Volume 19, Issue 4
RESEARCH ARTICLE
Free Access

Enhancing extracellular protein production in Escherichia coli by deleting the d‐alanyl‐d‐alanine carboxypeptidase gene dacC

Jinyuan Hu

The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, P. R. China

School of Biotechnology, Jiangnan University, Wuxi, P. R. China

Authors have contributed equally to this work.

Search for more papers by this author
Xiao Lu

The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, P. R. China

School of Biotechnology, Jiangnan University, Wuxi, P. R. China

Authors have contributed equally to this work.

Search for more papers by this author
Haokun Wang

The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, P. R. China

School of Biotechnology, Jiangnan University, Wuxi, P. R. China

Search for more papers by this author
Fuxiang Wang

The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, P. R. China

School of Biotechnology, Jiangnan University, Wuxi, P. R. China

Search for more papers by this author
Yuan Zhao

The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, P. R. China

School of Chemical and Material Engineering, Jiangnan University, Wuxi, P. R. China

Search for more papers by this author
Wei Shen

The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, P. R. China

School of Biotechnology, Jiangnan University, Wuxi, P. R. China

Search for more papers by this author
Haiquan Yang

Corresponding Author

E-mail address: haiquanyang@jiangnan.edu.cn

The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, P. R. China

School of Biotechnology, Jiangnan University, Wuxi, P. R. China

Correspondence

Haiquan Yang, The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi 214122, P. R. China.

Email: haiquanyang@jiangnan.edu.cn

Search for more papers by this author
Xianzhong Chen

The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, P. R. China

School of Biotechnology, Jiangnan University, Wuxi, P. R. China

Search for more papers by this author
First published: 22 January 2019
Citations: 1

Abstract

d‐Alanyl‐d‐alanine carboxypeptidase DacC is important for synthesis and stabilization of the peptidoglycan layer of Escherichia coli. In this work, dacC of E. coli BL21 (DE3) was successfully deleted, and the effects of this deletion on extracellular protein production in E. coli were investigated. The extracellular activities and fluorescence value of recombinant amylase, green fluorescent protein, and α‐galactosidase of the deletion mutants were increased by 82.3, 29.1, and 37.7%, respectively, compared with that of control cells. The outer membrane permeability and intracellular soluble peptidoglycan accumulation of deletion mutant were also enhanced compared with those of control cells, respectively. Based on fluorescence‐assisted cell sorting analyses, we found that the morphology of the E. coli deletion mutant cells was altered compared with that of control cells. Local transparent bulges in the poles of the E. coli mutant with deletion of the dacC gene were found by transmission electron microscopy analysis. These bulges in the poles could explain the improvement in the production of extracellular protein by the E. coli mutant with deletion of the dacC gene. These findings provide important insights into the extracellular production of proteins using E. coli as microbial cell factories.

Abbreviations

  • DCW
  • dry cell weight
  • FACS
  • fluorescence‐activated cell sorting
  • LMW
  • low‐molecular‐weight
  • NPN
  • N‐phenyl‐α‐naphthylamine
  • PBP
  • penicillin‐binding protein
  • TEM
  • transmission electron microscope
  • 1 INTRODUCTION

    There are several prokaryotic microorganism hosts used for production of recombinant proteins, including Escherichia coli and Bacillus subtilis 1, 2. E. coli, as one of hosts commonly used for recombinant protein expression, have many beneficial characteristics, including high expression and rapid growth 1, 3. Compared with intracellular expression, secretion of recombinant protein into the extracellular space provides several advantages, such as lack of proteolytic degradation and simple purification 2, 4-6. In addition, extracellular secretion of recombinant enzymes is important for metabolic engineering when substrates (such as toxic contaminants) are not fully absorbed by E. coli cells 4. However, most recombinant proteins are secreted into the periplasmic space of E. coli rather than directly secreted into the extracellular, with the exception of some proteins (e.g., toxins and erythrocyte haemolysin) 7.

    There are two main pathways for secretion of proteins into the extracellular medium in E. coli, i.e. active transport and passive transport 8. Instability of the internal and external composition of E. coli structures may lead to passive transport. At present, there are many ways to destroy the selectivity of E. coli membranes or partially destroy the outer membrane or cell wall to release periplasmic proteins, such as chemical methods (e.g. chloroform and glycine), lysozyme treatment, and physical methods (e.g. osmotic pressure) 5, 7-9. E. coli However, these methods may have destructive effects on the activity of the cells. In most cases, the recombinant protein in the periplasmic space is secreted outside of the cell because of serious damage to the integrity of the cell wall, resulting in cell death.

    The surface structure of the cell is critical for recombinant protein secretion by E. coli. For example, the addition of glycine disrupts the integrity of the peptidoglycan linker and structure and can thereby increase the extracellular production efficiency of recombinant proteins. As the main constituent of the cell wall, peptidoglycan contributes to cell structure robustness 10. Disruption of the surface structure of the cell, e.g. peptidoglycan and membrane components, can alter protein secretion 5, 11, 12. In our previous work, we investigated that recombinant proteins secretion in E. coli was enhanced by deleting or overexpressing d‐Alanyl‐d‐alanine carboxypeptidase DacA and DacB to perturb the surface structure of the cell 13, 14. Meanwhile, d‐Alanyl‐d‐alanine carboxypeptidase DacC is also critical for the formation and stabilization of the cell wall peptidoglycan layer of E. coli (Figure 1) 15, 16. When the activity of DacC is inhibited, the soluble peptidoglycan linked to the pentapeptide chain will form. Damage to the cell wall peptidoglycan can lead to an increase in the porosity of the peptidoglycan layer, which leads to loosening of the cell wall and enhanced permeability of the outer membrane 17. These effects then further enhance the accumulation of protein in the extracellular space.

    image
    Peptidoglycan biosynthesis in E. coli and the function of dacC gene on peptidoglycan biosynthesis. d‐Alanyl‐d‐alanine carboxypeptidases could remove the terminal d‐alanine from the pentapeptide side chains of murein components. UDP‐GlcNAc, UDP‐N‐acetylglucosamine; DacC, d‐Alanyl‐d‐alanine carboxypeptidase DacC

    Accordingly, in this work, we investigated the effects of deleting the dacC gene on extracellular protein production in E. coli BL21 (DE3) (Figure 1) and studied cell growth, outer membrane permeability, intracellular soluble peptidoglycan accumulation and morphology in the absence of dacC gene expression.

    2 MATERIALS AND METHODS

    2.1 Strains and vectors

    The strains, plasmids, and primers used in this work are listed in Tables 1 and 2. The GenBank accession nos. of green fluorescent protein (GFP) and AmyK were U70496.1 and KF751392, respectively.

    Table 1. Plasmids and strains used in this work
    Plasmids and strains Relevant genotype and characteristics Sources
    Plasmids
    pMD19‐T TA cloning TaKaRa
    pKD13 R6KY ori, KanR, AmpR, CmR CGSC
    pKD46 AmpR, helper plasmid CGSC
    pCP20 AmpR, CmR, helper plasmid CGSC
    pETDuet T7 promoters, pBR322 ori, AmpR Novagen
    pETDuet‐gfp pETDuet derivate with gfp cloned This work
    pETDuet‐amyk pETDuet derivate with amyk cloned This work
    Gene knockout cassette
    ΔdacC::kan KanR, knockout gene dacC This work
    Strains
    E. coli JM109 Cloning host Novagen
    E. coli BL21 Wild type E. coli BL21(DE3) Novagen
    BL21‐pKD46 E. coli BL21(DE3) derivate, including plasmid pKD46, AmpR This work
    BL21‐pETDuet BL21 derivate with plasmid pETDuet This work
    BL21‐pETDuet‐gfp BL21 derivate with plasmid pETDuet‐gfp This work
    BL21‐pETDuet‐amyk BL21 derivate with plasmid pETDuet‐amyk This work
    BL21‐ΔdacC::kan‐pKD46 BL21‐pKD46 derivate, deleting dacC This work
    BL21‐ΔdacC::kan BL21‐ΔdacC::kan‐pKD46 derivate, deleting plasmid pKD46 This work
    BL21‐ΔdacC BL21‐ΔdacC::kan derivate, deleting plasmid pKD46, and KanR This work
    BL21‐ΔdacC‐pETDuet BL21‐ΔdacC derivate with plasmid pETDuet This work
    BL21‐ΔdacC‐pETDuet‐gfp BL21‐ΔdacC derivate with plasmid pETDuet‐gfp This work
    BL21‐ΔdacC‐pETDuet‐amyk BL21‐ΔdacC derivate with plasmid pETDuet‐amyk This work
    Table 2. Nucleotide sequences of primers
    Oligonucleotidesaa FW represents Forward primers. RV represents Reverse primers.
    Sequences (5′ to 3′)bb Italic letters represent the restriction enzyme sites. Underline letters represent homologous sequences used for gene knockout.
    Plasmid construction
    GFP‐FW CGGAATTCATGAGTAAAGGAGAAGAACTTTTC
    GFP‐RV GAAGATCTTTATTTGTATAGTTCATCCATGC
    AmyK‐FW CCGGAATTCATGAGCGAGCTGCCGCAAATC
    AmyK‐RV CCGCTCGAGTTAAAAACCGCCATTGAAGGACG
    Gene knockout
    ΔdacC‐FW CGCCGAGCGTGGATGCGCGTGCATGGATTTTAATGGATTACGCCAGCGGTGTGTAGGCTGGAGCTGCTTC
    ΔdacC‐RS AGCGGACGCTGCTCAATGGATTTACCGTTAAGCTGGAAATCAATGGTCCCATTCCGGGGATCCGTCGACC
    • a FW represents Forward primers. RV represents Reverse primers.
    • b Italic letters represent the restriction enzyme sites. Underline letters represent homologous sequences used for gene knockout.

    2.2 Deletion of the dacC gene and construction of recombinant plasmids

    The dacC gene of E. coli BL21 (DE3) was deleted by Red homologous recombination 18. The primers and plasmids used in this work are listed in Tables 1 and 2. The gene knockout cassette containing the FRT locus was obtained by PCR amplification. To obtain the strain BL21‐pKD46, the plasmid pKD46 was transferred to E. coli BL21 (DE3). The knockout cassette ΔdacC::kan was transformed into BL21‐pKD46 by electroporation and screened to obtain the positive mutant BL21‐ΔdacC::kan‐pKD46. The plasmid pKD46 was removed at 37°C to obtain the mutant BL21‐ΔdacC::kan. The kanamycin‐resistance gene was eliminated using the plasmid pCP20, and the mutant BL21‐ΔdacC was obtained.

    The gfp gene was amplified by PCR with primers GFP‐FW and GFP‐RV (Table 2) and was linked to the plasmid pETDuet by EcoRI and BglII sites to construct the pETDuet‐gfp plasmid. The recombinant plasmid pETDuet‐gfp was then transformed into the mutant BL21‐ΔdacC to obtain the recombinant strain BL21‐ΔdacC‐pETDuet‐gfp. The amyk gene was amplified by PCR with primers AmyK‐FW and AmyK‐RV and was linked to the plasmid pETDuet by BamHI and XhoI sites to construct the pETDuet‐amyk plasmid. The recombinant plasmid pETDuet‐amyk was then transformed into the mutant BL21‐ΔdacC to obtain the recombinant strain BL21‐ΔdacC‐pETDuet‐amyk.

    2.3 Medium and culture conditions

    LB medium was used for seed culture, and TB medium was used for fermentation. The final concentrations of ampicillin and kanamycin in the culture medium were 50 and 30 μg/mL, respectively. The inoculation amount was 1.0% v/v, and the culture temperature was 37°C. E. coli were induced to express proteins by 1 mM isopropyl‐β‐d‐thiogalactoside (IPTG) at 25°C and with OD600 = 0.8.

    2.4 Cell density determination

    The E. coli fermentation broth (5 mL) was collected by centrifugation at 10 000 × g for 10 min at 4°C and washed with 10 mL 10 mM phosphate buffer (containing Na2HPO4, NaH2PO4, and NaCl, pH 7.4). The cells were then dried at 105°C for 2 h to determine the cell density.

    2.5 Preparation of intracellular and internal samples

    The E. coli fermentation broth was collected by centrifugation at 10 000 × g for 10 min at 4°C. The supernatant was used for extracellular enzyme activity or GFP fluorescence assays. The cells were washed with 10 mM phosphate buffer (containing Na2HPO4, NaH2PO4, and NaCl, pH 7.4) and resuspended in an equal volume buffer. Cells were rinsed with a quick grinding machine (JXFSTPRP; Shanghai Jingxin Industrial Development Co., Ltd., Shanghai, China). The supernatant was obtained by centrifugation at 15 000 × g for 15 min at 4°C and used for intracellular enzyme activity or GFP fluorescence assays.

    2.6 Detection of enzyme activity and GFP

    Amylase activity was determined by hydrolyzing soluble starch to obtain reducing sugars 2. One unit of amylase activity (U) was defined as the amount of enzyme required to catalyze the production of 1 μmol reducing sugar (calculated as glucose) at 50°C and pH 9.5 per min.

    The α‐galactosidase reaction mixture consisted of 100 μL enzyme solution, 50 μL of 10 mM p‐nitrophenyl α‐D‐galactospyranoside, and 50 μL of 100 mM citrate buffer (pH 5.8). The reaction temperature was 45°C, and the reaction time was 15 min. After the reaction, 0.25 mM Na2CO3 solution was used to terminate the reaction, and the absorbance at 400 nm (A400) was measured. The standard concentrations of p‐nitrophenol were 0, 0.2, 0.4, 0.6, 0.8, and 1.0 mM, and the standard curve was determined by measuring the A400. One unit of α‐galactosidase enzyme activity (U) was defined as the amount of enzyme required to release 1 μmol of p‐nitrophenol per min under the above conditions.

    The fluorescence intensity of GFP was measured using a multifunctional microplate reader and 96‐well plates. The excitation and emission wavelengths were 488 and 533 nm, respectively.

    2.7 Detection of outer membrane permeability

    N‐phenyl‐α‐naphthylamine (NPN; Shanghai Aladdin Bio Chem Technology Co., Ltd.), as a probe, was used to determine cell outer membrane permeability 13. Cells were induced by 1 mM IPTG at 25°C for 4 h and harvested to determine outer membrane permeability. The 200 μL cell suspension (OD600 = 0.5) and 20 μL 100 mM NPN were mixed. The fluorescence intensity was determined using a BioTek Cytation 3 microplate reader, the excitation and emission wavelengths of which were 350 and 420 nm, respectively.

    2.8 Detection of glucosamine

    The supernatant of lysed E. coli cells was freeze dried, 2 mg of which was dissolved in 1.5 mL hydrochloric acid (6 M) and incubated at 100°C for 1 h. The reaction was neutralized with NaOH solution, where distilled water was added to 10 mL (final volume). The absorbance at 440 nm (A440) was determined. The glucosamine concentration of the reaction above was calculated based on the standard curve. Glucosamine with different concentrations (0, 5.0, 10.0, 15.0, and 20.0 mg/L) was used to manufacture the standard curve 13. One milliliter mixture of acetylacetone and glucosamine were boiled for 25 min. One milliliter absolute ethyl alcohol and 1 mL para‐dimethylaminobenzaldehyde were added into the mixture boiled and held 1 h at 20°C. A440 was determined, and the standard curve of glucosamine was manufactured.

    2.9 Analysis of cell morphology

    E. coli cells were collected by centrifugation at 10 000 × g for 10 min at 4°C. The cells were then washed and resuspended using an equal volume of 10 mM phosphate‐buffered saline (containing Na2HPO4, NaH2PO4, and NaCl, pH 7.4). The cells were diluted to OD600 at 0.016 and analyzed with a FACSCalibur flow cytometer.

    E. coli were cultured in LB medium at 37°C for 8 h, and 20 μL of the culture was spread on the surface of LB media plates with 1 mM IPTG and induced at 25°C for 24 h. The morphology of the recombinant E. coli cells was analyzed using a Hitachi H‐7650 transmission electron microscope (TEM) 13, 19.

    2.10 Statistical analysis

    Experiments were independently performed at three times in this work, data of which were means ± standard deviation. The Student t‐test was used for statistical analyses 13. When the p‐value was less than 0.05, it was considered statistically significant.

    3 RESULTS

    3.1 Deletion of the dacC gene and its effect on cell growth

    The dacC gene was deleted from E. coli BL21 (DE3) using Red homologous recombination. As shown in Supporting Information Figure S1, the fragment size of the mutant BL21‐ΔdacC::kan containing the kanamycin‐resistance gene was 1604 bp, and the fragment size of the BL21‐ΔdacC strain was 368 bp after eliminating the resistance gene. These findings demonstrated that the positive mutant BL21‐ΔdacC was obtained.

    Next, the effects of deleting the dacC gene on the growth of E. coli cells were analyzed (Figure 2). As shown in Figure 2A, deletion of the dacC gene affected the maximum dry cell weight (DCW) of E. coli cells in LB medium. The maximum DCW of the mutant BL21‐ΔdacC was 5.1 g/L, which was slightly smaller than that of the control cells (6.0 g/L). Additionally, the maximum‐specific growth rate of E. coli deletion mutants was slightly improved compared with that of control cells (Figure 2B).

    image
    Effects of deleting dacC gene on cell growth. (A) Growth curve. DCW, dry cell weight. Asterisks, a significant difference compared with E. coli BL21 (none, > 0.05; * < 0.05; ** < 0.01). (B) Specific growth rate. E. coli BL21, wild type E. coli; BL21‐∆dacC, E. coli BL21 deleting dacC

    3.2 Effects of deleting the dacC gene on extracellular production of recombinant amylase in E. coli

    The recombinant plasmid pETDuet‐amyk containing the amyk gene encoding amylase was transformed into the mutant BL21‐ΔdacC with deletion of the dacC gene to obtain the recombinant mutant BL21‐ΔdacC‐pETDuet‐amyk. The study found that deleting the dacC gene significantly promoted the extracellular production capacity of recombinant amylase in E. coli (Figure 3A). The activity of extracellular recombinant amylase in the mutant BL21‐ΔdacC‐pETDuet‐amyk increased from (6.2 U/mL) for control cells to 11.3 U/mL at 36 h.

    image
    Effects of deleting dacC gene on the production of extracellular recombinant amylase in E. coli. (A) The activity of extracellular amylase; (B) The percentage of extracellular amylase activity for total activity. Asterisks, a significant difference compared with E. coli BL21 (none, > 0.05; * < 0.05; ** < 0.01)

    Next, we further analyzed the effects of deleting the dacC gene on the extracellular proportion of recombinant amylase produced in E. coli (Figure 3B). The rate of extracellular recombinant amylase activity to total amylase activity of the mutant BL21‐ΔdacC‐pETDuet‐amyk was significantly increased compared with that of the control cells. For example, the rate of extracellular recombinant amylase activity to total amylase activity of the mutant BL21‐ΔdacC‐pETDuet‐amyk increased significantly from 71.5 to 88.3% at 36 h.

    3.3 Effects of deleting the dacC gene on the extracellular distribution of GFP in E. coli

    We then analyzed the effects of deleting the dacC gene on the extracellular distribution of GFP in E. coli. As shown in Figure 4A, the fluorescence value of extracellular GFP in the mutant BL21‐ΔdacC‐pETDuet‐gfp increased from 87.5 AU/g/L to 113.0 AU/g/L, which was increased by 29.1% compared with the control. These data indicated that the mutant BL21‐ΔdacC‐pETDuet‐gfp was also favorable for the extracellular production of GFP after deleting the dacC gene in E. coli.

    image
    Effects of deleting dacC gene on the extracellular distribution of proteins, outer membrane permeability, and intracellular soluble peptidoglycan accumulation. (A) Effects of deleting dacC gene on the extracellular distribution of recombinant green fluorescent protein (GFP). (B) Effects of deleting dacC gene on the extracellular distribution of α‐galactosidase. Asterisks, a significant difference compared with E. coli BL21 (** < 0.01). (C) Outer membrane permeability. (D) Intracellular soluble peptidoglycan accumulation. Asterisks, a significant difference compared with E. coli BL21 (* < 0.05; ** < 0.01)

    3.4 Effects of deleting the dacC gene on the extracellular distribution of α‐galactosidase in E. coli

    The effects of deleting the dacC gene on the extracellular enzyme activity of α‐galactosidase in E. coli were also studied. As shown in Figure 4B, the extracellular α‐galactosidase activity of the mutant BL21‐ΔdacC‐pETDuet‐gfp reached 9.5 U/g, whereas that in the control strain BL21‐pETDuet‐gfp was only 6.9 U/g. These data indicated that the level of extracellular α‐galactosidase in the mutant BL21‐ΔdacC‐pETDuet‐gfp was significantly increased compared with that of the control cells.

    3.5 Effects of deleting the dacC gene on E. coli outer membrane permeability

    Herein, N‐phenyl‐α‐naphthylamine (NPN), as a probe, was used to investigate effects of deleting dacC gene on outer membrane permeability (Figure 4C). Deletion of dacC improved nonpolar or hydrophobic environment of cell membrane surface to increase the fluorescence intensity of NPN bound to cells. The NPN fluorescence intensity of the mutant deleting dacC (BL21‐∆dacC‐pETDuet) was 1.3 × 104 AU, which was increased by 51.9% compared with that control cells. It was indicated that deletion of dacC increased cells outer membrane permeability, which might a main reason of improving extracellular recombinant proteins.

    3.6 Effects of deleting the dacC gene on intracellular soluble peptidoglycan accumulation

    The glycan chains of peptidoglycan are consisted of N‐acetylmuramic acid and N‐acetylglucosamine residues 20. In this work, we determined the glucosamine concentration to reflect effects of deleting the dacC gene on intracellular soluble peptidoglycan accumulation (Figure 4D). The glucosamine concentration of deletion mutant BL21‐∆dacC‐pETDuet was 37.5 mg/g (DCW), and higher than that (33.5 mg/g (DCW)) of the control cells. It was indicated that deletion of the gene dacC increased intracellular soluble peptidoglycan accumulation in E. coli.

    3.7 Effects of deleting the dacC gene on the morphology of E. coli cells

    Next, we analyzed the effects of deleting the dacC gene on cell morphology by fluorescence‐activated cell sorting (FACS). The positive distribution of 1.0 × 104 cells was plotted to analyze the cell distribution of the E. coli mutant with deletion of the dacC gene (Figure 5A/B). Compared with the control strains, the cell morphology of the E. coli mutant with deletion of the dacC gene was altered. In order to quantify the number of cells, FACS gates were used as a stationary reference point to analyze the distributions of cell shapes. The fraction of E. coli mutant cells with deletion of the dacC gene among the gates at 0–5 × 104 forward‐scattered light was 60.5%, whereas that in control cells was 62.4%.

    image
    Effects of deleting the dacC gene on the morphology of E. coli cells. (A and B) The cell population distribution analyzed by Fluorescence‐activated cell sorting (FACS). Numbers of E. coli cells in y axis according to the amount of forward‐scattered light in x axis. (C and D) Transmission electron microscopy (TEM) analysis of cell morphology. (A and C) BL21‐pETDuet. (B and D) BL21‐ΔdacC‐pETDuet

    To further analyze the effects of deleting the dacC gene on the morphology of E. coli cells, the strains were analyzed by TEM. As shown in Figure 5C/D, the morphology of E. coli mutant cells with deletion of the dacC gene was significantly altered compared with that of control cells. Local transparent bulges were found in the poles of E. coli mutant cells with deletion of the dacC gene.

    4 DISCUSSION

    In this work, the dacC gene in E. coli BL21 (DE3) was successfully deleted by Red homologous recombination, and the mutant strain BL21‐ΔdacC was obtained. We found that deletion of the dacC gene did not inhibit the growth of E. coli BL21 (DE3) cells. Similarly, a previous study showed that DacC was not necessary for the growth of E. coli 15, and Broome‐Smith and Spratt also found that lack of the dacC gene had no marked effect on the growth of E. coli JBS200 21.

    The activity of extracellular recombinant amylase in the mutant BL21‐ΔdacC‐pETDuet‐amyk increased by 82.3% compared with that of the control cells. Additionally, the rate of extracellular recombinant amylase activity to total amylase activity in the deletion mutant was significantly increased compared with that of the control cells. This result could be explained by the observation that deleting the dacC gene improved the extracellular production of recombinant amylase in E. coli. Moreover, the deletion mutant BL21‐ΔdacC‐pETDuet‐gfp was also more favorable for the extracellular production of GFP compared with control cells, and the extracellular α‐galactosidase activity of the mutant BL21‐ΔdacC‐pETDuet‐gfp was increased by 37.7% compared with that of the control cells. These results indicated that deletion of the dacC gene affected the integrity of E. coli cells, which improved extracellular protein production in E. coli. Additionally, deletion of dacC may improve the secretion of chemical products with practical applications, such as those produced by metabolic engineering. DacC, as a low‐molecular‐weight (LMW) penicillin‐binding protein (PBP), has strict carboxypeptidase activity 22, allowing cleavage of the terminal d‐alanine from the pentapeptide side chains of murein components 15. DacC has a role in stabilization of peptidoglycan during the stationary phase 23. This could explain why deletion of the dacC gene significantly improved extracellular protein production in E. coli. Similarly, Shin and Chen found that deletion of the Braun's lipoprotein (LPP) gene lpp also improved extracellular protein production in E. coli 4. For lpp mutant E. coli, a periplasmic leaky phenotype was obtained, resulting in transportation of some proteins outside of the cell 24.

    The NPN fluorescence intensity of the mutant deleting dacC was enhanced compared with that of control cells, which was caused by nonpolar or hydrophobic environment of cell membrane surface of the deletion mutant cells. DacC, as one of four d‐Alanyl‐d‐alanine carboxypeptidases, could remove the d‐alaline from the terminal of pentapeptide side chains during peptidoglycan synthesis 25. Peptidoglycan is a critical component in maintaining E. coli cells structure stability and cell shape 26. It was presumed that deletion of dacC might disturb peptidoglycan structure and stability to increase cells outer membrane permeability, which might a main reason of improving extracellular recombinant proteins.

    Peptidoglycan is a major component of E. coli cell wall, the glycan chains of which are composed of N‐acetylmuramic acid and N‐acetylglucosamine residues 20. Peptidoglycan is made up of long glycan chains cross‐lined between the amino group of the diaminoacid at position 3 and the carboxyl group of D‐Ala at position 4 by short peptides 20. DacC, as one of key LMW PBPs with carboxypeptidase activity, could remove the terminal D‐Ala of the muramic acid pentapeptide side chains 25. In this work, the glucosamine concentration of deletion mutant was improved compared with that of the control cells, indicating that deleting dacC increased intracellular soluble peptidoglycan accumulation in E. coli. It was presumed that deletion of dacC perturbed peptidoglycan synthesis and structure stability. Perturbation of peptidoglycan synthesis and structure stability might be the main reason of enhancement of cell membrane permeability to improve extracellular production of recombinant proteins in E. coli.

    Notably, FACS analysis showed that deleting the dacC gene affected the morphology of E. coli cells. Moreover, TEM analysis showed that deletion of the dacC gene significantly altered the morphology of E. coli cells compared with that of control cells, and local transparent bulges were found in the poles of E. coli mutant cells. Thus, these findings suggested that deletion of the dacC gene may affect the structural stability and robustness of the E. coli cell wall. Peptidoglycan not only enables E. coli cells to resist intracellular pressure from the cell but also provides a well‐defined cell shape 22. Mutation of LMW PBPs could cause morphological aberrations in E. coli cells 27-29. DacC, as an important LMW PBP, could stabilize the peptidoglycan during the stationary phase 23, 30. Thus, deleting the dacC gene could lead to changes in cell morphology by decreasing stabilization of the cell wall 17, thereby improving extracellular protein production by the E. coli mutant.

    5 CONCLUDING REMARKS

    Deletion of the dacC gene increased the extracellular production of recombinant proteins (such as recombinant amylase and recombinant green fluorescent protein) in E. coli. The outer membrane permeability and intracellular soluble peptidoglycan accumulation of deletion mutant were also enhanced compared with those of control cells, respectively. d‐transparent bulges in the poles of the E. coli mutant with deletion of the dacC gene were found, which could explain the improvement in the production of extracellular protein by the E. coli mutant. These findings in this work provided important insights into the extracellular production of proteins using E. coli mutant with deletion of dacC gene as microbial cell factories.

    ACKNOWLEDGMENTS

    This work was financially supported by National Natural Science Foundation of China (21406089), Natural Science Foundation of Jiangsu Province (BK20140152), the Open Project Program of the Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, China (KLCCB‐KF201607), 111 Project (111‐2‐06) and Postgraduate Education Research and Practice Project of Jiangnan University (YJSJG2017004).

      CONFLICT OF INTEREST

      The authors have declared no conflict of interest.

        Number of times cited according to CrossRef: 1

        • Recent Developments in Bioprocessing of Recombinant Proteins: Expression Hosts and Process Development, Frontiers in Bioengineering and Biotechnology, 10.3389/fbioe.2019.00420, 7, (2019).

        The full text of this article hosted at iucr.org is unavailable due to technical difficulties.