donating substituent (methoxy and dimethylamino) on the 6- and 5-phenyl groups were studied. Furthermore, 2,6-diphenyl derivatives having an additional cyano group on the 2-phenyl ring were developed, to give an excellent fluorophore.

    5. Salvianolic Acid B Protects Normal Human Dermal Fibroblasts Against Ultraviolet B Irradiation-Induced Photoaging Through Mitogen-Activated Protein Kinase and Activator Protein-1 Pathways

      Zhengwang Sun, Sang-Yong Park, Eunson Hwang, Mengyang Zhang, Fengxie Jin, Baochun Zhang and Tae Hoo Yi

      Article first published online: 18 MAR 2015 | DOI: 10.1111/php.12427

      Thumbnail image of graphical abstract

      UV causes increased matrix metalloproteinase (MMP) activity and decreased collagen synthesis, leading to skin photoaging. We found that salvianolic acid B (SAB) significantly inhibited the UVB-induced expression of metalloproteinases-1 (MMP-1) while promoting the production of transforming growth factor β1 (TGF-β1). Moreover, SAB strongly inhibited UVB-induced extracellular signal-regulated kinase (ERK), Jun N-terminal kinase (JNK) and p38 phosphorylation, which resulted in decreasing UVB-induced phosphorylation of c-Fos and c-Jun. These results indicate that SAB down-regulates UV-induced MMP-1 expression by inhibiting mitogen-activated protein kinase (MAPK) signaling pathways and activator protein-1 (AP-1) activation.

    6. Luciferin-Regenerating Enzyme Mediates Firefly Luciferase Activation Through Direct Effects of D-Cysteine on Luciferase Structure and Activity

      Roohullah Hemmati, Saman Hosseinkhani, Reza H. Sajedi, Taha Azad, Amin Tashakor, Nuredin Bakhtiari and Farangis Ataei

      Article first published online: 18 MAR 2015 | DOI: 10.1111/php.12430

      Thumbnail image of graphical abstract

      The addition of D-cysteine in the absence of T69R T-LRE (closed circle) to luciferase reaction increased the bioluminescent level over time in comparison with a luciferase reaction containing D-cysteine in the presence of T69R T-LRE (closed diamond) and control (solid line). Thus, even in the presence of LRE the majority of this increase occurs from the direct effects of D-cysteine.

    7. Variability of Solar Radiation and CDOM in Surface Coastal Waters of the Northwestern Mediterranean Sea

      Richard Sempéré, Julien Para, Marc Tedetti, Bruno Charrière and Marc Mallet

      Article first published online: 16 MAR 2015 | DOI: 10.1111/php.12434

      Thumbnail image of graphical abstract

      The wavelengths 305 and 380 nm have been chosen as biologically effective wavelengths for the induction of DNA damages (CPDs) and photorepairs (PERs) respectively. The ratio of the mean doses received within the mixed layer at 305 and 380 nm [Q in % = H(m,305)]/H(m,380) × 100] along with the mixed layer depth (Zm) are presented. Q ratio can be considered as an indicator of changes in the balance between DNA damages (CPDs) and repairs (PERs). Clearly, Q increased with the stratification of the water column.

    8. Actual Isothermal Effects of Water-Filtered Infrared A-Irradiation

      Annika Höhn, Petra Hartmann, Veronika Gebhart, Johanna Sonntag, Tilman Grune and Tobias Jung

      Article first published online: 12 MAR 2015 | DOI: 10.1111/php.12439

      Thumbnail image of graphical abstract

      In this work, we exposed human dermal fibroblasts to water-filtered infrared A (wIRA)-irradiation under isothermal conditions in order to investigate changes in the parameters intracellular free calcium, mitochondrial membrane potential and radical production, DNA and protein oxidation, cell proliferation and protection against UVB.

    9. Human Hair as a Natural Sun Protection Agent: A Quantitative Study

      María Victoria de Gálvez, José Aguilera, Jean-Luc Bernabó, Cristina Sánchez-Roldán and Enrique Herrera-Ceballos

      Article first published online: 12 MAR 2015 | DOI: 10.1111/php.12433

      Thumbnail image of graphical abstract

      Hair provides a barrier against both UVB and UVA radiation which is significantly increased with respect to the hair density (A), thickness (B) and the presence of melanins (hair color) (C). This is the first study to quantify sun protection factor offered by hair, namely hair ultraviolet protection factor (HUPF). Hair should be recognized as an important natural sun barrier in the prevention of UV-induced skin cancers.

  6. Special Issue Research Articles

    1. Electron Spin Exchange in Linked Phenothiazine–Viologen Charge Transfer Complexes Incorporated in “Through-Ring” (Rotaxane) α-Cyclodextrins

      Hiroaki Yonemura and Malcolm D. E. Forbes

      Article first published online: 12 MAR 2015 | DOI: 10.1111/php.12436

      Thumbnail image of graphical abstract

      Photoexcitation of covalently bound phenothiazine donors with methylviologen acceptors separated by C8, C10 and C12 alkane chain spacers incorporated in a “through-ring” (rotaxane) fashion to α-cyclodextrin hosts leads to biradicaloid charge-separated states that are studied by time-resolved electron paramagnetic resonance spectroscopy at the X-band and Q-band microwave frequencies. Computer simulation of the spectra using a “static” model for spin-correlated radical pairs allows extraction of the spin exchange interactions, which range from –2 to –1000 Gauss. The results are discussed in terms of through-bond vs through-space electronic coupling mechanisms as a function of donor–acceptor distance.

  7. Research Articles

    1. Histopathological Analysis of UVB and IR Interaction in Rat Skin

      Vinícius C. Gonzalez, Ana C. M. Beheregaray, Bárbara M. Peres, Eliza S. V. Sallis, Antônio S. Varela Junior and Gilma S. Trindade

      Article first published online: 12 MAR 2015 | DOI: 10.1111/php.12435

      Thumbnail image of graphical abstract

      Chronic IR exposure before UVB irradiation can reduce some of the histopathological alterations caused by UVB while chronic IR exposure after UVB irradiation can enhance most of the histopathological features caused by UVB skin damage.

  8. Special Issue Research Articles

    1. Electronic and Vibrational Dynamics of Hollow Au Nanocages Embedded in Cu2O Shells

      Paul Szymanski, Mahmoud A. Mahmoud, Daniel O'Neil, Batyr Garlyyev and Mostafa A. El-Sayed

      Article first published online: 10 MAR 2015 | DOI: 10.1111/php.12432

      Thumbnail image of graphical abstract

      Femtosecond optical excitation of the localized surface plasmon resonance of Au–Cu2O core-shell nanocages creates hot electrons which transfer energy to the Au and Cu2O lattices on picosecond timescales, leading to coherent vibrational motion. Structural mechanics simulations reproduce the dominant lattice vibrational frequency by treating the rapid thermal expansion of the Au nanocage as a force that acts on the Cu2O shell.

  9. Research Articles

    1. Interfacial Engineering of CdO–CdSe 3D Microarchitectures with in situ Photopolymerized PEDOT for an Enhanced Photovoltaic Performance

      Iseul Lim, Dipak V. Shinde, Supriya A. Patil, Do Young Ahn, Wonjoo Lee, Nabeen K. Shrestha, Joong Kee Lee and Sung-Hwan Han

      Article first published online: 28 FEB 2015 | DOI: 10.1111/php.12429

      Thumbnail image of graphical abstract

      Interfacial engineering of 3D CdO–CdSe-microstructured film by deposition of PEDOT accelerates the interfacial electron transfer rate, and thereby the interfacial electron collection efficiency is enhanced. Thus, the short-circuit current of the device is enhanced significantly.

    2. Decontamination Efficiency of a DBD Lamp Containing an UV–C Emitting Phosphor

      Bruno Caillier, José Maurício Almeida Caiut, Cristina Muja, Julien Demoucron, Robert Mauricot, Jeanette Dexpert-Ghys and Philippe Guillot

      Article first published online: 22 FEB 2015 | DOI: 10.1111/php.12426

      Thumbnail image of graphical abstract

      An innovative mercury-free Dielectric Barrier Discharge (DBD) flat lamp has been developed to obtain large spectrum UV-C radiation. The UV-C radiation is produced by a pyrophosphate phosphor doped with Pr3+ (α-Ca2P2O7: Pr2%Na2%) internal coating excited by the 172 nm emission of a Ne-Xe plasma. This work investigates the influence of the plasma parameters on the newly developed UV source energy efficiency and its bactericidal efficiency.

    3. Evaluation of Photoprotective Potential and Percutaneous Penetration by Photoacoustic Spectroscopy of the Schinus terebinthifolius Raddi Extract

      Milena K. Bulla, Luzmarina Hernandes, Mauro L. Baesso, Ana C. Nogueira, Antonio C. Bento, Bruno B. Bortoluzzi, Lara Z. Serra and Diogenes A. G. Cortez

      Article first published online: 18 FEB 2015 | DOI: 10.1111/php.12419

      Thumbnail image of graphical abstract

      Plant extracts can be incorporated in photoprotective formulations. The crude extract and the fraction containing gallic acid, ethyl gallate and a mixture of flavonoids were obtained from Schinus terebinthifolius leaves. Emulsion and gel formulations containing the crude extract were prepared to evaluate the permeation and the histology of the skin after topical application of the formulations. The photoacoustic spectroscopy measurements confirmed absorption in the UV region and related to the permeation of these formulations. No histopathological changes were detected.

    4. Hiporfin-Mediated Photodynamic Therapy in Preclinical Treatment of Osteosarcoma

      Mengxiong Sun, Chenghao Zhou, Hui Zeng, Nahum Puebla-Osorio, Elisabetta Damiani, Jian Chen, Hongsheng Wang, Guodong Li, Fei Yin, Liancheng Shan, Dongqing Zuo, Yuxin Liao, Zhuoying Wang, Longpo Zheng, Yingqi Hua and Zhengdong Cai

      Article first published online: 16 FEB 2015 | DOI: 10.1111/php.12424

      Thumbnail image of graphical abstract

      Hiporfin is one kind of photosensitizer that has been approved by Chinese SFDA. In this study, hiporfin was used to see its photodynamic activity in osteosarcoma. After illumination by 630 nm laser, hiporfin killed osteosarcoma cells by increased ROS level and through apoptosis and necroptosis pathways. In vivo study also showed potent tumor eradication. All these provided evidences for the clinical trial of hiporfin on osteosarcoma.

    5. One-Pot Synthesis of Cu2O/ZnO Nanoparticles at Present of Folic Acid to Improve UV-Protective Effect of Cotton Fabrics

      Seyyed Abbas Noorian, Nahid Hemmatinejad and Azadeh Bashari

      Article first published online: 10 FEB 2015 | DOI: 10.1111/php.12420

      Thumbnail image of graphical abstract

      In this work, zinc chloride and copper sulfate have been used as precursors and Cu2O/ZnO nanoparticles have been synthesized in aqueous/alkali media at the presence of cotton fabrics and folic acid. Folic acid, as a biotemplate for synthesis of Cu2O/ZnO, was used to improve the reducing and stabilizing the ability of cotton fabric. Cotton fabric was used as a soft template to control the synthesis of desirable nanostructures with specific size and morphology.

    6. Formulation of Aluminum Chloride Phthalocyanine in Pluronic P-123 and F-127 Block Copolymer Micelles: Photophysical properties and Photodynamic Inactivation of Microorganisms

      Bruno Henrique Vilsinski, Adriana Passarella Gerola, Junior Adalberto Enumo, Katieli da Silva Souza Campanholi, Paulo Cesar de Souza Pereira, Gustavo Braga, Noboru Hioka, Elza Kimura, André Luiz Tessaro and Wilker Caetano

      Article first published online: 6 FEB 2015 | DOI: 10.1111/php.12421

      Thumbnail image of graphical abstract

      Formulations of aluminum chloride phthalocyanine were prepared in polymeric micelles of pluronic surfactants F-127 and P-123 and tested for inactivation of microorganisms. The process of incorporation of AlPcCl on copolymers was effective and the formulation obtained for the system AlPcCl/P-123 had good results against different kind of microorganisms.

    7. Solar Spectral Irradiance and Summary Outputs Using Excel

      Brian Diffey

      Article first published online: 6 FEB 2015 | DOI: 10.1111/php.12422

      Thumbnail image of graphical abstract

      An Excel spreadsheet that calculates solar spectral irradiance between 290–3000 nm on an unshaded, horizontal surface under a cloudless sky at sea level, together with summary outputs such as global UV index, illuminance and percentage of energy in different wavebands. The spreadsheet is easy to use by anyone with an interest in sunlight and solar power irrespective of their background in that just four inputs are required—geographical latitude, month, day of month and time of day.

    8. Light Treatment Improves Sleep Quality and Negative Affectiveness in High Arctic Residents During Winter

      Michel A. Paul, Ryan J. Love, Andrea Hawton, Kaighley Brett, Donald R. McCreary and Josephine Arendt

      Article first published online: 2 FEB 2015 | DOI: 10.1111/php.12418

      Thumbnail image of graphical abstract

      Subjects residing at Canadian Forces Station (CFS) Alert (82° 30′ 00″ N) filled out questionnaires regarding sleep difficulty, psychological well-being and mood and wore Actigraphs to obtain objective sleep data. Saliva was collected prior to and following treatment to measure melatonin and assess melatonin onset. Individuals were given individualized daily light treatment interventions based on their pretreatment salivary melatonin profile. The light treatments were effective in improving sleep quality and reducing negative affect among the participants.

  10. Special Issue Research Articles

    1. Opening Enediyne Scissors Wider: pH-Dependent DNA Photocleavage by meta-Diyne Lysine Conjugates

      Kemal Kaya, Madeleine Johnson and Igor V. Alabugin

      Article first published online: 29 JAN 2015 | DOI: 10.1111/php.12412

      Thumbnail image of graphical abstract

      Upon photochemical activation, meta-bis-tetrafluoropyridinylalkyne-lysine conjugates induce pH-dependent DNA ds-photocleavage. Efficiency of DNA damage is strongly enhanced at pH < 7. The observed pH-dependence of the DNA photocleavage activity stems from change in the protonation states of lysine amino groups. The ROS (Reactive Oxygen Species) scavenger experiments suggest that singlet oxygen is partially involved in the DNA damage.

  11. Research Articles

    1. Interaction of Crown Ether-Annelated Styryl Dyes with Double-Stranded DNA

      Daria V. Berdnikova, Olga A. Fedorova, Elena V. Tulyakova, Haixing Li, Sarah Kölsch and Heiko Ihmels

      Article first published online: 23 JAN 2015 | DOI: 10.1111/php.12405

      Thumbnail image of graphical abstract

      Binding of 15-crown-5-derived mono- and bis-styryl dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54.

  12. Special Issue Research Articles

    1. Absorption and Emission Sensitivity of 2-(2′-Hydroxyphenyl)benzoxazole to Solvents and Impurities

      Zhao Yuan, Qing Tang, Kesavapillai Sreenath, J. Tyler Simmons, Ali H. Younes, De-en Jiang and Lei Zhu

      Article first published online: 23 DEC 2014 | DOI: 10.1111/php.12393

      Thumbnail image of graphical abstract

      Minor long-wavelength absorption bands of the excited state intramolecular proton transfer (ESIPT) dye 2-(2′-hydroxyphenyl)benzoxazole (HBO) have been observed in DMSO by us and others. These bands might have been caused by base or metal salt impurities introduced by glass Pasteur pipettes that are equipped with latex rubber bulbs. Without the interference of extraneous bases or metal salts, solvent-mediated deprotonation fails to occur. The propensity of HBO to deprotonation is much higher in DMSO than in less polar solvents. The solvatochromic shifts of HBO suggest that the ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

    2. Steric and Electronic Factors Associated with the Photoinduced Ligand Exchange of Bidentate Ligands Coordinated to Ru(II)

      Bryan A Albani, Tyler Whittemore, Christopher B. Durr and Claudia Turro

      Article first published online: 23 DEC 2014 | DOI: 10.1111/php.12392

      Thumbnail image of graphical abstract

      In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT) with easily tunable excited state properties, the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complex 1 undergoes photoinduced ligand dissociation of the dpb ligand in coordinating solvent in the PCT window, however, the bimetallic complex is photoinert but does absorb lower energy light. The differences in the photophysical properties and the crystal structures of the complexes are discussed and used to explain the differences in photoreactivity.

    3. Transition from Charge-Transfer to Largely Locally Excited Exciplexes, from Structureless to Vibrationally Structured Emissions

      Ralph H. Young, Adam M. Feinberg, Joseph P. Dinnocenzo and Samir Farid

      Article first published online: 8 DEC 2014 | DOI: 10.1111/php.12380

      Thumbnail image of graphical abstract

      Exciplexes of 9,10-dicyanoanthracene with low oxidation potential (Eox) alkylbenzenes in cyclohexane show structureless emission spectra suggesting ideal charge-transfer (CT) states. With higher Eox donors, vibrational structure emerges. A theoretical model of mixing with a locally excited (LE) state reproduces the spectra and radiative rate constants. The fractional CT character of a highly mixed exciplex varies widely with fluctuations in the microscopic environment and/or librational geometry. Fluctuations favoring the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. The “ideal CT” appearance of the low-Eox spectra is illusory, resulting instead from several compensating factors.

    4. Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study

      Pascale Changenet-Barret, Ying Hua, Thomas Gustavsson and Dimitra Markovitsi

      Article first published online: 28 NOV 2014 | DOI: 10.1111/php.12379

      Thumbnail image of graphical abstract

      G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K+ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.

    5. Following Oxygen Consumption in Singlet Oxygen Reactions via Changes in Sensitizer Phosphorescence

      Tingting Feng, Tod A. Grusenmeyer, Max Lupin and Russell H. Schmehl

      Article first published online: 28 NOV 2014 | DOI: 10.1111/php.12381

      Thumbnail image of graphical abstract

      Photolysis of a Ruthenium-pyrene complex in oxygenated aqueous solutions results in efficient sensitization of singlet oxygen. In the presence of substrates, large increases in the orange luminescence of the Ruthenium-pyrene complex are observed as dissolved oxygen reacts with the substrate. Luminescence intensity changes allow determination of rate constants for singlet oxygen reaction with substrates.

    6. o-Amino Analogs of Green Fluorescence Protein Chromophore: Photoisomerization, Photodimerization and Aggregation-induced Emission

      Guan-Jhih Huang, Che-Jen Lin, Yi-Hung Liu, Shie-Ming Peng and Jye-Shane Yang

      Article first published online: 24 NOV 2014 | DOI: 10.1111/php.12373

      Thumbnail image of graphical abstract

      The GFP-like chromophore O0 undergoes solid-state [2 + 2] photodimerization to form a head-to-tail syn-oriented photodimer OD that is confirmed by X-ray crystallography. The excited-state “meta-ortho effect” of the amino analogs of GFP chromophore in solutions and aggregates is also established and discussed.

    7. Photoisomerization of cis-1,2-di(1-Methyl-2-naphthyl)ethene at 77 K in Glassy Media

      Christopher Redwood, V. K. Ratheesh Kumar, Stuart Hutchinson, Frank B. Mallory, Clelia W. Mallory, Ronald J. Clark, Olga Dmitrenko and Jack Saltiel

      Article first published online: 21 NOV 2014 | DOI: 10.1111/php.12367

      Thumbnail image of graphical abstract

      One bond twist photoisomerization of cis-I,2-di(1-methyl-2-naphthyl)ethene in glassy media.

    8. Comparison of Templating Abilities of Urea and Thioruea During Photodimerization of Bipyridylethyelene and Stilbazole Crystals

      Balakrishna R. Bhogala, Burjor Captain and Vaidhyanathan Ramamurthy

      Article first published online: 7 NOV 2014 | DOI: 10.1111/php.12353

      Thumbnail image of graphical abstract

      Templating properties of urea in solid-state photodimerization of stilbazoles and bispyridylethylenes have been established through a study that combined photochemistry and X-ray crystallography. The templating ability of urea derives from its ability to form hydrogen bond with itself and with coguests stilbazoles and bispyridylethylenes. At this stage, it is not easy to predict when urea will and when will not function as a template.

    9. Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins

      Almaz S. Jalilov, Ryan M. Young, Samuel W. Eaton, Michael R. Wasielewski and Frederick D. Lewis

      Article first published online: 30 OCT 2014 | DOI: 10.1111/php.12360

      Thumbnail image of graphical abstract

      The behavior of DNA conjugates having Michler's ketone hairpin linkers is dependent upon the ground state conformation of the linker. Linkers in which there is little interaction with the adjacent base pair undergo fluorescence and intersystem crossing to form a long-lived triplet state; whereas linkers that are stacked with an adjacent purine base undergo fast, reversible electron transfer.

    10. Photo-Wolff Rearrangement of 2-Diazo-1,2-naphthoquinone: Stern–Volmer Analysis of the Stepwise Reaction Pathway

      Manfred Ladinig, Markus Ramseier and Jakob Wirz

      Article first published online: 30 SEP 2014 | DOI: 10.1111/php.12341

      Thumbnail image of graphical abstract

      A quantitative assessment of the stepwise versus concerted photodeazotization pathways of 2-diazo-1,2-naphthoquinone (1) forming ketene 3 is provided. Trapping of the carbene intermediate 2 by methanol yields 2-methoxy-1-naphthol (4) in up to 12% yield. [3+2]Cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was also observed. The lifetime of the thermalized carbene 2 is at least 200 ps. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

    11. A New Series of Fluorescent Indicators for Super Acids

      I-Chih Shih, Yu-Shan Yeh, I-Che Wu, You-Hua Chen, Jiun-Yi Shen, Yi-An Chen, Mei-Lin Ho and Pi-Tai Chou

      Article first published online: 6 SEP 2014 | DOI: 10.1111/php.12326

      Thumbnail image of graphical abstract

      A new series of fluorescent indicators are developed for sensing super acids. The fluorescence intensity switches from the nonemissive state (the diprotonated form) to the intense emissive state (the triprotonated form) with pKa as low as −3.16. This super acid indicator with the highly emissive intensity, great chemical stability and excitation/emission wavelengths in the visible region may find potential applications in industry.

VIEW

  1. 1 - 40

SEARCH

SEARCH BY CITATION