Volume 121, Issue 1
RESEARCH ARTICLE
Free Access

Resistance of human primary mesenchymal stem cells to cytotoxic effects of nutlin‐3 in vitro

Babak Bajelan

Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Qazvin, Iran

Search for more papers by this author
Majid Zaki‐Dizaji

Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

Search for more papers by this author
Babak Rahmani

Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Qazvin, Iran

Search for more papers by this author
Sina Darzi

Department of Molecular Medicine, School of Advanced Technologies, Shahrekord University of Medical Sciences, Shahrekord, Iran

Search for more papers by this author
Shahram Darabi

Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Qazvin, Iran

Search for more papers by this author
Farzad Rajaei

Corresponding Author

E-mail address: farzadraj@yahoo.co.uk

Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Qazvin, Iran

Correspondence Farzad Rajaei, Professor of Anatomy, Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Qazvin 59811‐34197, Iran.Email: farzadraj@yahoo.co.uk

Search for more papers by this author
First published: 26 August 2019

Abstract

Background

The small‐molecule nutlin‐3 was found to be an effective therapeutic compound and p53 activator, and acts as a murine double minute 2 antagonist, although these findings need to be clinically confirmed. The essential components of the bone marrow include mesenchymal stem cells (MSCs), which play a key role in protecting, regenerating, and proliferating hematopoietic stem cells (HSCs). This feature is vital for HSC after exposure to myelotoxic anticancer agents; nevertheless, the effects of nutlin‐3 on MSCs remain to be disclosed. The present research study was conducted to examine the antiproliferative and proapoptotic effectiveness of nutlin‐3 in bone marrow MSCs (BMSCs).

Materials and Methods

Human‐derived BMSCs were cultured for different durations, that is, 24, 48, and 72 hours, and treated using various concentrations of nutlin‐3, including 5, 10, 25, 50, and 100 μΜ. To investigate the effect of nutlin‐3 on the apoptosis, cell vitality and proliferation in BMSCs, the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), thiazolyl blue tetrazolium bromide, propidium iodide (PI) and annexin V assay, as well as real‐time polymerase chain reaction, were used.

Results

BMSCs viability significantly decreased (P < .05) in the cells treated at concentrations of 50 and 100 μM for 24 hours and concentrations of 25, 50, and 100 μM for 48 hours and at all concentrations for 72 hours. The apoptosis of BMSCs (TUNEL positive) was significantly more visible at concentrations of 25 and 50 μM compared with that in the controls (P < .05), while this increased through dose‐dependent processes. Annexin V/PI staining revealed negligible dose‐dependent increases in all the apoptotic cells after 72 hours of incubation, and this apoptosis elevation was significant at 25 and 50 μM (P < .05).

Conclusion

Resistance to nutlin‐3 was observed in human bone marrow–derived MSCs; nevertheless, further clinical data are required to be obtained with long‐duration exposure to confirm the present findings.

1 INTRODUCTION

Despite extensive research and new treatments, medicine often remains helpless in the fight against cancer.1 In virtually all human cancers, uncontrolled proliferation of cancerous cells needs inactivation of the tumor protein p53 (TP53) protein function. Moreover, the deregulation of TP53 and the auto‐regulatory loop of murine double minute 2 (MDM2) are well‐known mechanisms contributing to tumor formation. MDM2 negatively regulates the function of TP53 in different cellular pathways, including apoptosis, cell cycle as well as senescence. It also suppresses the translation and transcription of the TP53 gene.2 MDM2 overexpresses in various human tumors via increased translation and transcription as well as amplification.3, 4 This overexpression is associated with chemo and radio‐resistance.5 Furthermore, the overexpression of the MDM2 gene is associated with weak prognosis in different cancers, including breast cancer, esophageal cancers, lung cancer, liposarcoma, stomach cancer, and glioblastomas.6

The high incidence of p53 pathway inactivation in cancer makes it an attractive target of therapeutic intervention strategies. Preventing the interaction of TP53 with MDM2 through the reactivation of wild‐type P53 has proved to be a therapeutic strategy for inducing the proapoptotic property and growth inhibiton of TP53.7 In this regard, recently nutlin‐3, as an MDM2 antagonist, has come to prominence in cancer therapeutic research. This compound protects TP53 from binding with MDM2 and consequently activates TP53.8 Nutlin‐3 was found to induce cell migration, growth inhibition, and apoptosis in different cancer cells.9-14 Moreover, research suggests that nutlin‐3 induces apoptosis and suppresses cell growth in the absence of wild‐type TP53 through the TP53 homolog of p73,15, 16 and sensitizes TP53‐defective cancer cells to different anticancer agents, such as arsenic trioxide,17 radiation,18 and doxorubicin.19 However, for reasons such as dose‐related toxicity and drug resistance, it is currently not clinically used.20 Preclinical studies found nutlin‐3 to present treatment potential for human cancer cells with wild‐type TP53. Nutlin‐3 appears to be cytostatic medicine for the proliferation of normal cells while inducing p53‐dependent apoptosis in cancer cells, including osteosarcoma,21 colon cancer,22 lung cancer,23 acute myelogenous leukemia,24 chronic lymphocytic leukemia,25 squamous cell carcinomas of the head and neck,26 and glioblastoma.27

Mesenchymal stem cells (MSCs) are composed of an incoherent category of adult multipotent stromal cells, which can be detected in different tissues, including the bone marrow.28 MSCs have been found to be valuable in animal models for rebuilding organs damaged by different anticancer agents, and these regenerative effects of stem cells are likely to be used for similar toxicities found following nutlin‐3‐based treatments.29, 30 Nutlin‐3 has conferred long‐term protection from cell cycle‐specific chemotherapeutics to normal human fibroblasts and the epithelial cell line in culture, so these cells proliferated after removal of chemo‐drugs.31, 32 The effect of nutlin‐3 on human's MSCs, however, should be identified. Rat‐derived BMSCs were found to be relatively resistant to nutlin‐3.33 The present research seeks to investigate the effectiveness of nutlin‐3 in the proliferation and survival of MSCs obtained from human bone marrow (BMSCs).

2 MATERIALS AND METHODS

2.1 BMSCs isolation and culture

BMSCs were procured from the Royesh Stem Cell Biotechnology Institute Cell Bank (Tehran, Iran) and were cultured on Dulbecco's modified Eagle's medium (DMEM) (made by Gibco, Germany). This media contained 10% fetal bovine serum (FBS made by Gibco, Germany) as well as antibiotics, including 100 U/mL of both streptomycin and penicillin, and it was incubated at 85% humidity in 5% CO2 and at 37°C. With 80% confluence, the BMSCs were collected and rinsed in phosphate‐buffered saline (PBS), and passed through 0.25% of trypsin/ethylenediaminetetraacetic acid. The cells from four passages were used for the following assays.

2.2 In vitro cytotoxicity assessment

Thiazolyl blue tetrazolium bromide (MTT) (Sigma‐Aldrich Co) was used to assess cytotoxicity. Nutlin‐3 was dissolved in 2 mM of dimethyl sulfoxide and diluted in the cell medium before being used. The 5000 cell/100 μL/well were seeded on plates with 96 wells (SPL Lifesciences, Korea), and cultured in DMEM, which was supplemented with 10% FBS and 100 U/mL of both penicillin and streptomycin. The cells were treated for 24, 48, and 72 hours using 5, 10, 25, 50, and 100 μM of nutlin‐3. Two hundred microliters of MTT (5 mg/mL) was used to incubate these cells at 37°C for 2 hours. Metabolically active cells reduce MTT tetrazolium salt to formazan. After the solubilization of precipitated formazan with 100 μL of dimethyl sulfoxide, optical densitometry was read at 578 nm. IC50 is defined as a concentration of nutlin‐3 that decreases the cell population growth by 50% compared with the controls.

2.3 Assessment of cell apoptosis

2.3.1 TUNEL assay

A total of 10, 25, and 50 μM of nutlin‐3 was used to treat BMSCs for 72 hours in 96 well plates. The In Situ Cell Death Detection Kit (Roche, Germany) and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay were used to detect apoptotic cells. The kit manufacturer's instructions were followed to carry out the procedures. Finally, the samples were visualized under a multimode microplate reader (Biotek, Cytation 3). Fluorescein integration was visualized using fluorescein isothiocyanate filter sets, while PI filter sets were used for nuclear staining.

2.3.2 Annexin V and propidium iodide staining

BMSCs were cultured in six‐well plates with a density of 5 × 105/mL per well. After treating these cells using 10, 25, and 50 μM of nutlin‐3 for 72 hours, and collecting and centrifuging them at 1000 rpm for 5 minutes, the culture medium was discarded. After rinsing the cells in PBS and centrifuging them, the supernatant was removed. Afterwards, the cells’ temperature was set at 4°C for 1 to 2 hours using 70% cold ethanol. Centrifugation was also performed to remove the ethanol. The cells were resuspended for 5 minutes in 3 mL of PBS and filtered and then centrifuged at 1500‐rpm for 5 minutes. One milliliter of propidium iodide (PI) and FITC‐annexin V were used to stain the cells in the dark for 30 minutes at 4°C.

2.4 RNA extraction and analysis of gene expression

A High Pure RNA Isolation Kit (Roche, Germany) was used to isolate the total RNA from MSCs. The RNA isolated was stored at –80°C in water free of RNase. A Nanodrop ND‐1000 (Nanodrop Technologies) was used to assess the RNA concentration.

The complementary DNA (cDNA) synthesis of 1 μg of the total RNA was conducted using a RevertAid First Strand Synthesis Kit (Thermo Fisher Scientific) as per the manufacturer's protocol.

The quantitative real‐time polymerase chain reaction (qPCR) test conducted with 20 μL included the Maxima SYBR Green/ROX qPCR master mix (10 μL) (Thermo Fisher Scientific), cDNA samples (2 μL), forward and reverse primers (0.5 μL of each) and nuclease‐free water (7 μL) (Qiagen, Hilden, Germany). An ABI Step‐One Plus qRT‐PCR machine was used for real‐time quantification PCR. The thermal cycle was as follows: an initial 30‐second activation step at 95°C, a 45‐cycle 5‐second denaturation step at 95°C and a 30‐second annealing/extension step at 60°C. Table 1 presents the primers sequences and the amplicon size. Actb (actin β) was used to normalize Cycle thresholds (Cts), which were calibrated in the controls, that is, untreated cells, and all ran simultaneously under the same conditions. According to the urn:x-wiley:07302312:media:jcb29324:jcb29324-math-0001 formula, the relative fold change of every target was calculated.

Table 1. Sequences and amplicon size of primers
Gene Primer Size, bp
TP53 F ACATAGTGTGGTGGTGCCCT 177
R ACCTCAAAGCTGTTCCGTCC
MDM2 F TACTGTGTATCAGGCAGGGGA 153
R CAATTCTCACGAAGGGCCCAA
P21 F TTGTACCCTTGTGCCTCGCT 110
R AGTGGTAGAAATCTGTCATGCTGG
PUMA F GACCTCAACGCACAGTACGAG 98
R AGGAGTCCCATGATGAGATTGT
ACTB F GAGAAAATCTGGCACCACACC 177
R GGATAGCACAGCCTGGATAGCAA
  • Abbreviations: ACTB, actin β; MDM2, murine double minute 2; PUMA, p53 upregulated modulator of apoptosis; TP53, tumor protein p53.

2.5 Statistical analyses

Statistical analyses were conducted by the use of GraphPad Prism 6 (GraphPad Software). The results of the two groups were compared using the independent t test. The data were presented as mean ± standard deviation. P < .05 was set as the level of statistical significance. Each test was conducted at least three times.

3 RESULTS

3.1 Morphology of BMSCs

Figure 1 shows that the morphology of the BMSCs was spindle‐like and almost uniform. A higher dose of treatment of BMSCs with a nutlin‐3 kills these cells. As is evident in Figure 1B‐D, 25 μM of nutlin‐3 time‐dependently reduce cell density.

image

The morphology and qualification of bone marrow mesenchymal stem cells measured with optic microscopy. Morphology observations associated with 4th generation BMSCs, (A) before the treatment, (B) cells treated with 25‐μM nutlin‐3 for 24 hours, (C) 48 hours, and (D) 72 hours

3.2 Viability of BMSCs under nutlin‐3 treatment

The MTT assay was performed to determine the potential inhibitory effects of nutlin‐3 treatment on the metabolic potential of BMSCs and cell proliferation. Viability decreased time and dose‐dependently in comparison to control (Figure 2). Significant reductions were observed in the viability of BMSCs in the cells treated for 24 hours at concentrations of 50 and 100 μM as well as for 48 hours at concentrations of 25, 50, and 100 μM (P < .05). Moreover, significant reductions were observed in the viability at all doses for 72 hours (P < .05). The obtained results suggest the cytotoxic effects of higher doses of nutlin‐3 on BMSCs.

image

The effect of nutlin‐3 on the BMSCs viability. MTT analysis was conducted to assess the cell viability. BMSCs were treated for 24, 48, and 72 hours using 0, 5, 10, 25, 50, and 100 μM of nutlin‐3, respectively. The presented data are mean values obtained from four independent tests, all of which were compared with the controls. BMSC, bone marrow mesenchymal stem cell; MTT, thiazolyl blue tetrazolium bromide

3.3 Apoptotic effect of nutlin‐3 on BMSCs

Figures 1B‐D and 3A present the morphological phenotype of BMSCs stained with PI and treated with nutlin‐3. The DNA fragmentation of apoptosis was identified in BMSCs using the TUNEL assay. Figure 3 shows the apoptotic cells stained with TUNEL. According to Figure 3A, TUNEL‐positive cells were frequently observed at concentrations above 10 μM of nutlin‐3. Nevertheless, these cells were almost absent from the BMSCs in the control and 10‐μM group. Based on the apoptotic index, TUNEL‐positive BMSCs were significantly higher at concentrations of 25 and 50 μM compared with the controls (P < .05). They also increased in a dose‐dependent fashion (Figure 3B).

image

Assessing apoptosis in BMSCs treated with nutlin‐3 using the TUNEL assay. BMSCs were treated for 72 hours with 0, 10, 25, and 50 μM of nutlin‐3. A, The TUNEL assay revealed apoptosis in BMSCs. Green denotes the TUNEL‐positive cells as apoptotic. Red denotes the cell nuclei counterstained by propidium iodide. B, Data presented as mean ± SD were obtained from three independent tests. Treated groups were compared with the controls. BMSC, bone marrow mesenchymal stem cell; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling. *P < .05, ***P < .001

Annexin V/PI was used to perform the apoptosis measurement and flow cytometry to perform the PI staining and analyze nutlin‐3‐treated BMSCs (Figure 4A). A small dose‐dependent upsurge was observed in the total apoptotic cells at 10 μM of nutlin‐3 after 72‐hour incubation, but this apoptosis elevation was significant at 25 and 50 μM (P < .05, Figure 4B).

image

Evaluating apoptosis in bone marrow mesenchymal stem cells treated with nutlin‐3 using annexin/propidium iodide staining. A, The cells were treated for 72 hours with 10, 25, and 50 μM of nutlin‐3. B, Treated groups were compared with the control group. *P < .05

3.4 Effects of nutlin‐3 on the transcriptional levels of MDM2, P21, p53 upregulated modulator of apoptosis, and TP53

To explore the transcriptional modulation of nutlin‐3 on the apoptosis pathway genes, transcriptional levels associated with MDM2, P21, p53 upregulated modulator of apoptosis (PUMA) and TP53 were assessed following nutlin‐3 exposure. As Figure 5 shows, the messenger RNA (mRNA) levels associated with P21, MDM2, PUMA, and TP53 were augmented dose‐dependently following a 72‐hour nutlin‐3 treatment. This increase is evident and significant in all genes at 50 μM.

image

Effects of nutlin‐3 on the transcriptional levels of MDM2, TP53, PUMA, and P21. qPCR was conducted to measure the relative mRNA expression of each gene in BMSCs treated with nutlin‐3 after normalizing with Actb. The values are presented as Mean ± SD. The treated groups were compared with the controls. MDM2, murine double minute 2; PUMA, p53 upregulated modulator of apoptosis; qPCR, quantitative real‐time polymerase chain reaction; TP53, tumor protein p53. *P < .05, **P < .01, ***P < .001

4 DISCUSSION

MSCs may participate in bone marrow regeneration after myeloablative chemotherapeutic treatment. These cells have formerly displayed resistance to numerous anticancer treatments such as ionizing radiation, Cisplatin, and topoisomerase inhibition.34-37 Recently, nutlin family compositions have been introduced as key to MDM2‐TP53 intervention in cancer treatment. nutlin‐3 was the first compound in this family that was shown to have efficacy in vivo and in vitro22, 38, 39; nevertheless, the effect of nutlin‐3 has not been yet fully confirmed on human bone marrow stem cells, especially MSCs. To evaluate the viability and apoptosis in BMSCs treated with 0, 10, 25, and 50 μM of nutlin‐3, the present study performed the MTT and TUNEL assay, and annexin V/PI staining. BMSCs were found to be rather resistant to the nutlin‐3 treatment.

The nutlin‐3 compound reactivates wild‐type TP53 both in normal and tumor cells; however, it seems to particularly kill tumor cells.22 With an IC50 of 1 to 2 μM, nutlin‐3 inhibits the cell growth in cancer cell lines with wild‐type TP53. This inhibition was observed in cell lines with mutated‐type TP53 with 13 to 21 μM of nutlin‐3.22 Given that at lower doses nutlin‐3 fails to present clear proliferation inhibition (the associated data were not presented), doses above 5 μM were utilized. The MTT test was performed to investigate the effect of nutlin‐3 on the growth and stability of BMSCs and showed that these cells are somehow resistant to nutlin‐3 (Figure 2). After treating BMSCs using nutlin‐3 for 24 and 48 hours, viability at 50 and 100 μM were significantly reduced in contrast to untreated cells. In line with the present research, a recent report found nutlin‐3 to inhibit the growth and viability of human skin cell line (1043SK) with an IC50 of 2.2 μM and the mouse embryo cell line (NIH/3T3) with an IC50 of 1.3 μM. Compared with cancer cells, these cells stay viable 1 week after treatment with nutlin‐3 even at 10 μM.22 In our study, about 90% of the cells were alive at 10 μM and the IC50 was 97 μM at 72 hours. These results support the argument that interventions using agents that affect cell cycle checkpoints, that is, nutlin‐3, could potentially protect normal cells against hemotherapeutic effects while maintaining onco‐toxicity.40

Nutlin‐3 has been found to exert inhibitory effects on cellular processes, including cell cycle progression, apoptosis and differentiation.22, 41-43 The present study assessed the mRNA expression of the cell cycle and apoptosis genes, and also functionally evaluated apoptosis. Similar to earlier studies in other antitumor agents,34, 35, 37 natural cells, like BMSCs, are less affected by nutlin‐3 compared with cancerous cells (Figures 3 and 4). In DNA damaging agents, this resistance to apoptotic activation has been attributed to a decreased p73‐dependent activation of proapoptotic proteins, Bax and p21,44 suppressing Bax/Bak activation,45 cell cycle arrest in G1 and/or G2,31 and the overexpression of numerous antiapoptotic proteins, including B‐cell lymphoma‐extra large and B‐cell lymphoma 2.46 Furthermore, MSCs were found to eliminate the activation of the TNF‐related apoptosis‐inducing ligand proapoptotic pathway in the treatment with cisplatin.47 The exact mechanism contributing to the different effects of nutlin‐3 on normal and cancer cells is yet to be understood. This may be due to the ability of nutlin‐3 to inhibit uncontrolled proliferation of cancerous cells48 and inducing reversible quiescence in normal cells.11, 49 Further studies are therefore recommended to focus on understanding the molecular mechanisms of nutlin‐3 in normal cells compared with in cancer cells.

MDM2 antagonists stabilize p53 by targeting a small hydrophobic pocket on MDM2, to which p53 normally binds. This p53 stabilization causes the upregulation of p53 downstream transcriptional targets, including genes encoding BAX, BBC3 (p53 upregulated modulator of apoptosis [PUMA]), and p21.50 In the present study, treatment with nutlin‐3 dose‐dependently induced the senescence and cell cycle arrest‐related gene, the auto‐regulatory negative feedback gene, P21, MDM2, apoptotic genes, PUMA, and TP53 (Figure 5). Overall, this study is similar to former reports that demonstrated nutlin‐3 induces expression of TP53,14 P21,14, 22, 41, 50 MDM2,14, 50-53 and PUMA.50, 52, 53 A study on nutlin‐1 showed this compound induces expression of TP53 in cancer cells at the protein level but not in mRNA level.22 This discrepancy of results can be explained by the differences in the concentration of nutlin‐3 in the present study compared with that in similar studies.

The outcome of TP53 reactivating therapies on normal cells is of utmost concern, which includes the stabilization of TP53 causing increased apoptosis in these cells. These cells were found to be relatively resistant to nutlin‐3 in rats33 and human BMSCs. Consistently, nutlin‐3 has conferred long‐term protection from mitotic inhibitors to the normal human fibroblast and epithelial cell line in culture.31, 32 Also, oral administration of nutlin‐3 efficiently protected mice from side effects caused by a mitotic inhibitor (BI‐2536).54 However, recent clinical trials with RG7112, a new member of the nutlin family, showed adverse side effects, mostly hematological in nature.55-57 Accordingly, additional clinical studies with long‐term exposure may support our results. Finally, we highlight the need for further investigations aiming to clarify the mechanisms responsible for MSC resistance to nutlin‐3, as the importance of these cells in the tumor microenvironment context is well known.

ACKNOWLEDGMENTS

This study was financially supported by the grant from Qazvin University of Medical Sciences, Qazvin, Iran.

    CONFLICT OF INTERESTS

    The authors declare that there are no conflict of interests.

    AUTHOR CONTRIBUTIONS

    BB: wrote the paper. MZ‐D: performed statistical analysis. BR: contributed to cell culture and molecular tests. SD: contributed to flow cytometry, MTT, and TUNEL analysis. ShD: participated in the final editing of the manuscript. FR: supervised the work and provided comments and additional scientific information.

      The full text of this article hosted at iucr.org is unavailable due to technical difficulties.