Original Article

Free Access

Maternal Nanos‐Dependent RNA Stabilization in the Primordial Germ Cells of Drosophila Embryos

Life Science Center of Tsukuba Advanced Research Alliance (TARA Center), University of Tsukuba, Tsukuba, Ibaraki, 305‐8577 Japan

Search for more papers by this author

Yuji Kumata

Developmental Genetics, National Institute for Basic Biology, Higashiyama, Okazaki, 444‐8787 Japan

Search for more papers by this author

Satoru Kobayashi

Corresponding Author

skob@tara.tsukuba.ac.jp

orcid.org/0000-0003-1127-5328

Life Science Center of Tsukuba Advanced Research Alliance (TARA Center), University of Tsukuba, Tsukuba, Ibaraki, 305‐8577 Japan

Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, 305‐8572 Japan

Author to whom all correspondence should be addressed.

Email: skob@tara.tsukuba.ac.jp

Search for more papers by this author

Seiko Sugimori

Life Science Center of Tsukuba Advanced Research Alliance (TARA Center), University of Tsukuba, Tsukuba, Ibaraki, 305‐8577 Japan

Search for more papers by this author

Yuji Kumata

Developmental Genetics, National Institute for Basic Biology, Higashiyama, Okazaki, 444‐8787 Japan

Search for more papers by this author

Satoru Kobayashi

Corresponding Author

skob@tara.tsukuba.ac.jp

orcid.org/0000-0003-1127-5328

Life Science Center of Tsukuba Advanced Research Alliance (TARA Center), University of Tsukuba, Tsukuba, Ibaraki, 305‐8577 Japan

Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, 305‐8572 Japan

Author to whom all correspondence should be addressed.

Email: skob@tara.tsukuba.ac.jp

Search for more papers by this author

First published: 26 December 2017

https://doi.org/10.1111/dgd.12414

Citations: 2

Abstract

Nanos (Nos) is an evolutionary conserved protein expressed in the germline of various animal species. In Drosophila, maternal Nos protein is essential for germline development. In the germline progenitors, or the primordial germ cells (PGCs), Nos binds to the 3′ UTR of target mRNAs to repress their translation. In contrast to this prevailing role of Nos, here we report that the 3′ UTR of CG32425 mRNA mediates Nos‐dependent RNA stabilization in PGCs. We found that the level of mRNA expressed from a reporter gene fused to the CG32425 3′ UTR was significantly reduced in PGCs lacking maternal Nos (nos PGCs) as compared with normal PGCs. By deleting the CG32425 3′ UTR, we identified the region required for mRNA stabilization, which includes Nos‐binding sites. In normal embryos, CG32425 mRNA was maternally supplied into PGCs and remained in this cell type during embryogenesis. However, as expected from our reporter assay, the levels of CG32425 mRNA and its protein product expressed in nos PGCs were lower than in normal PGCs. Thus, we propose that Nos protein has dual functions in translational repression and stabilization of specific RNAs to ensure proper germline development.

Introduction

The germline is the only cell type that gives rise to the next generation, while somatic cells form body tissues. In many animal groups, maternal factors required for germline development are localized in the specialized egg cytoplasm, or germ plasm, which is partitioned into primordial germ cells (PGCs) (Ikenishi 1998; Extavour & Akam 2003). In Drosophila, germ plasm is localized in the posterior pole region of cleavage embryos (Campos‐Ortega & Hartenstein 1985). Transplantation of germ plasm into the anterior pole region of early embryos results in ectopic formation of the germline there (Illmensee & Mahowald 1974). This strongly suggests that germ plasm contains two types of maternal factors, including one that is required to induce germline development, and one to repress somatic development.

One of the maternal factors is encoded by the ovo gene, which is evolutionarily conserved among animal species (Kumar et al. 2012). Ovo protein contains Zn‐finger DNA‐binding domains and acts as a transcriptional regulator (Mével‐Ninio et al. 1995). Maternal Ovo protein accumulates in PGC nuclei during embryogenesis, and serves a dual function, namely, the activation of germline genes and the repression of somatic genes (Yatsu et al. 2008; Hayashi et al. 2017). Repression of somatic genes requires at least two maternal factors localized in germ plasm, namely, Polar granule component (Pgc) and Nanos (Nos) (Deshpande et al. 1999; Martinho et al. 2004; Hanyu‐Nakamura et al. 2008). Pgc acts as a repressor for P‐TEFb function to suppress RNA polymerase II–dependent transcription in newly formed PGCs (Hanyu‐Nakamura et al. 2008). Nos is an evolutionarily conserved CCHC‐type zinc finger protein that plays an essential role in germline development in various animal species (Wang & Lehmann 1991; Mosquera et al. 1993; Kobayashi et al. 1996; Pilon & Weisblat 1997; Subramaniam & Seydoux 1999; Mochizuki et al. 2000; Köprunner et al. 2001; Extavour & Akam 2003; Tsuda et al. 2003). Maternally supplied Nos is partitioned into PGCs and remains detectable in these cells throughout embryogenesis (Wang & Lehmann 1991). In the absence of maternal Nos, PGCs enter into apoptotic pathway (Hayashi et al. 2004; Sato et al. 2007). When their apoptosis is inhibited, some of the PGCs are able to adopt a somatic cell fate rather than a germline fate (Hayashi et al. 2004). Even in the case when these PGCs rarely enter the embryonic gonads, they do not differentiate into germ cells (Hayashi et al. 2004).

Nos, along with a conserved RNA‐binding protein, Pumilio (Pum), acts as a translational repressor for specific RNA targets by binding to their 3′ untranslated region (3′ UTR). In abdominal patterning, maternal Nos represses translation of hunchback (hb) mRNA, which otherwise inhibits abdomen formation (Irish et al. 1989; Wreden et al. 1997; Sonoda & Wharton 1999). In PGCs, Nos represses the translation of head involution defective (hid) mRNA to suppress their apoptosis during embryogenesis (Hayashi et al. 2004; Sato et al. 2007). Furthermore, Nos is required to repress translation of cyclinB (cycB) mRNA to establish mitotic quiescence during their migration to the embryonic gonads (Asaoka‐Taguchi et al. 1999; Kadyrova et al. 2007). It has been reported that Nos and Pum bind to Nos‐binding sites (UAUU) and Pum‐binding sites (UGUA), respectively, in 3′ UTR of cycB mRNA. They recruit CCR4/NOT deadenylase complex to cycB 3′ UTR to facilitate deadenylation of its poly(A) tail, which in turn, represses translation in PGCs (Kadyrova et al. 2007; Weidmann et al. 2016).

In contrast to this prevailing role of Nos, we report that the 3′ UTR from CG32425 mRNA mediated Nos‐dependent RNA stabilization in PGCs. Although the role of the CG32425 gene in germline development remains unknown, the expression of maternal CG32425 mRNA and its protein product was upregulated by maternal Nos in PGCs. This report provides the first evidence that supports a role for Nos in stabilizing RNA in PGCs.

Materials and method

Fly stocks

The nos allele we used was nos^BN. nos^BN is a mutation resulting from a P‐element inserted into the 5′ region of the nos gene, and maternal nos RNA is not detected in embryos derived from nos^BN homozygous females (Forbes & Lehmann 1998). As a control, we used embryos from nos^BN heterozygous females. These embryos and PGCs formed in the embryos are referred to as normal embryos and normal PGCs, respectively.

To generate UASp‐EGFP lines, y¹ M{vas‐int.Dm}ZH‐2A w[*];; M{3xP3‐RFP.attP’}ZH‐86Fa (Bloomington Drosophila stock center; 24486) was used. nanos‐Gal4‐VP16 (nos‐Gal4) (Rörth 1998) was used to induce the expression of UASp‐EGFP‐K10 3′UTR, ‐cycB 3′UTR, ‐CG32425 3′UTR, ‐R1, ‐R2, ‐R3, and the double‐strand RNA against CG32425 (P{TRiP.HMC03193}attP40) (Bloomington Drosophila stock center; 51457) in PGCs. Flies were cultured on standard Drosophila medium at 25°C.

Construction of UASp‐EGFP lines and EGFP reporter assay

To construct UASp‐EGFP‐cycB 3′UTR and ‐CG32425 3′UTR, EGFP‐coding region was amplified from pEGFP‐N1 (Clontech) with the following pair of primers (Sato et al. 2007).

KpnI‐EGFP‐Fw: GGggtaccATGGTGAGCAAGGGCGAGGAGC (complementary to 676–700 nt in pEGFP‐N1).

EcoRI‐EGFP‐Rv: AACGgaattcTTACTTGTACAGCTCGTCCATGCCG (complementary to 1374–1398 nt in pEGFP‐N1).

Sequences recognized by KpnI and EcoRI are shown in lowercase. cycB and CG32425 3′ UTRs were amplified from an embryonic cDNA library (Brown & Kafatos 1988) using the following Fw/Rv pairs of primers.

EcoRI CG32425 3′UTR Fw: CCgaattcCCCAGGGCCAAAAGTCAGTTAA
NotI CG32425 3′UTR Rv: ATTTgcggccgcTTTTTGAGTTGCTTTAGCAATTG
EcoRI cycB 3′UTR Fw: CCgaattcTGCGGTCCAAGGCGGACT
XbaI cycB 3′UTR Rv: GCtctagaTTTATAAAATTATACAAAACTT

Sequences recognized by EcoRI, NotI, and XbaI are shown in lowercase. The EGFP‐coding region was fused to CG32425 or cycB 3′ UTR after digestion with the restriction enzymes, and were subcloned into pBluescript II SK(+) vector. The EGFP‐CG32425 3′UTR and ‐cycB 3′UTR were subsequently inserted into the transformation vector pUAS‐K10 attb (a gift from B. Suter), after digesting with KpnI/NotI and KpnI/XbaI.

To construct UASp‐EGFP‐K10 3′UTR, EGFP‐coding region was amplified from pEGFP‐N1 using the following pair of primers.

BamHI EGFP Fw: ggatccATGGTGAGCAAGGGCGA
XbaI EGFP Rv: tctagaTTACTTGTACAGCTCGTCCATG

Sequences recognized by BamHI and XbaI are indicated in lowercase. EGFP‐coding region was inserted into the vector pUAS‐K10 attb by digesting with BamHI and XbaI.

To construct UASp‐EGFP‐R1, R2, and R3, “region 1”, “region 2”, and “region 3” were amplified from UASp‐EGFP‐CG32425 3′UTR using the following Fw/Rv pairs of primers.

EcoRI R1 Fw: GgaattcCCCCAGGGCCAAAAGTCAGT
NotI R1 Rv: AAATATgcggccgcTATAAAAGACAGCCATAAGACGGTGA
EcoRI R2 Fw: GgaattcCTGATCTGATATTATGCTGTACTT
NotI R2 Rv: AAATATgcggccgcTATAAACAATCGACGATTTGTAACTCAA
EcoRI R3 Fw: GgaattcCATATAGCATAAAATCAAAGC
NotI R3 Rv: AAATATgcggccgcTATAAAGAGTTGCTTTAGCAATTGTAATT

The sequences recognized by EcoRI and NotI are shown in lowercase. These amplified DNAs were inserted into the vector pUAS‐K10 attb by digesting with EcoRI/NotI.

For germline transformation, approximately 0.1 nL of solution containing UASp‐EGFP‐K10 3′UTR, ‐cycB 3′UTR, ‐CG32425 3′UTR, ‐R1, ‐R2, and ‐R3 in the vector pUAS‐K10 attb (200–300 ng/μL in DW) was injected into the embryos derived from y¹ M{vas‐int.Dm}ZH‐2A w[*];; M{3xP3‐RFP.attP’}ZH‐86Fa females. The resulting males were mated with w;; Pr Dr/TM3 Sb females. Progeny with the desired transgenes were screened by checking for red eyes, and were used to establish stock lines.

For our EGFP reporter assay, we used embryos derived from either w;; nos^BN nos‐Gal4/nos‐Gal4 or w;;nos^BN nos‐Gal4 females mated with males homozygous for each UASp‐EGFP transgene.

In situ hybridization for CG32425 mRNA

Whole‐mount in situ hybridization of embryos was performed as described (Hayashi et al. 2004) with the following minor modifications. To synthesize an RNA probe for CG32425 mRNA, we used cDNA generated from the PGCs purified from stage 4–17 embryos (Shigenobu et al. 2006) by a vector‐capping procedure (Kato et al. 2005). A CG32425 cDNA corresponding to the protein‐coding region (1443 bp; 1–1443 in CG32425‐RC, FlyBase: http://flybase.org) was amplified from the cDNA using the following pair of primers.

CG32425 CDS Fw: ATGGCAGAGACCAATAAAGTC
CG32425 CDS Rv: CTATTCCTGACCGTTCGAGT

EGFP‐coding region (720 bp) was amplified from pEGFP‐N1 (Clontech) using the following pair of primers.

EGFP CDS Fw: ATGGTGAGCAAGGGCGAGGA
EGFP CDS Rv: TTACTTGTACAGCTCGTCCATG

The amplified cDNAs were inserted between the T7 and SP6 promoters in the pGEM‐T Easy Vector (Promega). Templates for RNA probes were amplified from these plasmids by using T7 and SP6 primers. Digoxigenin (DIG)‐labeled RNA probes were synthesized from the fragments using either T7 or SP6 RNA polymerase (Roche). Signals were detected using either an alkaline phosphatase–conjugated anti‐DIG Fab fragment (Roche) or a horseradish peroxidase–conjugated anti‐DIG antibody (Roche). In the latter case, signal was amplified using the TSA Biotin System and Streptavidin‐FITC (PerkinElmer). Double staining was performed as described (Hayashi et al. 2004). In nos embryos, PGCs sometimes showed abnormal morphologies, including membrane blebbing and large cellular aggregation. Such abnormal PGCs were omitted from our observation of RNA expression.

Immunostaining

Immunofluorescence staining of embryos was carried out as described (Hayashi et al. 2004). We collected embryos derived from nos^BN/TM3 or nos^BN females mated with w¹¹¹⁸ males. The following primary antibodies were used at the indicated dilutions: rabbit anti‐GFP (1:500, A11122; Life Technologies), chick anti‐Vasa (1:500), and guinea pig anti‐CG32425 antibody (1:200). Anti‐CG32425 antibody was raised against a synthetic peptide (STAAQNLRNSNGQE) (GL Biochem). To detect the primary antibody, the following secondary antibodies were used: Alexa Fluor 488‐conjugated goat anti‐rabbit IgG (1:500, A11034; Molecular Probes), Alexa Fluor 546‐conjugated goat anti‐chick IgY (1:500, A11040; Molecular Probes), and Alexa Fluor 488‐conjugated goat anti‐guinea pig IgG antibody (1:500, A11073; Molecular Probes). Stained embryos were mounted in Vectashield (Vector Laboratories) and observed under a confocal microscope (Leica Microsystems). In nos embryos, abnormal PGCs were omitted from our observation of protein expression, as described above.

Functional analysis of CG32425

To reduce maternal CG32425, we induced the expression of a double‐strand RNA during oogenesis. We obtained female adults either with (control females) or without Cy phenotype (maternal‐RNAi females) derived from w;; nos‐Gal4 parental females mated with y w;UAS‐CG32425 dsRNA/CyO (Bloomington Drosophila stock center; 51457) males. Control and maternal‐RNAi females were mated with w¹¹¹⁸ males, and their adult progeny were dissected in order to inspect the morphology of their ovaries and testes. Ovaries with no mature eggs and regressed testes shorter than 1 mm in length were considered dysgenic gonads.

Results

CG32425 3′ UTR mediated Nos‐dependent upregulation of RNA and protein expression in PGCs

In the course of examining the role of the 3′ UTR from the mRNAs immuno‐precipitated with Pum protein in embryos (Gerber et al. 2006), we have obtained a preliminary result suggesting that CG32425 3′ UTR acts as an RNA region that enhances protein production from mRNA that contains it in normal PGCs, but not in PGCs lacking maternal Nos (nos PGCs). Since this result was in contrast to the prevailing role of Nos, which binds to the 3′ UTR of target mRNAs to repress their protein production in PGCs (Asaoka‐Taguchi et al. 1999), we focused on the role of CG32425 3′ UTR.

To confirm this preliminary results, the CG32425 3′ UTR sequence was fused downstream of UASp‐EGFP (UASp‐EGFP‐CG32425 3′UTR), and the resulting fusion gene was inserted into the cytogenetic locus, 86, located on the right arm of the third chromosome by using the P[acman] recombination technique (Venken et al. 2006; Bischof et al. 2007). As controls, UASp‐EGFP‐cycB 3′UTR and UASp‐EGFP‐K10 3′UTR were constructed and inserted into the same chromosomal position. cycB 3′ UTR has been reported to mediate Nos‐dependent translational repression in PGCs (Asaoka‐Taguchi et al. 1999; Kadyrova et al. 2007), while the K10 3′ UTR, which is widely used to stabilize transcripts in the germline (Rörth 1998), is expected to be free from Nos‐dependent regulation. These transgenes were transcribed in PGCs using the nos‐Gal4‐VP16 (nos‐Gal4) transgene, which expresses the transcriptional activator, Gal4‐VP16, under the control of the germline‐specific nos promoter (Van Doren et al. 1998). In embryos derived from females with nos‐Gal4, the transcript is maternally supplied and partitioned into PGCs (Van Doren et al. 1998). In PGCs, Gal4‐VP16 produced from the maternal transcript (maternal nos‐Gal4) activated UAS‐dependent gene expression from stage 11 until at least the end of embryogenesis (Hayashi et al. 2017). By contrast, the zygotic expression of nos‐Gal4 (zygotic nos‐Gal4) activated UAS‐dependent gene expression in the germline from stage 15 to adulthood (Hayashi et al. 2017).

The aforementioned transgenes enable us to detect protein expression from each transcript containing CG32425, cycB, and K10 3′ UTR by using an anti‐GFP antibody. We expressed these transgenes by using maternal nos‐Gal4, and examined EGFP production in the PGCs of normal embryos and in embryos lacking maternal Nos (nos embryos) at stage 15. We found that EGFP production from UASp‐EGFP‐K10 3′UTR was detectable in both normal and nos PGCs, and that the signal intensity was almost similar between the two types of PGCs (Fig. 1 A,A′,B,B′). Expression of EGFP protein from UASp‐EGFP‐cycB 3′UTR was significantly higher in nos PGCs than in normal ones (Fig. 1C,C′,D,D′). By contrast, EGFP expression from UASp‐EGFP‐CG32425 3′UTR was much lower in nos PGCs than in normal ones (Fig. 1E,E′,F,F′).

**Figure 1**
Open in figure viewer PowerPoint

*CG32425* 3′ UTR mediates Nos‐dependent upregulation of *EGFP* mRNA expression in PGCs. (A–F,A′–F′) Expression of EGFP protein from *UASp‐EGFP‐K10 3′UTR* (A,A′,B,B′), ‐*cycB 3′UTR* (C,C′,D,D′), and ‐*CG32425 3′UTR* (E,E′,F,F′) in normal PGCs (A,A′,C,C′,E,E′) and *nos* PGCs (B,B′,D,D′,F,F′) at embryonic stage 15. (G–L,G′–L′) Expression of *EGFP* mRNA from *UASp‐EGFP‐K10 3′UTR* (G,G′,H,H′), ‐*cycB 3′UTR* (I,I′,J,J′), and ‐*CG32425 3′UTR* (K,K′,L,L′) in normal PGCs (G,G′,I,I′,K,K′) and *nos* PGCs (H,H′,J,J′,L,L′) at embryonic stage 15. *EGFP* mRNA and its corresponding protein signal are shown in green, and a PGC‐specific marker (Vasa) is shown in magenta. Scale bars: 10 μm

To determine whether the altered EGFP expression is due to Nos‐dependent translational regulation, we examined mRNA expression from these transgenes in PGCs using a probe complementary to EGFP‐coding region. We found that the levels of EGFP mRNA expressed from UASp‐EGFP‐K10 3′UTR and UASp‐EGFP‐cycB 3′UTR in normal PGCs were close to that observed in nos PGCs (Fig. 1G–J,G′–J′). However, the level of mRNA expressed from UASp‐EGFP‐CG32425 3′UTR was much lower in nos PGCs than in normal ones (Fig. 1K,K′,L,L′). Our data suggest that cycB 3′ UTR mediates Nos‐dependent translational repression, as has been reported (Asaoka‐Taguchi et al. 1999; Kadyrova et al. 2007). By contrast, EGFP mRNA with CG32425 3′ UTR is upregulated in PGCs in a Nos‐dependent manner, although we cannot rule out the possibility that its translation is also upregulated by maternal Nos.

Identification of regions required for Nos‐dependent upregulation of RNA and protein expression in the CG32425 3′ UTR

To identify the regions required for Nos‐dependent upregulation of RNA and protein expression in PGCs, CG32425 3′ UTR was deleted to produce three regions, 1, 2, and 3 (Fig. 2A), and each 3′ UTR region was fused downstream of UASp‐EGFP (UASp‐EGFP‐R1, ‐R2, and ‐R3, respectively). These transgenes were transformed and activated in PGCs by maternal nos‐Gal4, as described above. First, we found that neither UASp‐EGFP‐R1, ‐R2, nor ‐R3 expressed RNA and protein in normal PGCs at a level close to UASp‐EGFP‐CG32425 3′UTR (Figs 2B,B′,D,D′,F,F′,H,H′,K, 3A,A′,C,C′,E,E′,G,G′). This finding suggests that multiple regions are required to upregulate RNA and protein expression in PGCs, but are separated from each other in this deletion experiment. Second, RNA and protein expression from UASp‐EGFP‐R3 was reduced in nos PGCs, compared with those in normal PGCs (Figs 2H,H′,I,I′,K,L, 3G,G′,H,H′). By contrast, RNA and protein expression from UASp‐EGFP‐R1 and R2 were higher in nos PGCs than in normal ones (Figs 2D–G,D′–G′,K,L, 3C–F,C′–F′). These observations suggest that at least one of the multiple regions for upregulating RNA and protein expression is included in region 3.

**Figure 2**
Open in figure viewer PowerPoint

Identification of the region for Nos‐dependent upregulation of RNA expression in *CG32425* 3′ UTR. (A) *CG32425* 3′ UTR was deleted to produce region 1 (R1; 210 bp), region 2 (R2; 140 bp), and region 3 (R3; 210 bp). (B–I,B′–I′) Expression of *EGFP* mRNA from *UASp‐EGFP‐CG32425 3′UTR* (B,B′,C,C′), *‐R1* (D,D′,E,E′)*, ‐R2* (F,F′,G,G′), and *‐R3* (H,H′,I,I′) in PGCs of normal (B,B′,D,D′,F,F′,H,H′) and *nos* PGCs (C,C′,E,E′,G,G′,I,I′) at stage 15. *EGFP* mRNA signal is shown in green, and Vasa in magenta. Scale bar: 10 μm. (J–L) PGCs were classified into three groups depending on their strong (++), middle (+), and low (±) signal intensities of *EGFP* mRNA (J). The PGCs containing only small dotted signals, with large dotted signals, and cytoplasmic intense staining were judged as ±, +, and ++, respectively. The percentages of stage‐15 PGCs with strong, middle, and low signals in normal (K) and *nos* embryos (L) with *UASp‐EGFP‐CG32425 3′UTR*, *‐R1, ‐R2*, and *‐R3* transgenes are plotted. The numbers of PGCs examined are shown in parentheses. *Significance was calculated between normal and *nos* embryos by Fisher's exact test (P < 0.05).

**Figure 3**
Open in figure viewer PowerPoint

Protein expression from *UASp‐EGFP‐CG32425 3′UTR*, *‐R1, ‐R2*, and *‐R3* in normal and *nos* PGCs. (A–H,A′–H′) Expression of EGFP protein from *UASp‐EGFP‐CG32425 3′UTR* (A,A′,B,B′), *‐R1* (C,C′,D,D′)*, ‐R2* (E,E′,F,F′), and *‐R3* (G,G′,H,H′) in PGCs of normal (A,A′,C,C′,E,E′,G,G′) and *nos* PGCs (B,B′,D,D′,F,F′,H,H′) at stage 15. EGFP protein signal is shown in green, and Vasa in magenta. Scale bar: 10 μm. (I) The nucleotide sequences of α, β, γ, and δ in *CG32425* 3′ UTR (see Fig. 2A) are shown. Nos‐binding sites (red; UAUU) and Pum‐binding sites (blue; UGUA) are indicated.

It has been reported that Nos and Pum recognize Nos‐ and Pum‐binding sites, respectively, to repress the translation of mRNAs carrying these target sequences in their 3′ UTR (Kadyrova et al. 2007; Weidmann et al. 2016). Thus, we examined whether these target sequences are present in CG32425 3′ UTR. Figure 2A shows that region 1 is divided into α and β by the 5′ terminus of region 2, while region 3 is divided into γ and δ by the 3′ terminus of region 2. We found one Nos‐binding site in α, and one Nos‐ and one Pum‐binding site separated by a short intervening sequence in β. The arrangement of these binding sites is compatible with those observed in cycB 3′ UTR (Fig. 3I). Neither the Nos‐ nor the Pum‐binding site was observed in γ (Fig. 3I). In δ, four Nos‐binding sites were present, and only one Pum‐binding site that overlapped partially with one of the four Nos‐binding sites was observed (Fig. 3I).

Expression of endogenous CG32425 mRNA and its protein product in PGCs

The CG32425 locus encodes five mRNA isoforms (Fig. 4A) (FlyBase). Three of them, RA, RC, and RE, share a 3′ UTR region that was used for the aforementioned EGFP reporter assay, while the remaining two, RB and RF, terminate upstream of the 3′ UTR region (Fig. 4A). To examine the expression of CG32425 mRNA with the 3′ UTR in PGCs, we performed in situ hybridization of whole embryos using a digoxygenin (DIG)‐labeled probe detecting RA, RC, and RE isoforms (Fig. 4A; red line). The signal for CG32425 mRNA was distributed throughout cleavage and syncytial blastodermal embryos at stage 4 (Fig. 4B,B′). The signal rapidly decreased in the somatic region, and was subsequently enriched in PGCs of cellular blastodermal embryos at late stage 5 (Fig. 4C,C′). During the rest of embryogenesis, the signal remained detectable in PGCs, while in somatic tissues, such as the central nervous system (CNS), the signal was slightly increased (Fig. 4D,D′,E,E′). An essentially identical expression pattern was observed by fluorescence in situ hybridization (FISH) with probes for the region identical to the DIG‐labeled one (Fig. 4F,F′,H,H′,J,J′,L,L′). However, in nos PGC, the signal for CG32425 mRNA was decreased, compared with that observed in normal PGCs (Fig. 4G,G′,I,I′,K,K′,M,M′). Figures 4O and P clearly show that the number of PGCs with an intense signal being significantly reduced for nos PGCs throughout embryogenesis, compared with that in normal ones.

**Figure 4**
Open in figure viewer PowerPoint

Nos‐dependent upregulation of *CG32425* mRNA expression in PGCs. (A) Genomic organization of the *CG32425* locus, which encodes three transcripts containing the same 3′ UTR: *CG32425*‐RA, ‐RC, and ‐RE. *CG32425‐*RB and ‐RF are terminated upstream of the 3′ UTR region. Exon (boxes), intron (straight lines), and protein coding regions (black boxes) are shown. The Regions corresponding to the probe for *in situ* hybridization (red line) and to the peptide used for CG32425‐antibody production (blue straight line) are indicated. (B–E,B′–E′) Expression of *CG32425* mRNA (blue signal) in whole embryos at stage 4 (B,B′), late stage 5 (C,C′), stage 9 (D,D′), and stage 15 (E,E′). The probe used for *in situ* hybridization is indicated in A. Arrowheads and brackets show PGCs. B′,C′,D′, and E′ show magnification views of B, C, D, and E, respectively. Scale bars: 20 μm (E) and 100 μm (E′). (F–M,F′–M′,N,O,P) *CG32425* mRNA detected by FISH in normal (F,F′,H,H′,J,J′,L,L′) and *nos* PGCs (G,G′,I,I′,K,K′,M,M′) at stage 5 (F,F′,G,G′), stage 9 (H,H′,I,I′), stage 13 (J,J′,K,K′), and stage 15 (L,L′,M,M′). *CG32425* mRNA signal is shown in green, and Vasa is shown in magenta. Scale bars: 10 μm. (N–P) PGCs were classified into three groups depending on their strong (++), middle (+), and low (±) signal intensities for *CG32425* mRNA. The PGCs with only small dotted signals, those with large dotted signals, and those with aggregates of intense dotted signals were judged as ±, +, and ++, respectively. The percentages of stage‐15 PGCs with strong, middle, and low signals in normal (O) and *nos* embryos (P) are plotted against developmental stage number. The numbers of PGCs examined are shown in parentheses. *Significance was calculated between normal and *nos* embryos using Fisher's exact test (P < 0.05).

We went on to determine CG32425 protein expression in PGCs. For this purpose, we raised an antibody against a synthetic peptide corresponding to the C‐terminal region of the CG32425 protein (Fig. 4A; blue line). The antibody signal was almost undetectable in normal PGCs from embryonic stages 4 to 8 (Fig. 5A,A′). The signal later increased in PGCs from stage 9 until the end of embryogenesis (Fig. 5C,C′,E,E′,G,G′). In nos PGCs, the antibody signal was much lower than that observed in normal ones (Fig. 5B,B′,D,D′,F,F′,H,H′). Since the antibody signal was eliminated by maternal RNA interference (RNAi) for CG32425, in which double‐strand RNA was induced in the germline during oogenesis to reduce the maternal mRNA load (Fig. 5I–N,I′–N′), we concluded that this antibody is able to specifically detect the CG32425 protein. Therefore, CG32425 protein expression is upregulated in PGCs in a Nos‐dependent manner.

**Figure 5**
Open in figure viewer PowerPoint

Expression of CG32425 protein in normal and *nos* PGCs. (A–H and A′–H′) Expression of CG32425 protein in PGCs of normal (A,A′,C,C′,E,E′,G,G′) and *nos* PGCs (B,B′,D,D′,F,F′,H,H′) embryos at stage 5 (A,A′,B,B′), stage 10 (C,C′,D,D′), stage 12 (E,E′,F,F′), and stage 15 (G,G′,H,H′). (I–N,I′–N′) Signals detected by an antibody against CG32425 protein were observed in PGCs of normal embryos (I,I′,K,K′,M,M′), but at a reduced level in the PGCs of embryos derived from females expressing double‐strand RNA against *CG32425* mRNA during oogenesis (maternal RNAi), at stage 10 (J,J′), stage 12 (L,L′), and stage 15 (N,N′). Protein signals are shown in green, and Vasa in magenta. Scale bars: 10 μm.

Functional analysis for the CG32425 gene in germline development

Neither point mutation that disrupts CG32425 function nor transposon insertion into the exons of CG32425 mRNA with the 3′ UTR used for the aforementioned EGFP reporter assay has been reported (FlyBase). Furthermore, we failed to isolate the CG32425 mutation by using CRISPR‐Cas9 system (Gratz et al. 2014). Thus, we tried to reduce CG32425 activity using RNAi. As shown in Figure 5I–N,I′–N′, maternal RNAi for CG32425 eliminated expression of the corresponding protein in PGCs. However, maternal RNAi for CG32425 did not affect the fertility of the adult progeny. The percentages of dysgenic ovaries and of dysgenic testes were 1.32% and 0% [the numbers of gonads observed (n) were 77 and 40], respectively. In control adults, the respective percentages were 1.50% and 0% (n = 135 and 80) (see Materials and method).

Discussion

Stabilization of CG32425 mRNA in PGCs by maternal Nos protein via CG32425 3′ UTR

In this study, we found that the expression of EGFP‐CG32425 3′UTR mRNA increased in PGCs in a Nos‐dependent manner, while the expression of EGFP‐K10 3′UTR and ‐cycB 3′UTR mRNAs was similar in normal and nos PGCs (Fig. 1G–L,G′–L′). We expected that these three mRNAs are initially produced at an identical level in normal and nos PGCs, because they are transcribed from the same promoter activated by nos‐Gal4. Furthermore, these transgenes were inserted into the same chromosomal locus, suggesting that the chromosomal environment encompassing these transgenes, which may affect their transcription, is identical in both normal and nos PGCs. Thus, the alteration of EGFP‐CG32425 3′UTR mRNA expression in nos PGCs occurs at a post‐transcriptional level. Therefore, it is reasonable to conclude that EGFP‐CG32425 3′UTR mRNA is stabilized in PGCs in a Nos‐dependent manner via its 3′ UTR.

CG32425 3′ UTR contains a region that promotes RNA stabilization in PGCs

In our deletion experiment of CG32425 3′ UTR, we found that the expression level of EGFP‐R3 mRNA, but not EGFP‐R2, was reduced in nos PGCs compared with normal PGCs (Fig. 2F–I,F′–I′,K,L). This strongly suggests that the regulatory element for RNA stabilization is present in δ, which is included in region 3, but not in region 2 (Fig. 2A). However, expression of EGFP‐R3 mRNA, which contains δ, was less than that of EGFP‐CG32425 3′UTR in normal PGCs (Fig. 2B,B′,H,H′,K), suggesting the presence of another regulatory element for RNA stabilization in region 1. Since EGFP‐R1 mRNA in normal PGCs was conversely decreased compared with that observed in nos PGCs (Fig. 2D,D′,E,E′,K,L), the additional element is, by itself, unable to contribute to RNA stabilization, but may act synergistically with the element in δ to stabilize mRNA in PGCs.

We found that the levels of RNA and protein expressed from UASp‐EGFP‐R1 and ‐R2 transgenes in nos PGCs was higher than those in normal PGCs (Figs 2D–G,D′–G′,K,L, 3C–F,C′–F′). This suggests that β, which is included in both region 1 and region 2, contains the element for Nos‐dependent RNA degradation. Interestingly, β contains one Nos‐ and one Pum‐binding site separated by a short intervening sequence (Fig. 3I). A similar arrangement of these binding sites is observed in cycB 3′ UTR, which is required for Nos‐dependent translational repression. Nos and Pum proteins bind to cycB 3′ UTR through the Nos‐ and Pum‐binding sites, respectively (Asaoka‐Taguchi et al. 1999; Kadyrova et al. 2007). These proteins recruit the deadenylase CCR4‐NOT complex to shorten poly(A) tails, which consequently represses translation of cycB mRNA (Kadyrova et al. 2007). We speculate that a similar interaction among Nos, Pum, and the CCR4‐NOT complex occurs in β to cause the deadenylation of EGFP‐R1 and ‐R2 mRNA, which, in turn, induces their destabilization and translational repression. By contrast, δ contains four Nos‐binding sites and only one Pum‐binding site that overlaps with one of the four Nos‐binding sites (Fig. 3I). This leads us to speculate that Nos protein, along with a cofactor other than Pum, binds to δ to stabilize the mRNA. Thus, we assume that Nos protein stabilizes mRNA in a Pum‐independent manner.

Nos‐dependent stabilization of CG32425 mRNA in PGCs

CG32425 mRNA is maternally supplied throughout early embryos, but is degraded rapidly in the somatic region at stage 5. The remaining CG32425 mRNA in PGCs persists until at least the end of embryogenesis (Fig. 4B–F,H,J,L,B′–F′,H′,J′,L′). Translation of CG32425 mRNA initiates after stage 9, which in turn accumulates CG32425 protein in PGCs (Fig. 5A,A′,C,C′,E,E′,G,G′). During embryogenesis, maternal Nos protein is critical for the expression of CG32425 mRNA and its protein product in PGCs (Figs 4F–M,F′–M′,O,P, 5A–H,A′–H′). Our observation that the maternal RNAi for CG32425 eliminated CG32425 protein expression in PGCs throughout embryogenesis (Fig. 5I–N,I′–N′) indicates that maternal CG32425 mRNA is dominant in PGCs, and the zygotic level of CG32425 mRNA is low, if any, in these cells. Thus, it is reasonable to conclude that maternal CG32425 mRNA is stabilized in PGCs by maternal Nos protein. In the future, this should be tested by examining whether deleting Nos‐binding sites from maternal CG32425 mRNA causes its destabilization in PGCs.

In the somatic region of early embryos, maternal CG32425 mRNA was rapidly degraded (Fig. 4B,B′,C,C′). Maternal RNAs are degraded in early embryos during the maternal to zygotic transition (MZT) by specific decay mechanisms that involve RNA binding proteins [e.g., Smaug (Smg) and Pum], and small non‐coding RNAs [e.g., microRNAs and Piwi‐interacting RNAs (piRNAs)] to recruit the CCR4‐NOT complex to the target RNAs (Barckmann & Simonelig 2013). Although it remains unclear whether these decay mechanisms work in PGCs, Nos protein may associate with a cofactor other than Pum on 3′ UTR of CG32425 mRNA to repress or antagonize the CCR4‐NOT‐dependent decay mechanisms.

Nos has long been known as a translational repressor in various animal species, including Drosophila melanogaster (Wang & Lehmann 1991; Kraemer et al. 1999; Tsuda et al. 2003; Suzuki et al. 2010; Lai et al. 2011; Weidmann et al. 2016). However, we report for the first time here that maternal Nos acts to stabilize specific mRNAs. Thus, Nos protein has dual functions in translational repression and the stabilization of specific RNAs. Although it remains elusive whether CG32425 mRNA stabilization results from elongation of its poly(A) tail, Nos may exert opposing functions during deadenylation and polyadenylation in PGCs. It should be noted that a cytoplasmic polyadenylation element (CPE)‐binding protein (CPEBP), which binds CPE in 3′ UTR of mRNAs in Xenopus oocytes, shows similar opposing functions by switching interactants (Kim & Richter 2006; Barckmann & Simonelig 2013). As mentioned above, we assume that Nos stabilizes mRNA in a Pum‐independent manner. Hence, it would be interesting to test whether Pum is required to stabilize CG32425 mRNA in PGCs, and to identify interactants that help stabilize mRNA in PGCs.

We previously reported that, in the absence of maternal Nos, PGCs that successfully migrate into the embryonic gonads never differentiate into functional germ cells (Hayashi et al. 2004). This suggests that Nos upregulates the expression of genes required for germline development in PGCs. However, we failed to clarify the role of CG32425 in PGCs, due to the lack of its mutation. Therefore, it is particularly important to identify the other mRNAs stabilized by maternal Nos in PGCs, and to determine their function in germline development. It is worth noting that maternal nos mRNA itself is stabilized and translated in germ plasm and PGCs, through the function of localized Oskar (Osk) protein, which prevents the binding of Smg to nos mRNA to abrogate its deadenylation (Zaessinger et al. 2006; Barckmann & Simonelig 2013). We propose that the stabilization of maternal mRNAs plays an important role in initiating proper germline gene expression in PGCs. Our data provides the first step toward elucidating the novel function of maternal Nos in germline development.

Acknowledgments

We thank Dr. B. Suter for providing the transformation vector, the NIG stock center and the Bloomington Drosophila Stock Center for providing us with fly strains, and the Developmental Studies Hybridoma Bank for antibodies. This work was supported in part by Grants‐in‐Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS) (KAKENHI Grant Numbers: 25114002 and 24247011).

Author contributions

S. S., Y. K. and S. K. designed the experiments. S. S. and Y. K. performed the experiments, and S. S. and S. K. wrote the paper. All authors reviewed manuscripts.

References

Asaoka‐Taguchi, M., Yamada, M., Nakamura, A., Hanyu, K. & Kobayashi, S. 1999. Maternal Pumilio acts together with Nanos in germline development in Drosophila embryos. Nat. Cell Biol. 1, 431– 437.
Crossref CAS PubMed Web of Science®Google Scholar
Barckmann, B. & Simonelig, M. 2013. Control of maternal mRNA stability in germ cells and early embryos. Biochim. Biophys. Acta 1829, 714– 724.
Crossref CAS PubMed Web of Science®Google Scholar
Bischof, J., Maeda, R. K., Hediger, M., Karch, F. & Basler, K. 2007. An optimized transgenesis system for Drosophila using germ‐line‐specific phiC31 integrases. Proc. Natl Acad. Sci. USA 104, 3312– 3317.
Crossref CAS PubMed Web of Science®Google Scholar
Brown, N. H. & Kafatos, F. C. 1988. Functional cDNA libraries from Drosophila embryos. J. Mol. Biol. 203, 425– 437.
Crossref CAS PubMed Web of Science®Google Scholar
Campos‐Ortega, J. A. & Hartenstein, V. 1985. The Embryonic Development of Drosophila melanogaster. Springer, New York.
Crossref Google Scholar
Deshpande, G., Calhoun, G., Yanowitz, J. L. & Schedl, P. D. 1999. Novel functions of nanos in downregulating mitosis and transcription during the development of the Drosophila germline. Cell 99, 271– 281.
Crossref CAS PubMed Web of Science®Google Scholar
Extavour, C. G. & Akam, M. 2003. Mechanisms of germ cell specification across the metazoans: epigenesis and preformation. Development 130, 5869– 5884.
Crossref CAS PubMed Web of Science®Google Scholar
Forbes, A. & Lehmann, R. 1998. Nanos and Pumilio have critical roles in the development and function of Drosophila germline stem cells. Development 125, 679– 690.
CAS PubMed Web of Science®Google Scholar
Gerber, A. P., Luschnig, S., Krasnow, M. A., Brown, P. O. & Herschlag, D. 2006. Genome‐wide identification of mRNAs associated with the translational regulator PUMILIO in Drosophila melanogaster. Proc. Natl Acad. Sci. USA 103, 4487– 4492.
Crossref CAS PubMed Web of Science®Google Scholar
Gratz, S. J., Ukken, F. P., Rubinstein, C. D., Thiede, G., Donohue, L. K., Cummings, A. M. & O'Connor‐Giles, K. M. 2014. Highly specific and efficient CRISPR/Cas9‐catalyzed homology‐directed repair in Drosophila. Genetics 196, 961– 971.
Crossref CAS PubMed Web of Science®Google Scholar
Hanyu‐Nakamura, K., Sonobe‐Nojima, H., Tanigawa, A., Lasko, P. & Nakamura, A. 2008. Drosophila Pgc protein inhibits P‐TEFb recruitment to chromatin in primordial germ cells. Nature 451, 730– 733.
Crossref CAS PubMed Web of Science®Google Scholar
Hayashi, Y., Hayashi, M. & Kobayashi, S. 2004. Nanos suppresses somatic cell fate in Drosophila germ line. Proc. Natl Acad. Sci. USA 101, 10338– 10342.
Crossref CAS PubMed Web of Science®Google Scholar
Hayashi, M., Shinozuka, Y., Shigenobu, S., Sato, M., Sugimoto, M., Ito, S., Abe, K. & Kobayashi, S. 2017. Conserved role of Ovo in germline development in mouse and Drosophila. Sci. Rep. 7, 40056.
Crossref CAS PubMed Web of Science®Google Scholar
Ikenishi, K. 1998. Germ plasm in Caenorhabditis elegans, Drosophila and Xenopus. Dev. Growth Differ. 40, 1– 10.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Illmensee, K. & Mahowald, A. P. 1974. Transplantation of posterior polar plasm in Drosophila. Induction of germ cells at the anterior pole of the egg. Proc. Natl Acad. Sci. USA 71, 1016– 1020.
Crossref PubMed Web of Science®Google Scholar
Irish, V., Lehmann, R. & Akam, M. 1989. The Drosophila posterior‐group gene nanos functions by repressing hunchback activity. Nature 338, 646– 648.
Crossref PubMed Web of Science®Google Scholar
Kadyrova, L. Y., Habara, Y., Lee, T. H. & Wharton, R. P. 2007. Translational control of maternal Cyclin B mRNA by Nanos in the Drosophila germline. Development 134, 1519– 1527.
Crossref CAS PubMed Web of Science®Google Scholar
Kato, S., Ohtoko, K., Ohtake, H. & Kimura, T. 2005. Vector‐capping: a simple method for preparing a high‐quality full‐length cDNA library. DNA Res. 12, 53– 62.
Crossref CAS PubMed Web of Science®Google Scholar
Kim, J. H. & Richter, J. D. 2006. Opposing polymerase‐deadenylase activities regulate cytoplasmic polyadenylation. Mol. Cell 24, 173– 183.
Crossref CAS PubMed Web of Science®Google Scholar
Kobayashi, S., Yamada, M., Asaoka, M. & Kitamura, T. 1996. Essential role of the posterior morphogen nanos for germline development in Drosophila. Nature, 380, 708– 711.
Crossref CAS PubMed Web of Science®Google Scholar
Köprunner, M., Thisse, C., Thisse, B. & Raz, E. 2001. A zebrafish nanos‐related gene is essential for the development of primordial germ cells. Genes Dev. 15, 2877– 2885.
CAS PubMed Web of Science®Google Scholar
Kraemer, B., Crittenden, S., Gallegos, M., Moulder, G., Barstead, R., Kimble, J. & Wickens, M. 1999. NANOS‐3 and FBF proteins physically interact to control the sperm‐oocyte switch in Caenorhabditis elegans. Curr. Biol. 9, 1009– 1018.
Crossref CAS PubMed Web of Science®Google Scholar
Kumar, A., Bhandari, A., Sinha, R., Sardar, P., Sushma, M., Goyal, P., Goswami, C. & Grapputo, A. 2012. Molecular phylogeny of OVOL genes illustrates a conserved C2H2 zinc finger domain coupled by hypervariable unstructured regions. PLoS One 7, e39399.
Crossref CAS PubMed Web of Science®Google Scholar
Lai, F., Zhou, Y., Luo, X., Fox, J. & King, M. L. 2011. Nanos1 functions as a translational repressor in the Xenopus germline. Mech. Dev. 128, 153– 163.
Crossref CAS PubMed Web of Science®Google Scholar
Martinho, R. G., Kunwar, P. S., Casanova, J. & Lehmann, R. 2004. A noncoding RNA is required for the repression of RNA polII‐dependent transcription in primordial germ cells. Curr. Biol. 14, 159– 165.
Crossref CAS PubMed Web of Science®Google Scholar
Mével‐Ninio, M., Terracol, R., Salles, C., Vincent, A. & Payre, F. 1995. ovo, a Drosophila gene required for ovarian development, is specifically expressed in the germline and shares most of its coding sequences with shavenbaby, a gene involved in embryo patterning. Mech. Dev. 49, 83– 95.
Crossref CAS PubMed Web of Science®Google Scholar
Mochizuki, K., Sano, H., Kobayashi, S., Nishimiya‐Fujisawa, C. & Fujisawa, T. 2000. Expression and evolutionary conservation of nanos‐related genes in Hydra. Dev. Genes. Evol. 210, 591– 602.
Crossref CAS PubMed Web of Science®Google Scholar
Mosquera, L., Forristall, C., Zhou, Y. & King, M. L. 1993. A mRNA localized to the vegetal cortex of Xenopus oocytes encodes a protein with a nanos‐like zinc finger domain. Development 117, 377– 386.
CAS PubMed Web of Science®Google Scholar
Pilon, M. & Weisblat, D. A. 1997. A nanos homolog in leech. Development 124, 1771– 1780.
CAS PubMed Web of Science®Google Scholar
Rörth, P. 1998. Gal4 in the Drosophila female germline. Mech. Dev. 78, 113– 118.
Crossref CAS PubMed Web of Science®Google Scholar
Sato, K., Hayashi, Y., Ninomiya, Y., Shigenobu, S., Arita, K., Mukai, M. & Kobayashi, S. 2007. Maternal Nanos represses hid/skl‐dependent apoptosis to maintain the germ line in Drosophila embryos. Proc. Natl Acad. Sci. USA 104, 7455– 7460.
Crossref CAS PubMed Web of Science®Google Scholar
Shigenobu, S., Arita, K., Kitadate, Y., Noda, C. & Kobayashi, S. 2006. Isolation of germline cells from Drosophila embryos by flow cytometry. Dev. Growth Differ. 48, 49– 57.
Wiley Online Library CAS PubMed Web of Science®Google Scholar
Sonoda, J. & Wharton, R. P. 1999. Recruitment of Nanos to hunchback mRNA by Pumilio. Genes Dev. 13, 2704– 2712.
Crossref CAS PubMed Web of Science®Google Scholar
Subramaniam, K. & Seydoux, G. 1999. nos‐1 and nos‐2, two genes related to Drosophila nanos, regulate primordial germ cell development and survival in Caenorhabditis elegans. Development 126, 4486– 4871.
Web of Science®Google Scholar
Suzuki, A., Igarashi, K., Aisaki, K., Kanno, J. & Saga, Y. 2010. NANOS2 interacts with the CCR4‐NOT deadenylation complex and leads to suppression of specific RNAs. Proc. Natl Acad. Sci. USA 107, 3594– 3599.
Crossref CAS PubMed Web of Science®Google Scholar
Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K., Haraguchi, S., Kobayashi, S. & Saga, Y. 2003. Conserved role of nanos proteins in germ cell development. Science 301, 1239– 1241.
Crossref CAS PubMed Web of Science®Google Scholar
Van Doren, M., Williamson, A. L. & Lehmann, R. 1998. Regulation of zygotic gene expression in Drosophila primordial germ cells. Curr. Biol. 8, 243– 246.
Crossref PubMed Web of Science®Google Scholar
Venken, K. J., He, Y., Hoskins, R. A. & Bellen, H. J. 2006. P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314, 1747– 1751.
Crossref CAS PubMed Web of Science®Google Scholar
Wang, C. & Lehmann, R. 1991. Nanos is the localized posterior determinant in Drosophila. Cell 66, 637– 647.
Crossref CAS PubMed Web of Science®Google Scholar
Weidmann, C. A., Qiu, C., Arvola, R. M., Lou, T. F., Killingsworth, J., Campbell, Z. T., Tanaka Hall, T. M. & Goldstrohm, A. C. 2016. Drosophila Nanos acts as a molecular clamp that modulates the RNA‐binding and repression activities of Pumilio. Elife 5, e17096.
Crossref PubMed Web of Science®Google Scholar
Wreden, C., Verrotti, A. C., Schisa, J. A., Lieberfarb, M. E. & Strickland, S. 1997. Nanos and pumilio establish embryonic polarity in Drosophila by promoting posterior deadenylation of hunchback mRNA. Development 124, 3015– 3023.
CAS PubMed Web of Science®Google Scholar
Yatsu, J., Hayashi, M., Mukai, M., Arita, K., Shigenobu, S. & Kobayashi, S. 2008. Maternal RNAs encoding transcription factors for germline‐specific gene expression in Drosophila embryos. Int. J. Dev. Biol. 52, 913– 923.
Crossref CAS PubMed Web of Science®Google Scholar
Zaessinger, S., Busseau, I. & Simonelig, M. 2006. Oskar allows nanos mRNA translation in Drosophila embryos by preventing its deadenylation by Smaug/CCR4. Development 133, 4573– 4583.
Crossref CAS PubMed Web of Science®Google Scholar

Citing Literature

Volume60, Issue1

January 2018

Pages 63-75

Maternal Nanos‐Dependent RNA Stabilization in the Primordial Germ Cells of Drosophila Embryos

Abstract

Introduction