Volume 8, Issue 12
ORIGINAL ARTICLE
Open Access

Genomic instability of TnSMU2 contributes to Streptococcus mutans biofilm development and competence in a cidB mutant

Matthew E. Turner

Department of Microbiology and Cell Science, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA

Search for more papers by this author
Khanh Huynh

Department of Microbiology and Cell Science, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA

Search for more papers by this author
O’neshia V. Carney

Department of Microbiology and Cell Science, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA

Search for more papers by this author
Dennis Gross

Department of Microbiology and Cell Science, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA

Search for more papers by this author
Ronan K. Carroll

Department of Biological Sciences, Ohio University, Athens, OH, USA

Search for more papers by this author
Sang‐Joon Ahn

Department of Oral Biology, College of Dentistry, University of Florida, Gainesville, FL, USA

Search for more papers by this author
Kelly C. Rice

Corresponding Author

E-mail address: kcrice@ufl.edu

Department of Microbiology and Cell Science, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA

Correspondence

Kelly C. Rice, Department of Microbiology and Cell Science, IFAS, University of Florida, PO BOX 110700, Gainesville, FL 32611, USA.

Email: kcrice@ufl.edu

Search for more papers by this author
First published: 09 October 2019

Abstract

Streptococcus mutans is a key pathogenic bacterium in the oral cavity and a primary contributor to dental caries. The S. mutans Cid/Lrg system likely contributes to tolerating stresses encountered in this environment as cid and/or lrg mutants exhibit altered oxidative stress sensitivity, genetic competence, and biofilm phenotypes. It was recently noted that the cidB mutant had two stable colony morphologies: a “rough” phenotype (similar to wild type) and a “smooth” phenotype. In our previously published work, the cidB rough mutant exhibited increased sensitivity to oxidative stress, and RNAseq identified widespread transcriptomic changes in central carbon metabolism and oxidative stress response genes. In this current report, we conducted Illumina‐based genome resequencing of wild type, cidB rough, and cidB smooth mutants and compared their resistance to oxidative and acid stress, biofilm formation, and competence phenotypes. Both cidB mutants exhibited comparable aerobic growth inhibition on agar plates, during planktonic growth, and in the presence of 1 mM hydrogen peroxide. The cidB smooth mutant displayed a significant competence defect in BHI, which was rescuable by synthetic CSP. Both cidB mutants also displayed reduced XIP‐mediated competence, although this reduction was more pronounced in the cidB smooth mutant. Anaerobic biofilms of the cidB smooth mutant displayed increased propidium iodide staining, but corresponding biofilm CFU data suggest this phenotype is due to cell damage and not increased cell death. The cidB rough anaerobic biofilms showed altered structure relative to wild type (reduced biomass and average thickness) which correlated with decreased CFU counts. Sequencing data revealed that the cidB smooth mutant has a unique “loss of read coverage” of ~78 kb of DNA, corresponding to the genomic island TnSMU2 and genes flanking its 3′ end. It is therefore likely that the unique biofilm and competence phenotypes of the cidB smooth mutant are related to its genomic changes in this region.

1 INTRODUCTION

Although dental caries is considered a microbial shift disease within the human oral cavity (Marsh, 2006; Mira, Simon‐Soro, & Curtis, 2017; Sanz et al., 2017), Streptococcus mutans is highly associated with caries formation (Garcia et al., 2017; Loesche, 1986). S. mutans utilizes a variety of carbohydrates to power a fermentation‐based metabolism featuring adaptive pyruvate usage based on the growth environment (Abbe, Takahashi, & Yamada, 1982; Yamada & Carlsson, 1975; Yamada, Takahashi‐Abbe, & Abbe, 1985). Acidic end products from this metabolism, including lactic acid (Hojo, Komatsu, Okuda, Takahashi, & Yamada, 1994), build up in complex biofilms attached to the tooth surface, leading to the dissolution of enamel, and the formation of dental caries. Biofilm formation is a major virulence factor of S. mutans. Extracellular polysaccharide (EPS) synthesized by glucosyltransferases (GTFs) help the organism attach to tooth surfaces (Tsumori & Kuramitsu, 1997) and entomb the bacterium in a complex matrix that can protect it from antibiotics and fluid shearing (Fernández, Aspiras, Dodds, González‐Cabezas, & Rickard, 2017; Shen, Stojicic, & Haapasalo, 2011). Biofilms also form an intricate microenvironment limiting oxygen exposure (Wessel et al., 2014), sequestering nutrients (Hwang et al., 2016), and establishing pH gradients (Xiao et al., 2012). Extracellular DNA (eDNA) is also a major component of oral biofilms. Reports have shown eDNA to be distributed widely in Enterococcus faecalis biofilms, as well as biofilms generated from clinically collected human saliva samples (Rostami et al., 2017). The presence of eDNA is also important for S. mutans biofilm formation and regulated cell death (Perry, Cvitkovitch, & Lévesque, 2009).

Oral streptococci such as S. mutans can also utilize eDNA for genetic exchange via natural competence. In S. mutans, two quorum‐sensing systems have been characterized in regulation of competence. In peptide‐rich growth media, the competence‐stimulating peptide (CSP, encoded by comC)‐based system is used. CSP is a 21AA peptide which is released into the extracellular environment via ComAB. The peptide is then processed by the protease SepM (Hossain & Biswas, 2012) into a final 18AA form which can be recognized by the ComDE two‐component system. ComD is a histidine kinase which phosphorylates ComE, a response regulator, which then can activate bacteriocin genes, such as nlmC, and provide negative regulatory feedback for comC (Kreth et al., 2007). Phosphorylated ComE indirectly leads to comX activation, the alternative sigma factor involved in the regulation of competence genes (Li et al., 2002), yet the process by which this occurs remains unclear. Alternative to CSP, a 7AA peptide identified as comX‐inducing peptide (XIP) is processed from ComS, which can directly activate comX expression through the regulator ComR. Exported XIP is imported via the Opp permease and forms a complex with ComR, which then binds upstream of the gene encoding the XIP peptide, comS, and comX (Mashburn‐Warren, Morrison, & Federle, 2010). Opp‐mediated uptake is blocked by peptide‐rich media, but ComS has also been demonstrated to participate in competence signaling without leaving the cell (Underhill et al., 2018). While both CSP and XIP induce competence in alternative ways, addition of synthetic forms of either peptide has been shown to stimulate a comX response (Son, Ahn, Guo, Burne, & Hagen, 2012).

The S. mutans cidAB transcriptional unit encodes two proteins (CidA and CidB) which have been shown to affect a multitude of virulence traits including biofilm development and oxidative stress response (Ahn, Rice, Oleas, Bayles, & Burne, 2010). Expression of cidAB has also been shown to be regulated by catabolite control protein A (CcpA; Kim, Waters, Turner, Rice, & Ahn, 2019). While the close homologs of CidA/B, LrgA/B, have recently been characterized in Bacillus subtilis as a transporter of pyruvate (Charbonnier et al., 2017; Esker, Kovács, & Kuipers, 2017), the exact function of the Cid/Lrg proteins in S. mutans remains unknown. Expression data have shown that cidAB RNA levels are upregulated during anaerobic growth (Ahn, Wen, & Burne, 2007) and by growth in the presence of excess glucose (Ahn et al., 2010). Transcriptomic data collected under anaerobic conditions also suggest an interesting effect on the expression of genomic islands (GIs) TnSMU1 and TnSMU2 (Ajdić et al., 2002) of S. mutans in a cidB mutant (Ahn & Rice, 2016). Many of the genes encoded within these regions were found to be significantly upregulated in a cidB mutant as compared to wild type under the same conditions, possibly indicating a link between Cid and these mobile genetic elements (MGEs).

Genomic islands are a major class of MGE commonly acquired via horizontal gene transfer events. There are two identified GIs within the S. mutans UA159 genome designated TnSMU1 and TnSMU2 (Ajdić et al., 2002). TnSMU2 is large, consisting of over 50 kb, and is flanked by transposase remnants. It also has a distinct shift in G + C nucleotide content (~28%) relative to the rest of the S. mutans genome (37.5%; Waterhouse & Russell, 2006). The primary coding regions within this island have been characterized as a cluster containing nonribosomal peptide synthases, polyketide synthases, and accessory proteins involved in pigment synthesis as well as oxidative stress tolerance and biofilm formation (Wu et al., 2010). The region also contains a TetR‐like regulator, SMU.1349, which can act as both as an activator for TnSMU2 genes and as a repressor of its own expression (Chattoraj, Mohapatra, & Rao, 2011). It is also notable however that TnSMU2 is not present in all S. mutans strains, with several studies reporting a range of clinical isolates failing to generate PCR products with primers targeted to this GI (Lapirattanakul et al., 2008; Wu et al., 2010).

During routine culturing of the S. mutans cidB mutant from different laboratory frozen glycerol stock cultures, we recently noticed the presence of two stable phenotypes based on colony morphology: a “rough” variant and a “smooth” variant. While the rough variant had been utilized for previous studies characterizing the physiological role of cidB (Ahn & Rice, 2016; Ahn et al., 2010), discovery of the smooth variant was novel. Hi‐depth genome resequencing revealed this morphological difference may stem from the loss of TnSMU2, as well as an additional ~20 kb on the island's 3′ end. In this report, we explore the physiological differences between the cidB rough and cidB smooth mutants in relation to the presence or loss of the TnSMU2 region, respectively. Critical S. mutans physiological functions such as genetic competence, oxidative and acid stress resistance, and biofilm formation were also compared between UA159 and both cidB mutant variants. As a whole, this work addresses the physiological role(s) that cidB and TnSMU2 play in S. mutans UA159, and reinforces a previously established regulatory connection (Ahn & Rice, 2016) between these two loci.

2 MATERIALS AND METHODS

2.1 Bacterial strains and growth conditions

For each experiment below, S. mutans UA159 and/or its isogenic cidA (∆cidA::Kmr, nonpolar (NP)), cidB rough and smooth (∆cidB:: NPKmr), and cidAB (∆cidA:: ΩKmr) mutants created in (Ahn et al., 2010) were streaked from frozen glycerol stocks on Brain Heart Infusion (BHI, Oxoid, UK) containing 1 mg/ml kanamycin for the cid mutants. A S. gordonii DL‐1 pyruvate oxidase (spxB) mutant (Huang et al., 2016) was generously provided by the laboratory of Dr. Robert Burne (University of Florida). S. gordonii DL‐1 and/or its isogenic spxB mutant were cultured on BHI (+1 mg/ml kanamycin for the spxB mutant). Unless otherwise stated, all agar plates, biofilms, and planktonic S. mutans and S. gordonii cultures were grown at 37°C in a 5% CO2 incubator, in either BHI, semidefined biofilm medium (BM; Loo, Corliss, & Ganeshkumar, 2000) containing 20 mM sucrose, or FMC media (Terleckyj, Willett, & Shockman, 1975). E. coli JM110 harboring the plasmid pOri23 (Que, Haefliger, Francioli, & Moreillon, 2000) was grown in aerobic conditions (37°C, 250 RPM) in Luria‐Bertani (LB Lennox, BD) broth with erythromycin (300 µg/ml). All glycerol stock cultures were maintained at −80°C and were prepared by mixing equal volume of overnight with sterile 80% (vol/vol) glycerol in cryogenic tubes.

2.2 Colony morphology comparisons

To compare general trends in colony morphology between S. mutans UA159 and the cidA, cidB, and cidAB mutants, cells were grown 16–18 hr and then serially diluted in BHI. An equal volume (100 µl) of each 10–7 dilution was spread‐plated onto BHI agar plates and incubated for 48 hr at 37°C in either a regular plate incubator (atmospheric conditions), an incubator supplemented with 5% CO2, or in an anaerobic environment (Pouch‐Anaero anaerobic Gas Generating System, Mitsubishi Gas Chemical Company, Japan). Representative colony images from n = 3 independent experiments were then captured using a Zeiss Stemi 305 Microscope and corresponding Labscope software (Zeiss, Germany). All images were taken at 10× magnification using darkfield settings.

2.3 Genomic DNA isolation, Illumina Resequencing, and SNP analysis

To analyze and identify single nucleotide polymorphisms (SNPs) and other sequence changes, genomic DNA (gDNA) was isolated from S. mutans UA159, cidB rough, and cidB smooth strains. Cells were grown to late exponential phase (Optical density at 600 nm (OD600) between 0.5–0.8) in BHI, at which time cell pellets were harvested from 7 ml of culture by centrifugation (3,900 × g, 10 min). DNA extractions were performed using the Promega Wizard Genomic DNA Purification Kit (Wisconsin, USA) with the following modifications: Following cell pellet resuspension in 50 mM ethylenediaminetetraacetic (EDTA) acid, cells were lysed with 100 µl of 10 mg/ml lysozyme and 20 units mutanolysin (Sigma‐Aldrich) at 37°C, 50 RPM, for 60 min. Total gDNA was precipitated in isopropanol for 1 hr, at room temperature, on a mixing platform, and gDNA pellets were washed once with room temperature 70% ethanol and air‐dried before being solubilized per kit instructions. The gDNA concentration, A260/A280, and A260/A230 ratios were quantified using a Nanodrop (Thermo Fisher) to ensure gDNA quality: DNA concentration above 100 ng/µl, A260/A280 between 1.8 and 2.0, and A260/A230 between 2.0 and 2.2. Samples were then submitted to the University of Florida Interdisciplinary Center for Biotechnology Research (ICBR) for library construction using the NEB Ultra II PCR‐based library construction protocol. Qubit and TapeStation were performed on the final libraries to calculate nM quantity prior to pooling libraries using equimolar amounts. Genome resequencing was performed using the Illumina MiSeq 2x300 platform with Illumina v3 sequencing reagents. Sequence analysis was then performed using CLC Genomics Workbench (Qiagen) using basic variant detection with a 90% minimum frequency cutoff, as described in (Mashruwala et al., 2016).

2.4 Real‐time PCR (qPCR)

Relative copy number of genes located within and outside of the low‐coverage TnSMU2 region of the cidB smooth mutant were verified using quantitative real‐time polymerase chain reaction (qPCR). Total gDNA was isolated from wild‐type, cidB rough, and cidB smooth strains as described above and was used as template with the primer sets indicated in Table 1. qPCRs were performed using iQ SYBR Green Supermix (Bio‐Rad, California, USA), 30 ng gDNA per reaction, and with primers at 250 nM per reaction on a Bio‐Rad CFX Connect Real‐Time System with the following conditions: 95°C for 3 min and 34 cycles of 95°C for 15 s followed by 55°C for 30 s. Relative copy number was then compared using the reported CT value for each reaction.

Table 1. qPCR primers used in this study
Primer name Sequence
bacA2‐F 5′‐ACAAGTGGGCGATGTAGTTG‐3′
bacA2‐R 5′‐TCAATTGGCGTTCCCGAATC‐3′
comE‐F 5′‐CAGTATCAGGTATCTGCTTTGGA‐3′
comE‐R 5′‐TGACCATTCTTCTGGCTGTT‐3′
gbpC‐F 5′‐TGAACCAACGCCAGAAAAGC‐3′
gbpC‐R 5′‐CACGCTCTCTAACACGCATTTC‐3′
pdhB‐F 5′‐ACATGTCAGCTTCTGTTGGG‐3′
pdhB‐R 5′‐AACGCATTTTCGACCCTTGG‐3′

2.5 Aerobic growth assay

Growth of S. mutans UA159 and isogenic cid mutants in aerobic conditions was assayed using a Bioscreen C automated growth system (Growth Curves USA). S. mutans cells were grown 16–18 hr in a chemically defined media (FMC; Terleckyj et al., 1975) and then diluted to an OD600 of 0.02 per milliliter in fresh FMC. A honeycomb well plate (Growth Curves USA) was then inoculated at a 1:4 well to volume ratio, and cell optical density was recorded over 24 hr with constant shaking at 37°C.

2.6 Acid tolerance assay

Each strain's ability to withstand acid stress was assayed by measuring cell viability over time after exposure to low pH conditions. Cells were first grown 16–18 hr in BHI and then diluted to an OD600 of 0.02 in 5 ml of fresh BHI. Cultures were then grown for 4 hr before cells were harvested via centrifugation. Supernatant was then removed, and cell pellets were resuspended in 5 ml of 0.1 M glycine buffer at a pH of either 3.5 or 7, and incubated at 37°C, 5% CO2. Samples were then removed at 0, 20, 40, 60, and 90 min incubation and serially diluted before being plated on BHI agar. Total colony‐forming units (CFUs) were then enumerated after 48 hr growth at 37°C in a 5% CO2 incubator.

2.7 Dot drop competition assays

The ability of wild‐type and cid mutant strains to compete against S. gordonii DL‐1 and its isogenic spxB mutant was determined by a dot drop competition assay as described previously (Kreth, Merritt, Shi, & Qi, 2005). In brief, S. gordonii or spxB mutant cells were grown overnight for 16–18 hr in 0.5x BHI media and then diluted to an OD600 of 0.5 in fresh 0.5× BHI media. About 10 µl was then dropped onto 0.5× BHI (Difco, BD) agar, and the plate was incubated overnight at 37°C in 5% CO2. The following day, 10 µl of each S. mutans competing species was inoculated alongside the S. gordonii drop in a similar manner and allowed to incubate an additional 24 hr at 37°C in 5% CO2 before being photographed.

2.8 Hydrogen peroxide (H2O2) tolerance assay

To quantify the ability of the cidB mutant variants to tolerate exogenous H2O2, cells were challenged with 1 mM H2O2 in chemically defined FMC media. Cells were cultivated in FMC for 16–18 hr, then diluted to an OD600 of 0.02 in 3 ml fresh FMC. H2O2 (Fisher Scientific) was then added to a final concentration of 1 mM, and a 48‐well plate (Corning, Costar #3548) was inoculated with 500 µl of each strain in triplicate. OD600 was then measured at 2‐hr intervals over 24 hr using a Cytation 3 plate reader (BioTek, Vermont, USA) with incubation at 37°C.

2.9 Confocal microscopy and COMSTAT of static biofilms

In order to identify possible differences in biofilm formation between the cidB mutant variants, 5% CO2 and anaerobic biofilms were cultivated in BM media (Loo et al., 2000) containing 20 mM sucrose. Cells were first cultivated in BHI for 16–18 hr and then diluted to an OD600 of 0.02 in 3 ml fresh BM media. An optically clear 96‐well plate (Corning, Costar #3614) was then inoculated with 200 µl of each strain in triplicate. Biofilms were grown for 48 hr at 37°C either in atmospheric conditions supplemented with 5% CO2 or in a Pouch‐Anaero Anaerobic Gas Generating System for anaerobic growth. Biofilm culture supernatant was removed from each well prior to staining with the LIVE/DEAD BacLight Bacterial Viability Kit (Invitrogen, USA) using Syto‐9 (0.5 µl/ml) and propidium iodide (PI; 1.5 µl/ml) to detect live and dead/damaged cells, respectively. Imaging was performed on a Zeiss LSM 800 Confocal Light Microscope using ZEN software (Zeiss, Germany). Z‐stacks were generated using 0.5 µm slices at 63 × objective magnification with two random, center fields of view per well. Quantification of biofilm statistics was performed using COMSTAT (Heydorn et al., 2000) running on MATLAB R2010a (MathWorks) with manual thresholding on individual images collected on separate days.

2.10 Cell viability measurement of static anaerobic biofilms

To assay biofilm cell viability, UA159, cidB rough, and cidB smooth biofilms were cultivated in semidefined sucrose biofilm media in anaerobic pouches as described above. After 48 hr growth, growth media was removed, and biofilms were scraped and resuspended in sterile 0.85% NaCl. Serial dilutions were plated on BHI agar, and total CFUs were then enumerated after 48 hr growth at 37°C in a 5% CO2 incubator.

2.11 CSP competence assays

To assay the ability of the cid mutants to take up externally added plasmid DNA, a quantitative competence assay was performed using a previously published protocol (Seaton, Ahn, Sagstetter, & Burne, 2011) with the following modifications: S. mutans UA159 and isogenic mutant strains were grown in BHI broth for 16–18 hr at 37°C in a 5% CO2 incubator. Overnight cultures of each strain were diluted to an OD600 of 0.02 in BHI and then grown in a 96‐well plate to an OD600 of 0.13–0.15 before the addition of 81 ng plasmid DNA (methylated or unmethylated pOri23, as indicated in the results section), with or without addition of synthetic CSP (sCSP, Sigma‐Aldrich) to a final concentration of 0.5 µg/ml per culture. After 2.5 hr of further incubation at 37°C and 5% CO2, cultures were serially diluted and plated on BHI agar with and without selective antibiotic (erythromycin, 10 µg/ml). The number of colony‐forming units per milliliter (CFU/ml) of each culture was enumerated after 48 hr growth at 37°C in a 5% CO2 incubator. The transformation efficiencies were calculated as the percentage of transformants (CFU/ml on BHI + selective antibiotic) among total viable cells (CFU/ml on BHI).

2.12 XIP competence assays

Transformation efficiencies in chemically defined media were determined as described above, except that cultures were grown in defined FMC media (Terleckyj et al., 1975) and were supplemented with 1 µg synthetic SigX‐inducing peptide (sXIP, Sigma‐Aldrich) and 500 ng unmethylated pORI23 when cultures reached an OD600 of 0.135–0.15.

2.13 Statistical analysis

All statistical analyses were performed using SigmaPlot 13.0 (Systat Software). Data were tested for normality and equal variance prior to selection of appropriate parametric or nonparametric tests as indicated in each figure legend. Number of biological replicates analyzed in each experiment is specified in each figure legend.

3 RESULTS

3.1 The cidB mutant yields two stable colony phenotypes

During routine culturing of cidB mutant frozen glycerol stocks, it was recently noted that two variant colony morphologies formed when struck out onto a BHI plate and grown in 5% CO2 supplemented conditions. One cidB variant was rough and granular matching the colony phenotype of the parental wild‐type strain S. mutans UA159, as well with isogenic cidA and cidAB mutants (Figure 1). The other cidB variant was observed to be smooth and round, lacking the granularity of both wild‐type and the cidB “rough” mutant (Figure 1). When grown anaerobically, this morphology repeated itself with the cidB “smooth” variant remaining round and mucoid while each of the other strains maintained their rough shape and granularity. When cultured in conditions with atmospheric levels of oxygen, both cidB colony variants, as well as the cidAB mutant, failed to grow (Figure 1), as was observed in our previous publication (Ahn et al., 2010). However, aerobic growth of the wild‐type and the cidA mutant displayed consistent colony morphology to that observed in anaerobic and CO2 supplemented growth conditions. Thus, the two cidB mutant variants were renamed: cidB rough for the granular variant and cidB smooth for the round, mucoid variant. Both cidB variant colony morphologies were deemed stable, as repeated subculturing from frozen glycerol stocks and colonies of cidB rough and cidB smooth always yield all rough or smooth colonies, respectively.

image
Influence of growth environment on S. mutans colony morphology. S. mutans wild‐type (UA159) and isogenic cid mutants were grown on BHI plates at 37°C for 48 hr in either normal atmospheric conditions (“aerobic”), 5% CO2, or in an anaerobic pouch. All images were taken at 10× magnification and are representative of n = 3 independent experiments

3.2 The cidB smooth mutant genome has lost TnSMU2 and neighboring genes

In order to determine what genetic variations may have led to altered colony morphologies of the cidB rough and cidB smooth variants, high depth whole genome resequencing was performed. Total gDNA was extracted from each of wild‐type UA159, cidB rough, and cidB smooth, which were then sequenced using a MiSeq Illumina Platform to a depth of 1,000 reads. Deletion of the cidB gene was confirmed in both cidB variants (Figure A1 in Appendix), with a small degree of aligned read noise attributed to cidB’s sequence homology to the lrgB gene (SMU.575c). Single nucleotide polymorphisms (SNPs) were identified based on differences from the S. mutans UA159 reference genome (NC_004350.2) and showed two SNPs within the wild‐type genomic resequencing that were not found in either cidB mutant (Table 2). SNP analysis of both cidB variants displayed many of the same SNPs as the isogenic wild‐type strain (Tables 2-A2 in Appendix), but also presented four variations found in both cidB variants that were not present in the reference genome or our wild‐type strain (Table 1). Additionally, a major read coverage gap was identified in the cidB smooth mutant genome, corresponding to the TnSMU2 genomic island, in addition to ~20 kb of sequence on the region's 3′ end (Figure 2, bottom). This low‐coverage area starts at the beginning of TnSMU2, the gene bacD or mubD (Wu et al., 2010), and ends ~76kb downstream with SMU.1406c (a hypothetical protein of unknown function) (Figure 2). This entire area was found with full coverage in both the wild‐type and cidB rough strains (Figure 2, top and middle).

Table 2. Summary of SNP analysis
Strain Nucleotide Change relative to published genome (NC_004350.2) Overlapping annotation Amino acid change
UA159 (SNP not present in either cidB mutant) G → T fic, SMU.1207 A78D
G → C aspB, SMU.1312c A77G
cidB rough and cidB smooth (not present in UA159) A → G SMU.12 Y33C
C → T pgi, SMU.307 R258C
A → G pgi, SMU.307 E293G
C → G dltA, SMU.1691c A466P
image
Wild‐type, cidB rough, and cidB smooth gDNA resequencing results displaying TnSMU2 and surrounding region. Mapped reads to TnSMU2 and surrounding area are displayed in green (forward only reads), red (reverse only reads), blue (read in both directions), and yellow (repetitive sequence motifs) to depth of 1,000 reads. Sequenced reads for S. mutans wild‐type (UA159, top) and the isogenic cidB rough variant (middle) show full presence of the TnSMU2 genomic island along with immediately neighboring regions. The corresponding genomic region of cidB smooth (bottom) displays significantly lower coverage for this region, as well as an approximately 20 kb section on the island's 3′ end

Given that coverage of the TnSMU2 region by sequence reads was not completely absent in the cidB smooth mutant, qPCR was also performed on gDNA isolated from wild type, cidB rough, and cidB smooth, using primers specific for genes both within and outside the “low‐read coverage” TnSMU2 region of the cidB smooth strain. Primers were generated for two genes inside of the low‐coverage region, bacA2 and gbpC, as well as two genes outside of the region, pdhB and comE (Table 1). Relative copy numbers were determined as a function of the CT values generated by each qPCR, with higher CT values indicating lower levels of initial gDNA template copy number available for amplification. Analysis of CT values for those genes outside of the TnSMU2 region indicated similar abundance for each of pdhB and comE, with little difference in CT values noted between each of the three strains (Figure 3). CT values for bacA2 and gbpC products were also comparable between wild type and cidB rough, with mean CT values of ranging from 12 to 13. In the cidB smooth variant however, these CT values were significantly higher, ranging from 30 to 31 for gbpC and bacA2 products (Figure 3). Although these qPCR data correlate with the sequencing read coverage patterns observed in wild type, cidB rough, and cidB smooth (Figure 2), it is not clear whether the TnSMU2 genomic region is in very low abundance or completely absent in the cidB smooth variant.

image
qPCR gene copy measurements of TnSMU2‐related genes. Relative copy numbers were determined by qPCR using wild‐type (UA159), cidB rough, and cidB smooth genomic DNA. The CT value represents the qPCR cycle at which detectable amplification occurred for each gene product. Data represent the average of n = 3 (wild type, cidB rough) or n = 4 (cidB smooth) independent experiments; error bars display standard deviation with * denoting statistical significance relative to wild type (Dunn's test (bacA2) or Holm–Sidak (gbpC), p < .05)

3.3 Both cidB mutant variants are more sensitive to oxidative stress but display comparable acid tolerance relative to wild type

As a defect in oxidative stress tolerance had been previously observed in the cidB rough mutant (Ahn & Rice, 2016), we proceeded to compare each cidB variant's ability to survive aerobic growth conditions relative to wild type and other cid mutants. When grown in defined FMC media with constant shaking, the cidA mutant displayed an increased lag phase compared to wild type with a lower final cell density after 24 hr (Figure 4). Growth of the cidAB mutant and both cidB mutant variants was severely impaired in this assay, as all three strains failed to rise above an OD600 of 0.05, remaining at baseline at timepoints when the cidA mutant entered exponential growth (10 hr) or reached peak optical density (24 hr) (Figure 4). A small, linear increase in OD600 was noted in cidB rough starting at 15 hr growth, but this increase was minimal.

image
Influence of cid mutations on aerobic growth. Growth curves of wild‐type S. mutans (UA159) and the cid panel of mutants under aerobic challenge. Cells were grown in FMC media using an automated Bioscreen C growth curve system with constant shaking at 37°C. Data are the representatives of n = 3 independent experiments

In order to explore possible oxidative stress tolerance differences between the cidB variants with a peroxygenic competitor, dot drop competition assays were then performed with the oral commensal S. gordonii. Growth inhibition of all S. mutans strains in this assay was observed when challenged with wild‐type S. gordonii (Figure 5a, top and middle). However, the cidB smooth mutant appeared to display greater growth inhibition compared with wild type and cidB rough (Figure 5a, middle and bottom). In contrast, inhibition of cidA and cidAB mutants by wild‐type S. gordonii was more modest and similar to S. mutans UA159 (Figure 2a in Appendix). Growth inhibition was rescued for all strains when challenged with a pyruvate oxidase (spxB) mutant strain (defective in H2O2 production) of S. gordonii (Figure 5b and Figure A2b in Appendix). In a confirmatory experiment, wild‐type variant and each cidB mutant variant were also grown planktonically in the presence of 1 mM H2O2 (Figure 5c), which demonstrated that both cidB mutants displayed comparable growth inhibition relative to the wild‐type strain. Collectively these results suggest that although both cidB variants are comparably deficient in tolerating planktonic aerobic growth and chemical 1 mM H2O2 challenge (Figures 4, 5c), the cidB rough mutant may be better able to tolerate H2O2 stress generated by S. gordonii on BHI agar plates relative to cidB smooth, presumably due to its intact TnSMU2 locus.

image
Dot drop competition between S. mutans cidB mutants and S. gordonii, and quantitative H2O2 challenge assay. The ability of S. gordonii wild‐type (Sg) (a) and isogenic spxB mutant (b) to inhibit S. mutans wild‐type (UA159) and isogenic cidB mutant growth was assessed using a dot drop competition assay as described in Materials and Methods. Data represent n = 3 independent experiments. The ability to grow planktonically in FMC containing 1 mM H2O2 was also quantified in all three strains by OD600 measurements over a 24‐hr period (C). Data represent n = 3 independent experiments, error bars = SEM

The ability for each cidB mutant variant to tolerate acid stress was also assessed by challenging wild type and each strain to pH 3.5 (Figure A3 in Appendix). In this experiment, all strains displayed comparable decreases in cell viability over time in the pH 3.5 treatment condition (~99% loss of viability by 90 min) and demonstrated similar levels of survival in the pH 7.0 control condition. These results suggest that neither CidB nor TnSMU2 is required for acid tolerance under the conditions tested in this study.

3.4 Both cidB and the TnSMU2 genomic region influence S. mutans biofilm structure

Biofilm formation is another key physiological process of S. mutans which has been previously described as impacted by the Cid/Lrg system (Ahn et al., 2010). Both CO2 and anaerobic growth conditions were chosen in order to study the alterations in biofilm formation due to the presence of oxygen. Visualization of each biofilm by LIVE/DEAD staining (Figure 6) revealed a full, healthy looking wild‐type biofilm consisting primarily of live (green) cells (Figure 6, left). The anaerobic wild‐type biofilm appeared thicker in the horizontal cross‐sectional view, with many of the holes or pockets in the CO2 biofilm (Figure 6, top left) replaced with a more homogenous mat of cells (Figure 6, bottom left). The cidB rough mutant appeared to have decreased biofilm production under anaerobic growth conditions (Figure 6, middle), with a noted reduction of cell mass seen in the biofilm cross sections. Increased red/yellow signal (as a result of PI staining) was observed in the cidB smooth anaerobic biofilm (Figure 6, bottom right) indicating an increased presence of dead and/or damaged cells within the biofilm matrix. The cidB smooth CO2 biofilm also appeared to have decreased thickness, as also observed in both the top‐down and cross‐sectional views (Figure 6, right). An interesting honeycomb‐like pattern was also observed in both growth conditions for the cidB smooth mutant (Figure 6, right).

image
Representative biofilm images of wild‐type, cidB rough, and cidB smooth mutants. Confocal microscopy images of wild‐type, cidB rough, and cidB smooth biofilms grown for 48 hr in semidefined media with 20 mM sucrose. Biofilms were stained for viable (green) or dead/damaged (red) using Syto‐9 and propidium iodide, respectively. Images show the orthogonal view of the biofilm centered on a Z‐stack in the first third and are representative of n = 18–27 random fields of view taken over n = 3–5 independent experiments

To quantify viability of the anaerobic 48 hr biofilms, CFU plating was performed in a parallel experiment (Figure 7a). Although increased PI staining was observed in the cidB smooth mutant (Figure 6, bottom right), this did not translate to decreased viability as assessed by CFU counts, and in fact, CFU counts were significantly higher in the cidB smooth mutant compared to wild type (Figure 7a), which could indicate that its increased population of PI‐stained cells represents a damaged but viable subpopulation of the biofilm. Interestingly, a significantly decreased level of viable cells was observed by CFU counts in the cidB rough mutant compared to wild‐type (Figure 7a). COMSTAT analysis of wild‐type and both cidB mutant biofilms was also performed to quantify biofilm parameters of each strain (Figure 7b‐d). These analyses revealed a modest trend in increased biofilm biomass and thickness for wild type during anaerobic growth compared with CO2 growth, but these results were not statistically significant (p > .05, Mann–Whitney rank sum test, Figure 7b, c). The opposite trend was noted however with the roughness coefficient (Figure 7d), whereby wild‐type anaerobic biofilm values were significantly reduced relative to wild‐type CO2 biofilms (p < .001, Mann–Whitney rank sum test), suggesting that anaerobic wild‐type biofilms are more homogenous than CO2 grown samples. The cidB rough mutant biofilms were closely matched to wild type in terms of biomass, thickness, and roughness coefficient in the CO2 growth condition, but anaerobic cidB rough mutant biomass and thickness were reduced almost twofold compared with wild‐type under this same condition (Figure 7b, c), which correlates with the decreased CFU counts observed in this strain (Figure 7a). An almost threefold increase in roughness coefficient was also observed in the anaerobic cidB rough biofilm relative to wild‐type (Figure 7d). In contrast to cidB rough, the cidB smooth mutant biofilms displayed significantly (p < .05, Holm–Sidak Test) decreased average biomass and thickness during CO2 growth compared with wild‐type (Figure 7b, c), and a significantly increased (p < .05, Dunn's test) roughness coefficient (Figure 7d). Biofilm growth of the cidB smooth mutant under anaerobic conditions minimized these differences compared with wild‐type. Qualitative examination of these images (Figure 6), along with COMSTAT quantification of biofilm metrics, suggests that both cidB mutant variants have altered biofilm properties that are observed in opposite growth conditions. Given that the increased cell PI staining phenotype was unique to the cidB smooth mutant, it is likely that this is associated with genomic loss of TnSMU2 and/or neighboring genes.

image
CFU and COMSTAT analysis of wild‐type, cidB rough, and cidB smooth biofilms. Quantification of viable biofilm cells by CFU serial dilution plating (a) was performed on 48 hr UA159 (wild‐type), cidB rough, and cidB smooth anaerobic biofilms. Data represent n = 3 biological replicates, error bars = SEM. * represents significant difference compared to wild type (p < .01, Holm–Sidak). Total biomass (b), average biofilm thickness (c), and the roughness coefficient (d) were quantified using pixel density and calculated through the COMSTAT algorithm (Heydorn et al., 2000) in MATLAB. The roughness coefficient represents the heterogeneity of the biofilm surface, with higher values indicative of a less uniform surface. Light bars represent biofilms generated during CO2 growth, and dark bars represent biofilms generated during anaerobic conditions. Data represent the average of n = 18–27 random fields of view acquired over n = 3–5 independent experiments. Error bars = standard error of the mean (SEM), * represents significant difference between CO2 growth conditions compared to wild type (p < .05, Holm–Sidak for biomass and thickness, Dunn's test for Roughness coefficient), ** represents significant difference between anaerobic growth conditions compared to wild type (p < .05, Dunn's test), # represents significant difference between anaerobic wild type and CO2 wild type (p < .001, Mann–Whitney rank sum test)

3.5 Mutation of cidB and loss of TnSMU2 correlate with altered competence

We had previously observed that mutation of lrgA leads to CSP‐related competence deficiency (Ahn, Qu, Roberts, Burne, & Rice, 2012). Therefore, the influence of cid genes on the ability of S. mutans to uptake foreign DNA was tested in this study using quantitative competence assays in both complex and defined media. Both media were tested in order to probe both the CSP‐ and XIP‐mediated competence systems found within S. mutans. With addition of synthetic CSP (sCSP), each of the wild type and cid mutants had similar transformation efficiencies (Figure 8 and Figure A4 in Appendix) with cidB smooth being slightly lower than wild type and the cidB rough variant (Figure 8a). As expected, transformation efficiencies without the addition of sCSP were dramatically lower for all strains. However, the cidB smooth transformation efficiency was significantly lower (~1 log reduction, p < .05, Student–Newman–Keuls test) compared with the wild‐type strain and cidB rough (Figure 8a). Mutation of either cidA or cidAB did not alter transformation efficiency in BHI media in the presence or absence of sCSP (Figure A4 in Appendix).

image
CSP (a) and XIP (b) competence assays. (a) Transformation efficiencies of wild type (UA159), cidB smooth, and cidB rough in complex BHI media. Light bars depict efficiencies with added sCSP, and dark bars depict efficiencies without sCSP. Data represent n = 5 independent experiments. Error bars represent SEM, with * denoting statistical significance (p < .05, Student–Newman–Keuls test) compared to wild type. (b) Transformation efficiencies of S. mutans strains in defined FMC media supplemented with sXIP. Data represent n = 3–4 independent experiments. Error bars represent SEM, with * denoting statistical significance (p < .05, Holm–Sidak test) compared to wild type

When grown in defined media and supplemented with synthetic XIP (sXIP), distinct phenotypes were observed with each cidB variant. The transformation efficiency of the cidB rough variant was modestly decreased compared with wild type (Figure 8b; ~0.5 log decrease, p = .014, Holm–Sidak Test), but the cidB smooth mutant transformation efficiency was significantly lower with a ~1.5 log decrease in transformation efficiency compared with wild‐type (p < .001, Holm–Sidak Test) and a ~1 log difference compared with cidB rough (p = .043, Holm–Sidak Test). These results indicate that deletion of cidB also negatively impacts S. mutans genetic competence during growth in defined media, but the loss of TnSMU2 and/or neighboring genes increases this effect significantly.

4 DISCUSSION

In order to successfully persist and cause disease within the oral cavity, S. mutans must be able to survive numerous environmental stresses. The cidB gene has been shown to be an important contributor to the oxidative stress response of S. mutans with wide‐ranging effects on expression of numerous metabolic genes and the GI TnSMU2 (Ahn & Rice, 2016). Our characterization of each cidB mutant variant has both confirmed the role of cidB in S. mutans physiology and reinforces a possible link between this gene and TnSMU2. However, at this time the exact mechanism by which the cidB smooth variant emerged is not known and is currently under investigation. We had previously attempted an initial evolution experiment to determine the frequency of stable smooth colony formation from repeated passaging of both wild‐type and cidB rough strains on BHI plates under aerobic, CO2, and anaerobic growth conditions. After 50 passages for cidB rough and 14 passages for wild type, we were unable to detect the appearance of any stable smooth variant colonies from either strain. Given that the original stock culture of cidB rough appears to have a relatively equal mixture of smooth and rough colonies (the subculturing of each yielding a stable phenotype), it is possible that the cidB smooth variant arose during the initial transformation to generate the cidB mutant. On‐going and future research efforts include a careful assessment of the frequency of stable smooth colony phenotype after transformation of wild type, whether this frequency is increased when cidB is absent and genomic loss of TnSMU2 always correlates with emergence of stable smooth colony variants.

In the cidB smooth variant, the only genomic sequence difference of note, compared with cidB rough, is low‐read coverage within and 3′ to TnSMU2. This region contains upwards of 60 coding sequences, though many are annotated as transposon fragments or repetitive sequences. Many are hypothetical with several other genes annotated to be involved in metabolism (especially isopropylmalate synthesis, SMU.1384) or the CRISPR1/Cas system with Cas1, Cas2, and Cas9 located within an operon in this region (SMU.1402 through SMU.1405) next to a CRISPR array spanning several ORFs (Serbanescu et al., 2015). Genes within this region, as well as the CRISPR2/Cas loci (SMU.1753cSMU.1755c, SMU.1757c & SMU.1758c, and SMU.1760c through SMU.1764c), were also among those whose expression was affected by a deletion of lrgAB (Rice, Turner, Carney, Gu, & Ahn, 2017). Taken alongside the strikingly similar expression transcriptomic profiles of the cidB rough mutant (Ahn & Rice, 2016), these data suggest a close link in the cellular role(s) of Cid and Lrg with TnSMU2 and bacterial cell immunity through CRISPR/Cas. Additional evidence of connections between Cid/Lrg and TnSMU2 were also uncovered during microarray analysis of transcriptomic changes in a lytS mutant, which encodes the sensor kinase of the LytST two‐component system that serves as a primary regulator of lrgAB expression (Ahn et al., 2012). Genes within TnSMU2 were again among the most affected by a mutation of lytS, with expression significantly downregulated compared with wild type. Expression of TnSMU2 genes was conversely increased in both the lrgAB and cidB mutants (Ahn & Rice, 2016; Rice et al., 2017), which may indicate that function of these gene products is suppressive in some way to expression of the TnSMU2 region. Possibly, regulation of lrgAB by LytS balances this negative effect.

Change in colony morphology due to loss of the TnSMU2 region may not be from the loss of any one of these ORFs, but the collective loss of all related genes may cause larger physiological changes that alter the appearance of colonies on an agar plate. It is also important to note that TnSMU2 is not found in all S. mutans strains (Lapirattanakul et al., 2008; Wu et al., 2010) and that many S. mutans backgrounds have differing colony morphologies (Emilson, 1983). Previous work in other serotype c S. mutans isolates has identified large, mucoid colonies similar in description to the cidB smooth strain, and characterized this alteration as a result of altered fructosyltransferase (FTase) activity (Okahashi, Asakawa, Koga, Masuda, & Hamada, 1984). Although we have not identified any genes within this region predicted to take part in fructan synthesis, the possibility remains that one of the many hypothetical proteins may indeed have a role in this process.

Due to the presence of low‐read coverage within the TnSMU2 region of the cidB smooth mutant genome, we are not able to conclusively state this region has been completely lost. In order to better understand if genes within this region were present, as well as to quantify the gap in coverage, qPCR primers were targeted to genes within the region. These results confirmed that copy numbers of comE and pdhB, two genes outside of the low‐coverage area, are consistent throughout our wild‐type S. mutans and both cidB mutant variants. This was expected, as neither gene showed gaps in coverage during our sequence analysis even though pdhB resides on the edge of the 3′ end of the low‐coverage region. However, relative quantities for bacA2 and gbpC differed in this qPCR analysis: Both genes were present in comparable relative copy number between wild‐type and cidB rough genomic DNA (as indicated by near‐identical CT values to each other, which were also in line with CT values observed for pdhB and comE for all three strains). However, bacA2 and gbpC CT values in the cidB smooth strain were very high (~30), indicating a low copy number relative to wild type and cidB rough. Although qPCR amplification of these genes was detectable in cidB smooth, their CT values approach the qPCR cutoff which is normally considered background (CT ≥ 35). This result alone still does not clarify whether or not this region is completely absent in the cidB smooth genome, or whether the TnSMU2 region is somehow being maintained in a small subpopulation of this strain. Experiments are currently in progress to distinguish between these two scenarios, as well as to probe the frequency of loss of TnSMU2 in cidB mutants in both previously and newly constructed mutants.

Two vital physiological processes for S. mutans persistence within the oral cavity are biofilm formation and the ability to withstand oxidative stress (Kreth et al., 2005; Tsumori & Kuramitsu, 1997). While acid tolerance was not shown to be affected in either cidB mutant variant (Figure A3 in Appendix), mutation of cidB has previously been shown to have a significant effect on oxidative stress tolerance in S. mutans grown in BHI (Ahn & Rice, 2016) and on agar plates in atmospheric levels of O2 (Ahn et al., 2010). Congruent with these results, neither cidB variant nor the cidAB mutant grew successfully in atmospheric aerobic conditions planktonically (Figure 4), or on agar plates (Figure 1). The cidA mutant however was able to grow comparatively well in defined media during aerobic growth. Competing each cidB variant against S. gordonii did reveal a modest separation of these two mutants in terms of H2O2 resistance when cultured on BHI agar plates (Figure 5a). The cidB smooth mutant appeared to display greater inhibition by wild‐type S. gordonii, with a larger area of obstructed growth as directly compared with either the cidB rough variant or wild‐type (Figure 5a). This phenotype was lost when competed against a S. gordonii spx mutant which is defective in H2O2 production, confirming this inhibition was a function of H2O2 generated by S. gordonii rather than production of an excreted secondary metabolite or peptide. Increased inhibition of cidB rough as compared with wild type was also observed, suggesting that cidB itself is important for competitive fitness within the oral cavity, but loss of the TnSMU2 region in cidB smooth may contribute to its increased growth inhibition by H2O2‐producing S. gordonii on BHI agar plates. Deletion of the bac/mub operon (encoding a nonribosomal peptide synthetase‐polyketide synthase gene cluster responsible for pigment biosynthesis) within TnSMU2 has been previously shown to increase sensitivity to oxidative stress in three different S. mutans strain backgrounds (Wu et al., 2010). Therefore, it is likely that loss of these genes in the cidB smooth mutant contributes to its increased growth inhibition by H2O2‐producing S. gordonii. Defining a specific stress‐related effect of elimination of this region is made even more complex due to the variability of this region seen in S. mutans clinical isolates characterized thus far (Lapirattanakul et al., 2008; Wu et al., 2010).

Assessment of biofilm formation between the cidB variants also revealed an interesting effect of this gene on the structure and amount of biofilm generated by S. mutans. During growth in CO2 supplemented conditions, biofilms produced by cidB rough closely resembled those of wild type, whereas biofilms produced by cidB smooth were significantly diminished with lower biomass and average thickness under this same growth condition. This cidB smooth mutant biofilm phenotype may be driven in part by the loss of the glucan binding protein gbpC, which is not a part of TnSMU2 but was part of the 3′ end missing from cidB smooth (Figure 2). Biofilm growth of cidB smooth under anaerobic conditions reversed the phenotypic effects observed in CO2 growth. In comparison, biofilms formed by the cidB rough mutant were altered during anaerobic growth (decreased biomass and thickness) but not during CO2 growth, suggesting that loss of cidB alone leads to a reduction of anaerobic biofilm formation, while concurrent loss of the TnSMU2 region may compensate this biofilm reduction in some manner. Viable cell counts within each anaerobic biofilm reflected these findings, as the cidB rough mutant displayed a significantly lower cell count than either the wild type or cidB smooth. Indeed, the smooth variant anaerobic biofilm displayed the highest viable cell count of all three tested strains despite the increase in PI staining observed in the confocal images (Figure 6). The function of cidB may thus be tied to S. mutans anaerobiosis and persistence. Loss of the large coding sequences within the TnSMU2 region may also reduce the overall carbon requirements for S. mutans in the cidB smooth mutant during anaerobic growth, possibly allowing it to maintain wild‐type levels biofilm formation despite increased presence of cell damage.

Reductions in genetic competence can prevent horizontal gene transfer within the oral microbiome, disabling transfer of antibiotic resistance genes (Hannan et al., 2010; Li, Lau, Lee, Ellen, & Cvitkovitch, 2001), disrupting acquisition of MGEs (Ciric, Mullany, & Roberts, 2011), and/or decreasing subpopulation heterogeneity and overall fitness of the S. mutans population. In this study, a significant decrease in the ability for both cidB variants to uptake plasmid DNA was shown in defined media where the XIP‐mediated ComRS system is predominant. The cidB smooth variant was less able to uptake added plasmid DNA compared with cidB rough and also displayed a deficiency in plasmid DNA uptake in complex media. This phenotype was rescued however with the addition of sCSP. As ComRS‐mediated competence activation directly stimulates comX, observed competence defects in both cidB mutant variants indicate a relationship between cidB and the ability of S. mutans to activate comX. This effect is not observed in complex media however, indicating that diminished competence in cidB smooth is also contingent on loss of the TnSMU2 region. Genes impacting natural competence have been mapped across the S. mutans genome via transposon sequencing (Shields et al., 2018) and includes SMU.1398, annotated irvR as a phage‐associated repressor protein. Found within the reduced TnSMU2 region, losing this gene may contribute to the competence defect observed in defined media as well as explain the cidB smooth competence defect in complex media. A study by Khan et al. demonstrated the expression of many genes located within the TnSMU2 region and its 3′ end to be significantly altered in cultures treated with CSP after 10 or 100 min (Khan et al., 2016). Some of these genes, such as the hypothetical 3‐isopropylmalate dehydrogenase SMU.1383, displayed increased expression in the wild‐type background at both timepoints, but decreased expression in a comS mutant. Others, such as gbpC, displayed consistent expression profiles in all three treatments with increased expression throughout. While several were stated to be statistically significant, many of these alterations failed to clear a mean fold change cutoff of 2.0. Regulation of competence is incredibly complex; thus, alterations of expression for many of these genes may be downstream effects from more significant changes in other loci. Further experiments beyond the scope of this current study are necessary to determine what the causal agent of the observed competence defects is in both cidB variants or if these competence defects derive directly from the loss of TnSMU2 and its downstream region.

While the precise function of CidAB remains a mystery, this study has reinforced a link between these genes and the genomic island TnSMU2. Our data also provide novel insight into the physiological role CidB plays within the cell, in addition to how the presence or absence TnSMU2 affects S. mutans physiology. Determining the importance of cidB and TnSMU2 in S. mutans oxidative stress tolerance, biofilm production, and competence helps provide new insights as to how this bacterium is able to persist within the oral cavity and cause disease, while also providing new evidence in regard to the function of these relatively uncharacterized areas of S. mutans physiology.

ACKNOWLEDGMENTS

This work was supported by the National Institutes of Health (NIH)‐ National Institute of Dental and Craniofacial Research (NIDCR) grant R01 DE025237 (SJA and subaward to KCR), and in part by a UF Graduate School Fellowship Award to MET and NSF Science and Technology Expansion Program (STEP) (Award 1161177) for DG summer internship funding. We thank Dr. Robert Burne (Dept. Oral Biology, College of Dentistry, University of Florida) for providing S. gordonii DL‐1 and isogenic spx mutant.

    CONFLICT OF INTEREST

    None declared.

    AUTHOR CONTRIBUTIONS

    MET, SJA, and KCR were involved in conceptualization; MET, KH, OVC, DG, and RKC were involved in investigation; MET, KH, RKC, and KCR were involved in formal analysis; MET, KH, OVC, RKC, and KCR were involved in visualization; SJA, KCR, and MET were involved in funding acquisition; MET, KH, and KCR were involved in writing – original draft preparation; MET, KH, OVC, DG, RKC, SJA, and KCR were involved in writing – review and editing.

    ETHICS STATEMENT

    None required.

    APPENDIX A

    image
    Wild‐type, cidB rough, cidB smooth gDNA re‐sequencing results displaying cidAB region. Mapped reads to cidAB surrounding area are displayed in green (forward only reads), red (reverse only reads), blue (read in both directions), and yellow (repetitive sequence motifs) to depth of 1,000 reads. Images are for S. mutans wild‐type (UA159, top), cidB rough (middle), and cidB smooth (bottom)
    image
    Dot drop competition between S. mutans cid mutants and S. gordonii. The ability of S. gordonii wild‐type (Sg) (a) and isogenic spxB mutants (b) to inhibit S. mutans wild‐type (UA159) and isogenic cid mutant growth was assessed using a dot drop competition assay as described in Materials and Methods. Data represent n = 3 independent experiments
    image
    Influence of cidB mutation on acid tolerance. Viability of late‐exponential phase wild‐type (UA159), cidB rough, and cidB smooth mutants in response to acid stress (pH 3.5 buffer) and neutral pH buffer (pH 7.0) over a 90‐min period was assessed by serial dilution plating and CFU counts. Viability was expressed as a percentage of the CFU/ml at each time point divided by the CFU/ml of t = 0 (when cells first transferred to treatment buffer) for each strain and treatment. Data represent the average of n = 3 independent experiments, error bars = SEM
    image
    CSP competence assays. Transformation assay and efficiencies of wild‐type (UA159) and isogenic cid mutants were performed and calculated as described in Materials and Methods, except that methylated pOri23 plasmid was used. Data represent n = 3–4 independent experiments. Error bars represent SEM, and n.d. indicates that transformation efficiencies were not determined, as no colonies were observed on antibiotic plates
    Table A1. SNP analysis compared resequenced S. mutans UA159 laboratory strain to published S. mutans UA159 genome (NC_004350.2)
    Reference Position Type Length Reference Allele Linkage Count Coverage Frequency Forward/reverse balance Average quality Overlapping annotations Coding region change Amino acid change
    11066 SNV 1 G A   857 863 99.3 0.5 36.64 CDS: SMU_13, Gene: SMU_13 NP_720498.1:c.224G > A NP_720498.1:p.Arg75Gln
    385786 SNV 1 C T   717 722 99.31 0.5 36.11 CDS: brpA, Gene: brpA NP_720858.1:c.1109C > T NP_720858.1:p.Ser370Phe
    418392 SNV 1 T C   704 704 100 0.49 36.79 CDS: SMU_448, Gene: SMU_448 NP_720892.1:c.176T > C NP_720892.1:p.Phe59Ser
    552448 Deletion 1 A   677 686 98.69 0.49 35.4 CDS: furR, Gene: furR NP_721026.1:c.393delA NP_721026.1:p.Asn132fs
    808802 SNV 1 C G   607 607 100 0.5 36.37 CDS: pyrAB, Gene: pyrAB NP_721270.1:c.1266C > G  
    826253 SNV 1 C G   442 442 100 0.46 36.32 CDS: SMU_875c, Gene: SMU_875c NP_721284.1:c.214G > C NP_721284.1:p.Asp72His
    842678 SNV 1 G T   522 523 99.81 0.49 35.9 CDS: galE, Gene: galE NP_721296.1:c.672G > T  
    957858 SNV 1 T C   152 154 98.7 0.18 36.7 CDS: gtfC, Gene: gtfC NP_721400.1:c.2121T > C  
    957915 SNV 1 C T   91 91 100 0.01 35.54 CDS: gtfC, Gene: gtfC NP_721400.1:c.2178C > T  
    957924 SNV 1 A G   85 85 100 0.01 35.74 CDS: gtfC, Gene: gtfC NP_721400.1:c.2187A > G  
    988399 SNV 1 T G   519 519 100 0.49 36.61      
    1148435 SNV 1 G T   499 500 99.8 0.49 35.58 CDS: fic, Gene: fic NP_721587.1:c.233C > A NP_721587.1:p.Ala78Asp
    1164137 SNV 1 C G   571 571 100 0.5 36.2 CDS: pyrF, Gene: pyrF NP_721601.1:c.144G > C  
    1223786 SNV 1 T C   514 516 99.61 0.48 36.41 CDS: SMU_1297, Gene: SMU_1297 NP_721668.1:c.655T > C  
    1237595 SNV 1 G C   551 551 100 0.5 36.13 CDS: aspB, Gene: aspB NP_721683.1:c.230C > G NP_721683.1:p.Ala77Gly
    1380458 SNV 1 C A   605 610 99.18 0.5 36.04 CDS: SMU_1450, Gene: SMU_1450 NP_721803.1:c.162C > A  
    1568890 SNV 1 C T   691 693 99.71 0.5 35.71      
    1576987 SNV 1 G C   716 718 99.72 0.5 34.74 CDS: nrgA, Gene: nrgA NP_721991.1:c.94C > G NP_721991.1:p.Arg32Gly
    1733172 SNV 1 T C   56 56 100 0.22 37.38 CDS: aroG, Gene: aroG NP_722153.1:c.87A > G  
    1733175 SNV 1 C T   35 37 94.59 0.15 37.14 CDS: aroG, Gene: aroG NP_722153.1:c.84G > A  
    1733177 MNV 2 TA GG   35 37 94.59 0.17 36.3 CDS: aroG, Gene: aroG NP_722153.1:c.81_82delTAinsCC NP_722153.1:p.Lys28Gln
    1733181 SNV 1 C T   35 35 100 0.15 37.11 CDS: aroG, Gene: aroG NP_722153.1:c.78G > A  
    1733185 SNV 1 T G   35 35 100 0.15 37.09 CDS: aroG, Gene: aroG NP_722153.1:c.74A > C NP_722153.1:p.Asp25Ala
    1733187 SNV 1 C T   35 35 100 0.15 37.14 CDS: aroG, Gene: aroG NP_722153.1:c.72G > A  
    1733189 SNV 1 G C   35 35 100 0.15 37.4 CDS: aroG, Gene: aroG NP_722153.1:c.70C > G NP_722153.1:p.Gln24Glu
    1733194 SNV 1 T G   35 35 100 0.15 37.74 CDS: aroG, Gene: aroG NP_722153.1:c.65A > C NP_722153.1:p.Lys22Thr
    1733977 SNV 1 A T   51 51 100 0.16 37.22 CDS: aroH, Gene: aroH NP_722154.1:c.315T > A  
    1733986 SNV 1 G A   58 58 100 0.16 37.36 CDS: aroH, Gene: aroH NP_722154.1:c.306C > T  
    1733988 MNV 2 CC TG   58 58 100 0.16 37.38 CDS: aroH, Gene: aroH NP_722154.1:c.303_304delGGinsCA NP_722154.1:p.Met101_Val102delinsIleIle
    1733991 MNV 2 TT GG   58 58 100 0.16 37.34 CDS: aroH, Gene: aroH NP_722154.1:c.300_301delAAinsCC NP_722154.1:p.Met101Leu
    1733998 SNV 1 G A   92 92 100 0.23 37.01 CDS: aroH, Gene: aroH NP_722154.1:c.294C > T  
    1734001 SNV 1 G A   97 97 100 0.24 37.45 CDS: aroH, Gene: aroH NP_722154.1:c.291C > T  
    1734016 SNV 1 G A   113 113 100 0.26 37.36 CDS: aroH, Gene: aroH NP_722154.1:c.276C > T  
    1892328 Deletion 6 AATAAT   632 698 90.54 0.47 35.2 CDS: SMU_2167, Gene: SMU_2167 YP_004853792.1:c.814_819delATTATT YP_004853792.1:p.Ile272_Ile273del
    1932163 Insertion 1 T   779 802 97.13 0.49 36.6      
    • Grey: SNPs common to WT, cidB rough, and cidB smooth relative to published S. mutans UA159 genome (NC_004350.2).
    • Yellow: SNPs only found in WT (wild‐type laboratory strain UA159 isogenic to both cidB mutants).
    Table A2. SNP analysis compared resequenced S. mutans cidB smooth mutant to published S. mutans UA159 genome (NC_004350.2)
    Reference Position Type Length Reference Allele Linkage Count Coverage Frequency Forward/reverse balance Average quality Overlapping annotations Coding region change Amino acid change
    9729 SNV 1 A G   1,039 1,052 98.76 0.49 36.65 CDS: SMU_12, Gene: SMU_12 NP_720497.1:c.98A > G NP_720497.1:p.Tyr33Cys
    11066 SNV 1 G A   961 962 99.9 0.49 36.16 CDS: SMU_13, Gene: SMU_13 NP_720498.1:c.224G > A NP_720498.1:p.Arg75Gln
    294438 SNV 1 C T   862 866 99.54 0.49 36.31 CDS: pgi, Gene: pgi NP_720764.1:c.772C > T NP_720764.1:p.Arg258Cys
    294544 SNV 1 A G   852 862 98.84 0.5 35.3 CDS: pgi, Gene: pgi NP_720764.1:c.878A > G NP_720764.1:p.Glu293Gly
    385786 SNV 1 C T   803 809 99.26 0.49 36 CDS: brpA, Gene: brpA NP_720858.1:c.1109C > T NP_720858.1:p.Ser370Phe
    418392 SNV 1 T C   837 838 99.88 0.49 36.8 CDS: SMU_448, Gene: SMU_448 NP_720892.1:c.176T > C NP_720892.1:p.Phe59Ser
    552448 Deletion 1 A   738 759 97.23 0.5 34.93 CDS: furR, Gene: furR NP_721026.1:c.393delA NP_721026.1:p.Asn132fs
    808802 SNV 1 C G   666 669 99.55 0.47 36.45 CDS: pyrAB, Gene: pyrAB NP_721270.1:c.1266C > G  
    826253 SNV 1 C G   511 513 99.61 0.45 36.39 CDS: SMU_875c, Gene: SMU_875c NP_721284.1:c.214G > C NP_721284.1:p.Asp72His
    842678 SNV 1 G T   637 639 99.69 0.47 35.42 CDS: galE, Gene: galE NP_721296.1:c.672G > T  
    957858 SNV 1 T C   202 203 99.51 0.18 36.19 CDS: gtfC, Gene: gtfC NP_721400.1:c.2121T > C  
    957915 SNV 1 C T   148 148 100 0.04 36.69 CDS: gtfC, Gene: gtfC NP_721400.1:c.2178C > T  
    957924 SNV 1 A G   143 145 98.62 0.05 35.87 CDS: gtfC, Gene: gtfC NP_721400.1:c.2187A > G  
    988399 SNV 1 T G   619 620 99.84 0.49 36.52      
    1164137 SNV 1 C G   608 608 100 0.5 35.74 CDS: pyrF, Gene: pyrF NP_721601.1:c.144G > C  
    1223786 SNV 1 T C   605 607 99.67 0.48 36.26 CDS: SMU_1297, Gene: SMU_1297 NP_721668.1:c.655T > C  
    1380458 SNV 1 C A   680 684 99.42 0.49 35.66 CDS: SMU_1450, Gene: SMU_1450 NP_721803.1:c.162C > A  
    1568890 SNV 1 C T   759 764 99.35 0.48 35.17      
    1576987 SNV 1 G C   815 817 99.76 0.5 34.16 CDS: nrgA, Gene: nrgA NP_721991.1:c.94C > G NP_721991.1:p.Arg32Gly
    1604392 SNV 1 C G   739 750 98.53 0.49 36.26 CDS: dltA, Gene: dltA NP_722022.1:c.1396G > C NP_722022.1:p.Ala466Pro
    1733172 SNV 1 T C   74 74 100 0.15 37.09 CDS: aroG, Gene: aroG NP_722153.1:c.87A > G  
    1733175 SNV 1 C T   36 36 100 0.08 37 CDS: aroG, Gene: aroG NP_722153.1:c.84G > A  
    1733177 MNV 2 TA GG   36 36 100 0.1 36.78 CDS: aroG, Gene: aroG NP_722153.1:c.81_82delTAinsCC NP_722153.1:p.Lys28Gln
    1733181 SNV 1 C T   36 36 100 0.08 37.47 CDS: aroG, Gene: aroG NP_722153.1:c.78G > A  
    1733185 SNV 1 T G   36 36 100 0.08 37.61 CDS: aroG, Gene: aroG NP_722153.1:c.74A > C NP_722153.1:p.Asp25Ala
    1733187 SNV 1 C T   36 36 100 0.08 37.53 CDS: aroG, Gene: aroG NP_722153.1:c.72G > A  
    1733189 SNV 1 G C   36 36 100 0.08 36.72 CDS: aroG, Gene: aroG NP_722153.1:c.70C > G NP_722153.1:p.Gln24Glu
    1733194 SNV 1 T G   36 36 100 0.08 37.25 CDS: aroG, Gene: aroG NP_722153.1:c.65A > C NP_722153.1:p.Lys22Thr
    1733977 SNV 1 A T   53 53 100 0.05 36.89 CDS: aroH, Gene: aroH NP_722154.1:c.315T > A  
    1733986 SNV 1 G A   60 60 100 0.1 37.43 CDS: aroH, Gene: aroH NP_722154.1:c.306C > T  
    1733988 MNV 2 CC TG   60 60 100 0.1 37.25 CDS: aroH, Gene: aroH NP_722154.1:c.303_304delGGinsCA NP_722154.1:p.Met101_Val102delinsIleIle
    1733991 MNV 2 TT GG   59 61 96.72 0.11 37.3 CDS: aroH, Gene: aroH NP_722154.1:c.300_301delAAinsCC NP_722154.1:p.Met101Leu
    1733998 SNV 1 G A   98 98 100 0.21 36.68 CDS: aroH, Gene: aroH NP_722154.1:c.294C > T  
    1734001 SNV 1 G A   107 108 99.07 0.22 36.59 CDS: aroH, Gene: aroH NP_722154.1:c.291C > T  
    1734016 SNV 1 G A   141 141 100 0.26 36.82 CDS: aroH, Gene: aroH NP_722154.1:c.276C > T  
    1892328 Deletion 6 AATAAT   786 882 89.12 0.47 35.09 CDS: SMU_2167, Gene: SMU_2167 YP_004853792.1:c.814_819delATTATT YP_004853792.1:p.Ile272_Ile273del
    1932163 Insertion 1 T   855 888 96.28 0.49 36.44      
    • Grey: SNPs common to WT, cidB rough, and cidB smooth relative to published S. mutans UA159 genome (NC_004350.2).
    • Green: SNPs only found in cidB smooth variant.
    Table A3. SNP analysis compared resequenced S. mutans cidB rough mutant to published S. mutans UA159 genome (NC_004350.2)
    Reference Position Type Length Reference Allele Linkage Count Coverage Frequency Forward/reverse balance Average quality Overlapping annotations Coding region change Amino acid change
    9729 SNV 1 A G   475 477 99.58 0.5 35.62 CDS: SMU_12, Gene: SMU_12 NP_720497.1:c.98A > G NP_720497.1:p.Tyr33Cys
    11066 SNV 1 G A   454 456 99.56 0.49 35.92 CDS: SMU_13, Gene: SMU_13 NP_720498.1:c.224G > A NP_720498.1:p.Arg75Gln
    294438 SNV 1 C T   390 392 99.49 0.49 36.57 CDS: pgi, Gene: pgi NP_720764.1:c.772C > T NP_720764.1:p.Arg258Cys
    294544 SNV 1 A G   379 384 98.7 0.5 34.81 CDS: pgi, Gene: pgi NP_720764.1:c.878A > G NP_720764.1:p.Glu293Gly
    385786 SNV 1 C T   365 369 98.92 0.48 35.79 CDS: brpA, Gene: brpA NP_720858.1:c.1109C > T NP_720858.1:p.Ser370Phe
    418392 SNV 1 T C   397 398 99.75 0.49 36.13 CDS: SMU_448, Gene: SMU_448 NP_720892.1:c.176T > C NP_720892.1:p.Phe59Ser
    552448 Deletion 1 A   385 393 97.96 0.5 33.84 CDS: furR, Gene: furR NP_721026.1:c.395del NP_721026.1:p.Asn132fs
    808802 SNV 1 C G   381 382 99.74 0.49 35.34 CDS: pyrAB, Gene: pyrAB NP_721270.1:c.1266C > G  
    826253 SNV 1 C G   249 250 99.6 0.46 35.31 CDS: SMU_875c, Gene: SMU_875c NP_721284.1:c.214G > C NP_721284.1:p.Asp72His
    842678 SNV 1 G T   355 356 99.72 0.5 34.35 CDS: galE, Gene: galE NP_721296.1:c.672G > T  
    957858 SNV 1 T C   78 79 98.73 0.17 34.17 CDS: gtfC, Gene: gtfC NP_721400.1:c.2121T > C  
    957915 SNV 1 C T   52 52 100 0.04 35.83 CDS: gtfC, Gene: gtfC NP_721400.1:c.2178C > T  
    957924 SNV 1 A G   48 49 97.96 0.06 33.9 CDS: gtfC, Gene: gtfC NP_721400.1:c.2187A > G  
    988399 SNV 1 T G   345 345 100 0.5 35.32      
    1164137 SNV 1 C G   368 369 99.73 0.49 35.91 CDS: pyrF, Gene: pyrF NP_721601.1:c.144G > C  
    1223786 SNV 1 T C   312 315 99.05 0.5 35.04 CDS: SMU_1297, Gene: SMU_1297 NP_721668.1:c.655T > C  
    1380458 SNV 1 C A   396 399 99.25 0.49 34.13 CDS: SMU_1450, Gene: SMU_1450 NP_721803.1:c.162C > A  
    1568890 SNV 1 C T   349 350 99.71 0.49 33.59      
    1576987 SNV 1 G C   427 430 99.3 0.5 33.38 CDS: nrgA, Gene: nrgA NP_721991.1:c.94C > G NP_721991.1:p.Arg32Gly
    1604392 SNV 1 C G   381 384 99.22 0.49 35.01 CDS: dltA, Gene: dltA NP_722022.1:c.1396G > C NP_722022.1:p.Ala466Pro
    1733172 SNV 1 T C   31 32 96.88 0.16 36.77 CDS: aroG, Gene: aroG NP_722153.1:c.87A > G  
    1733175 SNV 1 C T   15 15 100 0 36.6 CDS: aroG, Gene: aroG NP_722153.1:c.84G > A  
    1733177 MNV 2 TA GG   14 15 93.33 0.07 36.68 CDS: aroG, Gene: aroG NP_722153.1:c.81_82delinsCC NP_722153.1:p.Lys28Gln
    1733181 SNV 1 C T   15 15 100 0 37.87 CDS: aroG, Gene: aroG NP_722153.1:c.78G > A  
    1733185 SNV 1 T G   15 15 100 0 37.6 CDS: aroG, Gene: aroG NP_722153.1:c.74A > C NP_722153.1:p.Asp25Ala
    1733187 SNV 1 C T   15 15 100 0 36.47 CDS: aroG, Gene: aroG NP_722153.1:c.72G > A  
    1733189 SNV 1 G C   15 15 100 0 36.4 CDS: aroG, Gene: aroG NP_722153.1:c.70C > G NP_722153.1:p.Gln24Glu
    1733194 SNV 1 T G   15 15 100 0 35.87 CDS: aroG, Gene: aroG NP_722153.1:c.65A > C NP_722153.1:p.Lys22Thr
    1733977 SNV 1 A T   17 17 100 0.26 36.59 CDS: aroH, Gene: aroH NP_722154.1:c.315T > A  
    1733986 SNV 1 G A   18 18 100 0.25 36.44 CDS: aroH, Gene: aroH NP_722154.1:c.306C > T  
    1733988 MNV 2 CC TG   18 18 100 0.25 35.36 CDS: aroH, Gene: aroH NP_722154.1:c.303_304delinsCA NP_722154.1:p.Met101_Val102delinsIleIle
    1733991 MNV 2 TT GG   17 18 94.44 0.26 36.44 CDS: aroH, Gene: aroH NP_722154.1:c.300_301delinsCC NP_722154.1:p.Met101Leu
    1733998 SNV 1 G A   31 31 100 0.31 35.48 CDS: aroH, Gene: aroH NP_722154.1:c.294C > T  
    1734001 SNV 1 G A   37 37 100 0.31 36.22 CDS: aroH, Gene: aroH NP_722154.1:c.291C > T  
    1734016 SNV 1 G A   47 47 100 0.32 34.11 CDS: aroH, Gene: aroH NP_722154.1:c.276C > T  
    1932163 Insertion 1 T   440 458 96.07 0.49 36.09      
    • Grey SNPs common to WT, cidB rough, and cidB smooth relative to published S. mutans UA159 genome (NC_004350.2).
    • Green: SNPs only found in cidB rough variant.

    DATA AVAILABILITY STATEMENT

    All data generated or analyzed during this study are included in this published article and its corresponding appendices. Additionally, all DNA raw sequencing data files are accessible via the NCBI Sequence Read Archive (SRA) under the accession number PRJNA560077.

      The full text of this article hosted at iucr.org is unavailable due to technical difficulties.