Conservation of two distinct types of 100S ribosome in bacteria
Communicated by: Hiroji Aiba
Abstract
In bacteria, 70S ribosomes (consisting of 30S and 50S subunits) dimerize to form 100S ribosomes, which were first discovered in Escherichia coli. Ribosome modulation factor (RMF) and hibernation promoting factor (HPF) mediate this dimerization in stationary phase. The 100S ribosome is translationally inactive, but it dissociates into two translationally active 70S ribosomes after transfer from starvation to fresh medium. Therefore, the 100S ribosome is called the ‘hibernating ribosome’. The gene encoding RMF is found widely throughout the Gammaproteobacteria class, but is not present in any other bacteria. In this study, 100S ribosome formation in six species of Gammaproteobacteria and eight species belonging to other bacterial classes was compared. There were several marked differences between the two groups: (i) Formation of 100S ribosomes was mediated by RMF and short HPF in Gammaproteobacteria species, similar to E. coli, whereas it was mediated only by long HPF in the other bacterial species; (ii) RMF/short HPF‐mediated 100S ribosome formation occurred specifically in stationary phase, whereas long HPF‐mediated 100S ribosome formation occurred in all growth phases; and (iii) 100S ribosomes formed by long HPF were much more stable than those formed by RMF and short HPF.
Introduction
During the stationary phase of Escherichia coli cell growth, ribosome modulation factor (RMF; 55 amino acids) is specifically expressed, binds to 70S ribosomes and induces their dimerization to form the 100S ribosome (Wada et al. 1990). The 100S ribosome lacks translational activity, because RMF binds to the 70S ribosome, binds close to the peptidyl transferase center and peptide exit tunnel, and 100S ribosome do not contain tRNA and mRNA (Wada et al. 1995; Yoshida et al. 2002, 2004; Kato et al. 2010). RMF is essential for 100S ribosome formation in vivo (Yamagishi et al. 1993) and in vitro (Wada et al. 1995). The expression of RMF is positively regulated by ppGpp (Izutsu et al. 2001). In an rmf E. coli deletion mutant, the 100S ribosome fails to form and the mutant survives for a shorter length of time than the wild‐type strain during stationary phase (Yamagishi et al. 1993).
Hibernation promoting factor (HPF; 95 amino acids) promotes formation of 100S ribosomes. In vivo studies using hpf (yhbH) deletion mutants indicate that RMF binds to the 70S ribosome, which dimerizes to form unfolded particles of approximately 90S. Thereafter, the particles are converted from 90S to 100S by the binding of HPF (Ueta et al. 2005). These findings were confirmed by in vitro studies using purified HPF and RMF proteins (Ueta et al. 2008).
YfiA (113 amino acids), a paralog of HPF, is expressed specifically in stationary phase (Maki et al. 2000). Although YfiA shares 40% sequence homology with HPF, it interferes with 100S ribosome formation (Ueta et al. 2005). The structure of HPF has been determined by multi‐dimensional NMR (Sato et al. 2009). HPF uses a βαβββα‐fold structure (Fig. S2B in Supporting Information) and contains a ribosome‐binding region similar to YfiA (Fig. S2B in Supporting Information; Rak et al. 2002; Ye et al. 2002), as expected from their sequence homology. In contrast to YfiA, HPF contains structural modifications that may be involved in coordinating its activity with RMF. These include the absence of a C‐terminal extension, the stabilization of the α2 helix and the conservation of acidic residues that are exposed at the rim of the common basic patch.
RMF inhibits the binding of aminoacyl‐tRNA to ribosomes and translational activity in vitro (Wada et al. 1995). Although HPF inhibits in vitro translation activity in a poly (U)‐dependent phenylalanine incorporation assay, it does not inhibit normal in vitro translation activity in an MS2 mRNA‐dependent leucine incorporation assay (Ueta et al. 2008), as ribosome‐bound HPF is removed by IF3 (Ueta et al. 2008; Yoshida et al. 2009).
When E. coli cells are transferred from starvation to fresh medium, RMF and HPF are immediately released from the 100S ribosome, and the dissociated 70S ribosomes participate in translation (Wada 1998; Maki et al. 2000). This rapid process is completed within 1 min of the transfer (Aiso et al. 2005), and cells start to proliferate within 6 min. In E. coli, the 100S ribosome represents a resting form within the ribosome cycle, and the process of 100S ribosome formation has been termed ‘ribosomal hibernation’ (Yoshida et al. 2002). Interconversion between the inactive 100S ribosome and the active 70S ribosome is important for regulating translational responses to environmental changes.
Cryo‐electron microscopy has showed that the 100S ribosome comprises two tRNA‐free 70S ribosomes in E. coli, which have twofold symmetry (Kato et al. 2010). Formation of the 100S ribosome occurs through interaction between the small subunit proteins S2, S3 and S5, which appear to be critical for the dimerization process. It is suggested that conformational changes around the S2–S5 region may inhibit binding of mRNA after the formation of the 100S ribosome. Ortiz et al. (2010) showed by cryo‐electron tomography that native E. coli cells contain 100S ribosomes. Krokowski et al. (2011) observed 110S ribosomes composed of ribosome dimers in nutrient‐starved rat cells.
HPF and RMF are involved in the formation of the 100S ribosome. Although RMF homologues are only present in the Gammaproteobacteria class, HPF homologues are found in almost all bacteria (Ueta et al. 2008). Phylogenetic analysis has classified HPF homologues into four types: long HPF, short HPF, YfiA and plant plastid HPF (Ueta et al. 2008). All these homologues possess a common conserved region in the N‐terminal half (amino acids 1–95). The HPF homologues found in the Gammaproteobacteria and Betaproteobacteria classes are short, whereas bacteria in other classes have long HPF homologues that are approximately double the molecular weight of short HPF. Long HPF homologues include YvyD of Bacillus subtilis (Drzewiecki et al. 1998; Nanamiya et al. 2004; Tam et al. 2006) and plant plastid PSRP‐1 (Johnson et al. 1990; Yamaguchi & Subramanian 2003; Sharma et al. 2007), which both bind ribosomes. Staphylococcus aureus has no RMF homologue and forms 100S ribosomes using only its long HPF homologue (SaHPF) (Ueta et al. 2010). These results suggest that long HPF might mediate 100S ribosome formation in many bacteria that lack RMF homologues.
In this study, we compared 100S ribosome formation in six species belonging to the Gammaproteobacteria class and eight species belonging to other bacterial classes. This study reports in detail how 100S ribosome formation mediated by long HPF homologues occurs in Lactobacillus paracasei and Thermus thermophilus. 100S ribosome formation was also observed in five other bacterial strains possessing a long HPF homologue. The findings of this study suggest that 100S ribosomes form in the majority of bacteria with a long HPF homologue. We propose that bacteria have evolved two distinct mechanisms by which 100S ribosomes form, one involving RMF and short HPF, and the other involving only long HPF.
Results
100S ribosome formation in Gammaproteobacteria and Betaproteobacteria species
Gammaproteobacteria have rmf and hpf genes. The formation of 100S ribosomes mediated by RMF and HPF has been reported in detail in E. coli (Wada et al. 1990, 2000; Yamagishi et al. 1993; Wada 1998; Ueta et al. 2005). Here, 100S ribosome formation was analyzed and compared in five Gammaproteobacteria species, namely Salmonella typhimurium, Proteus mirabilis, Serratia marcescens, Klebsiella pneumoniae and Pectobacterium carotovorum, and also in E. coli. E. coli, S. typhimurium and P. mirabilis were grown at 37 °C, and Se. marcescens, K. pneumoniae and Pe. carotovorum were grown at 30 °C in EP medium with shaking (Wada et al. 2000). Crude ribosome (CR) fractions were prepared from the various strains in exponential phase (turbidity of 50 Klett units) or stationary phase (after 2 or 3 days of culture). The ribosome profiles were analyzed by 5–20% sucrose density gradient (SDG) centrifugation (Fig. 1A). In E. coli, 100S ribosomes are not detected during the majority of exponential phase, and low levels appear at the end of exponential phase. The level of 100S ribosomes increases during stationary phase and is highest after 3–4 days of culture, after which they dissociate into 70S ribosomes that are rapidly degraded (Wada 1998; Wada et al. 2000). Similarly, 100S ribosomes were not detected in exponential phase but were detected in stationary phase in each of the five species tested. In S. typhimurium, P. mirabilis and Se. marcescens, 100S ribosomes were most abundant after 2–4 days of culture, after which the level decreased (Fig. S1 in Supporting Information). RMF and HPF proteins were detected in each of the six species in stationary phase using radical‐free and highly reducing two‐dimensional polyacrylamide gel electrophoresis (RFHR 2‐D PAGE) (Fig. 1B). The RMF and HPF protein sequences are highly conserved among the tested strains (Figs S2A,B in Supporting Information).

100S ribosomes did not form in any growth phase in the Betaproteobacteria species Burkholderia multivorans (Fig. S3 in Supporting Information), which lacks RMF and has a short HPF homologue that differs from that found in Gammaproteobacteria species (Fig. S2B in Supporting Information).
Time course of 100S ribosome formation in Lactobacillus paracasei
100S ribosome formation was examined in eight bacterial species that do not belong to the Gammaproteobacteria and Betaproteobacteria species, namely S. aureus, five Lactobacillaceae species, T. thermophilus and Synechocystis sp. PCC6803, which have neither genes for RMF nor short HPF but have a gene for long HPF. Among these species, S. aureus forms 100S ribosomes. Unexpectedly, 100S ribosomes are detected throughout exponential phase. The key protein that mediates 100S ribosome formation is long HPF, the molecular weight of which is approximately twofold greater than that of short HPF (Ueta et al. 2010).
We examined 100S ribosome formation in L. paracasei. Bacteria were grown in modified MRS medium at 37 °C (doubling time is approximately 2 h), and cell growth was measured by turbidity (Klett units) (Fig. 2A). Cells were harvested in exponential phase (after approximately 4 h of culture when turbidity reached 50 Klett units), the transition stage before entering stationary phase (hereafter referred to as ‘transition phase’; after 8 h of culture) and stationary phase (after 16, 24 and 48 h of culture). CR fractions prepared from each sample were analyzed by 5–20% SDG centrifugation, and the ribosome profiles are shown in Fig. 2B. 100S ribosomes were detected throughout both exponential phase and stationary phase (Fig. 2B). 100S ribosomes accounted for 51% of the total ribosome fraction in exponential phase; this peaked during transition phase (68% after 8 h of culture) and then decreased during stationary phase (30% and 37% after 16 and 24 h of culture, respectively) (Fig. 2C). Similar results were obtained when cells were cultured in MRS medium (doubling time is approximately 90 min). These results show that 100S ribosomes are present throughout the growth cycle in L. paracasei, similar to S. aureus (Fig. 2B).

Analysis of ribosomal and ribosome‐associated proteins in CR fractions from Lactobacillus paracasei
A proteomics approach was used to search for key factors involved in 100S ribosome formation in L. paracasei. Ribosomal proteins (r‐proteins) and ribosome‐associated proteins in the CR fractions of L. paracasei were analyzed using RFHR 2‐D PAGE. CR, 50S subunit and 30S subunit fractions were prepared from bacteria in exponential phase. Proteins were extracted from each fraction using the acetic acid method and were analyzed by RFHR 2‐D PAGE (Fig. 3A,B). After staining the gels with Coomassie Brilliant Blue (CBB), the spots were identified by matrix‐assisted laser desorption/ionization time‐of‐flight mass spectrometry (MALDI‐TOF MS).

The genome of L. paracasei contains 23 genes encoding small subunit r‐proteins (S1–S21, two S14 proteins) and 33 genes encoding large‐subunit r‐proteins (L1–L36, including L33.2 and excluding L7, L8, L25 and L26) (Lactobacillus paracasei subsp. paracasei ATCC 25302, GOLD CARD: Gi03755). In RFHR 2‐D PAGE analysis of the L. paracasei CR fraction, 21 of the small subunit r‐proteins (all except for the two S14 proteins) and 29 of the large‐subunit r‐proteins (all except for L21, L29, L33.2 and L36) were identified (Fig. 3A,B, and Table S2 in Supporting Information). L9 was found in the CR fraction (Fig. 3A), but not in the ribosome fraction washed with high salt buffer (Table S2 in Supporting Information), which suggests that this protein binds to ribosome particles more weakly than the other r‐proteins.
Proteins were extracted from the CR fractions of cells at growth stages 1, 2, 3 and 4, corresponding to culture for 4, 8, 16 and 24 h, respectively (Fig. 2A), and analyzed by RFHR 2‐D PAGE. In addition to the r‐proteins, ten CR‐associated proteins were detected and identified by MALDI‐TOF MS (Fig. 3A,B, Table 1). Stained spot densities were measured using a densitometer, and the copy number of each protein was calculated by comparison with ribosomal proteins with a known copy number. Spots 2–10 were released from the ribosomal fraction by high salt washing, whereas spot 1 was not (Table 1). This persistence of spot 1 is consistent with the fact that 100S ribosomes of L. paracasei do not dissociate into 70S ribosome even with high salt washing (Fig. 8B). In addition, spot 1 was located in the 30S subunit but not in the 50S subunit of the 100S and 70S ribosome fractions (Fig. 3B, Table 1). Spot 1 was identified as the long HPF homologue (accession number; gi|227535602, ribosome‐associated inhibitor protein Y) of L. paracasei and named LpHPF (accession number, AB744219). The molecular weight of LpHPF (185 amino acid, MW = 20 998 Da, pI = 6.19) is almost double that of its E. coli homologue (HPF; 95 amino acid, MW = 10 750 Da, pI = 6.50). As expected from the pI values, LpHPF was located to the lower right of L10 (168 amino acid, MW = 18 176 Da, pI = 5.17) on the RFHR 2‐D PAGE gels (Fig. 3A). These results strongly suggest that LpHPF is a key factor for 100S ribosome formation in L. paracasei.
| Spot No. | Accession No. | Protein name | Spot density on RFHR 2‐D gel | ||||||
|---|---|---|---|---|---|---|---|---|---|
| 4 h CR | 8 h CR | 16 h CR | 24 h CR | 4 h HSR | 8 h 30S | 8 h 50S | |||
| 1 | gi|227535602 | Ribosome‐associated inhibitor protein Y (LpHPF) | +++ (++) | +++ (+++) | +++ | +++ | +++ | +++ | − |
| 2 | gi|239631540 | Bacterial nucleoid protein Hbs | +++ | +++ | +++ | +++ | − | − | − |
| 3 | gi|227534847 | Conserved hypothetical protein | + | + | ++ | ++ | − | − | − |
| 4 | gi|227535203 | Pyruvate dehydrogenase complex, E2 component, dihydrolipoamide acetyltransferase | ++ | ++ | +++ | +++ | + | − | + |
| 5 | gi|227533210 | Myosin cross‐reactive antigen | ++ | ++ | +++ | +++ | + | − | + |
| 6 | gi|227535202 | Pyruvate dehydrogenase complex E3 component, dihydrolipoamide dehydrogenase | + | + | +++ | +++ | − | − | + |
| 7 | gi|239631582 | Trigger factor | +++ | +++ | +++ | +++ | + | − | + |
| 8 | gi|227535556 | Enolase (2‐phosphoglycerate dehydratase) | +++ | +++ | +++ | +++ | + | − | + |
| 9 | gi|116805224 | Pyruvate dehydrogenase complex E1 component, alpha subunit | ++ | +++ | +++ | +++ | + | − | + |
| 10 | gi|227535204 | Pyruvate dehydrogenase complex E1 component, beta subunit | ++ | +++ | +++ | +++ | + | − | + |
- The ribosome‐associated proteins in CR fractions from cells in exponential phase (4 h), transition phase (8 h) and stationary phase (16 or 24 h) were identified on RFHR 2‐D PAGE gels (see Fig. 2A,B). In addition to r‐proteins, 10 other proteins were found in the CR fractions. The genome sequences of Lactobacillus paracasei subsp. paracasei ATCC 25302, L. paracasei subsp. paracasei 8700:2 and L. paracasei were used to identify these proteins. The NCBI accession number of each gene is shown. Data from high salt‐washed ribosomes (HSR) from cells in exponential phase (4 h) and dissociated subunits (30S and 50S) from cells in transition phase (8 h) are shown in the right column [+++, copy number >0.3; ++, copy number 0.1–0.3; +, copy number <0.1; −, spots not detected on the RFHR 2‐D PAGE gel; and (++), (+++), copy number in 70S ribosomes].
Correlation between 100S ribosome content and the copy number of LpHPF
Lactobacillus paracasei cells were harvested after culture for 4, 8, 16, 24 and 48 h, and the 100S ribosome content and LpHPF copy number were measured. The profiles of ribosome particles in CR fractions were analyzed by SDG centrifugation (Fig. 2B). The percentage of 100S ribosomes in the total ribosome particles at different time points is shown in Fig. 2C. Proteins were extracted from each CR fraction and separated by RFHR 2‐D PAGE, and the density of the stained spots was measured with a densitometer to calculate the protein copy number. LpHPF was detected during exponential phase (4 h), similar to SaHPF of S. aureus. The level of LpHPF increased in transition phase (8 h) and peaked during early stationary phase (16 h) (Fig. 4A). The increase in the level of LpHPF up to 8 h correlated with an increase in the 100S ribosome content (Fig. 4A). The abundance of 100S ribosomes decreased during stationary phase (16, 24 and 48 h), although the LpHPF copy number remained high (Fig. 4A). The profiles of ribosome particles in cell extract fractions were analyzed by SDG centrifugation, and the levels of LpHPF in each fraction (soluble, 30S subunit, 50S subunit, 70S ribosome and 100S ribosome) were monitored by Western blotting (Fig. S4 in Supporting Information). The ribosome profiles of cell extracts and CR fractions were similar in various growth phases (compare Fig. 2B with Fig. S4 in Supporting Information), and LpHPF was present in 70S and 100S ribosomes but not in the 30S subunit, 50S subunit or soluble fractions (Fig. S4 in Supporting Information). This finding shows that LpHPF binds 70S ribosomes as well as 100S ribosomes.

LpHPF is present in 100S ribosomes during exponential phase
To investigate the localization of LpHPF in detail, CR fractions prepared from cultures grown for 4 or 8 h were separated into 100S ribosome, 70S ribosome and 50S+30S subunit fractions using preparative SDG centrifugation. Proteins extracted from each fraction were analyzed by RFHR 2‐D PAGE. In exponential phase (4 h), LpHPF was present in the 70S ribosome fraction (0.25 copies) and the 100S ribosome fraction (0.83 copies), indicating that LpHPF was mainly present in the 100S ribosome fraction (Fig. 4C and Fig. S4 in Supporting Information). In transition phase (8 h), LpHPF was more evenly distributed between the 70S and 100S ribosome fractions (0.80 and 0.97 copies, respectively; Fig. 4B,C and Fig. S4 in Supporting Information) and was not detected in the 50S+30S subunit fraction (Fig. 4B and Fig. S4 in Supporting Information). These results indicate that LpHPF preferentially is present in 100S ribosomes during the exponential phase, whereas it binds both 70S and 100S ribosomes during transition phase (8 h). The data indicate that the molar ratio of LpHPF to 70S ribosome in the 100S ribosome is 1 : 1 (Fig. 4C) and that two LpHPF molecules are present in each 100S ribosome.
The position of LpHPF on RFHR 2‐D PAGE gels was the same at each time point examined. This indicates that the net charge and molecular weight of LpHPF did not change, which suggests that this protein is neither modified nor cleaved during any growth phase.
100S ribosome formation in vitro using purified LpHPF
To examine the role of LpHPF in 100S ribosome formation further, in vitro experiments were carried out in which purified LpHPF was mixed with 70S ribosomes prepared from cells at exponential phase (4 h), which contain a low copy number of LpHPF (0.25 copies) (Fig. 4C and Fig. S4 in Supporting Information). The mixture was incubated for 30 min at 37 °C and was then centrifuged and analyzed by SDG centrifugation. The percentage of 100S ribosomes increased from 19% to 36% after the addition of LpHPF (Fig. 5A). Thus, purified LpHPF converted free 70S ribosomes into 100S ribosomes in vitro. This suggests that LpHPF is a key factor for 100S ribosome formation in L. paracasei.

SaHPF is essential for the formation of 100S ribosomes in Staphylococcus aureus
Recently, long HPF (SaHPF) was shown to be a key protein for 100S ribosome formation in S. aureus (Ueta et al. 2010). However, the Sahpf gene product has not been shown to be essential for 100S ribosome formation. We studied the function of Sahpf using a deletion mutant (ΔSahpf), which could not generate 100S ribosomes (Fig. 5B). Ribosomes isolated from ΔSahpf cells were mixed with purified SaHPF protein in vitro and incubated for 30 min at 37 °C. The incubation mixture was centrifuged and analyzed by SDG centrifugation. 100S ribosomes formed after the addition of SaHPF, whereas no 100S ribosomes were detected in the absence of SaHPF (Fig. 5C). Furthermore, immunoblotting showed that SaHPF bound both 70S and 100S ribosomes (Fig. 5C). These results show that SaHPF is essential for the formation of 100S ribosomes in S. aureus.
TtHPF is essential for the formation of 100S ribosomes in Thermus thermophilus
Thermus thermophilus is remote from Lactobacillus and Staphylococcus in the phylogenetic tree (Battistuzzi & Hedges 2009), but it does contain a gene encoding a long HPF homologue. Thermus thermophilus HB8 was originally isolated from a thermal vent in a hot spring in Izu (Oshima & Imahori 1974) and is an extremely thermophilic, gram‐negative and obligate aerobic bacterium that can grow at temperatures of up to 85 °C. We examined 100S ribosome formation in T. thermophilus HB8; the strain was cultured at 75 °C, and the cells were harvested at exponential phase, transition phase and stationary phase (Fig. 6A). The profiles of ribosome particles in CR fractions prepared from each growth phase were analyzed by SDG centrifugation. 100S ribosomes were observed in all growth phases, similar to Lactobacillus and Staphylococcus (Fig. 6B,C, upper columns). The long HPF homologue was identified as accession number: gi|55772676, ribosomal subunit interface protein by proteome analysis of the CR fractions using RFHR 2‐D PAGE and MALDI‐TOF MS and named TtHPF (accession number; BR001021) (Fig. 6B lower column). The copy number of TtHPF was 0.97 (from two experiments) as determined by measuring the density of the stained TtHPF and L9 spots on RFHR 2‐D PAGE gels (Fig. 6B (2) lower column). The copy number of TtHPF was reduced to 0.57, and the level of 100S ribosomes decreased after high salt washing (Fig. 6B (3)). The function of TtHPF was studied using a deletion mutant (ΔTthpf: SP2011A), which could not generate 100S ribosomes (Fig. 6C upper right column). Ribosomes prepared from ΔTthpf cells were mixed with purified TtHPF protein and incubated for 30 min at 60 °C. The incubation mixture was centrifuged and analyzed by SDG centrifugation. 100S ribosomes were detected after the addition of TtHPF, whereas they were not detected in the absence of TtHPF (Fig. 6C lower column). In vitro 100S ribosome formation occurred most efficiently at 60 °C (Fig. 6D) and when the molar ratio of TtHPF to ribosomes was 1.5 : 1 (Fig. 6E). The level of 100S ribosomes formed decreased when more TtHPF protein was added (Fig. 6E).

Formation of 100S ribosomes in four Lactobacillus species and Synechocystis sp. PCC6803
In addition to L. paracasei and T. thermophilus, 100S ribosomes were detected in CR fractions from all growth phases (exponential, transition and stationary phase) in Lactobacillus casei, Lactobacillus acidophilus, Lactobacillus delbruekii and Lactobacillus plantarum (Fig. S5 in Supporting Information). According to phylogenic analysis, L. paracasei and L. casei (L. casei group), L. acidophilus and L. delbruekii (L. delbruekii group), and L. plantarum (L. plantarum group) belong to different branches (Makarova et al. 2006). In addition, 100S ribosomes were detected in Synechocystis sp. PCC6803, which has a long HPF that is similar to SaHPF, LpHPF and TtHPF (Fig. S5 in Supporting Information). The HPF proteins (short and long) in the examined bacterial species showed high sequence homology, particularly in the N‐terminal and C‐terminal domains (Fig. S6 in Supporting Information). Long HPF is also widely conserved among the various bacteria that belong to other groups aside from the Gammaproteobacteria and Betaproteobacteria classes. These results suggest that 100S ribosomes are present in almost all bacteria that have a wild‐type long HPF gene.
Long HPF (SaHPF or LpHPF) can mediate dimerization of E. coli 70S ribosomes
In stationary phase of E. coli, formation of 100S ribosomes is mediated by RMF and short HPF. We generated the quadruple deletion mutant YB1008 (W3110 ΔyfiA, Δhpf, Δrmf, ΔompT::Km). This deletion mutant does not express YfiA, HPF or RMF, which are involved in 100S ribosome formation in E. coli, and it cannot form 100S ribosomes in stationary phase (Fig. 7). When the CR fraction prepared from bacteria in transition phase is washed with high salt buffer to remove ribosome‐associated proteins and then treated with dissociation buffer, the 70S ribosomes dissociate into the 30S and 50S subunits. Purified SaHPF or LpHPF protein was mixed with the treated E. coli ribosomes and incubated for 30 min at 37 °C. The incubation mixture was centrifuged and analyzed by SDG centrifugation. Interestingly, 100S ribosomes formed after the addition of SaHPF or LpHPF, and both proteins were detected in the 70S and 100S ribosome fractions (Fig. 7). These results show that both SaHPF and LpHPF can mediate the dimerization of E. coli 70S ribosomes.

100S ribosomes formed by long HPF are more stable than those formed by RMF and short HPF
The stabilities of 100S ribosomes formed by RMF and short HPF or by long HPF were compared using SDG centrifugation. When 150 pmol [equivalent to 50 μL of a sample with an optical density (OD) at 260 nm of 100] of CR fraction prepared from E. coli in stationary phase was analyzed by SDG centrifugation, the concentration of 70S ribosomes in the 100S ribosome peak was approximately 3 × 10−8 m (OD at 260 nm of 1). The 100S ribosome peak was stable; however, when the amount of CR fraction was reduced to 30 and 15 pmol, the level of 100S ribosomes was reduced and the sedimentation coefficient was altered indicating a change from tight 100S ribosomes to unfolded 90S ribosomes. When 6 pmol of the CR fraction was applied, the 70S dimer dissociated into 70S monomers with shoulder [Fig. 8A (3); Kato et al. 2010]. The 100S ribosomes in S. typhimurium, Pe. carotovorum and particularly in K. pneumoniae were more unstable than those in E. coli (Fig. S7 in Supporting Information). In K. pneumoniae, 100S ribosomes were not detected when 30 pmol of the CR fraction was applied, whereas they were detected as a shoulder of the 70S ribosome peak when 150, 300 or 600 pmol was applied (Fig. 1A and Fig. S7 in Supporting Information). In contrast, 100S ribosome generated by long HPF (LpHPF, SaHPF and TtHPF) were completely stable even when 6 or 15 pmol of the CR fraction was applied [Fig. 8A (1), 8A (2) and Fig. S7 (1) in Supporting Information]. This suggests that 100S ribosomes formed by long HPF are much more stable than those generated by RMF and short HPF, with the dissociation constants (Kd) differing by at least one order of magnitude.

Interestingly, E. coli 100S ribosomes that formed after the addition of SaHPF or LpHPF (Fig. 7) did not dissociate when low amounts of the CR fraction were applied, similar to those formed by long HPF in vivo [Fig. 8A (4), 8A (5)]. These results suggest that RMF/short HPF and long HPF determine the stability of 100S ribosomes. It appears that long HPF mediates strong interactions between 70S ribosomes, whereas the interaction mediated by RMF/short HPF is weaker.
LpHPF binds tightly to 30S subunits
By high salt washing, CRs release ribosome‐associated proteins, translational factors, mRNA and tRNA to generate ‘high salt‐washed ribosomes’. When the CR fraction prepared from E. coli in stationary phase is washed with a high salt buffer, RMF is released and the 100S ribosome dissociates into two 70S ribosomes (Wada et al. 1990). In S. aureus, treatment of the CR fraction with a high salt buffer releases SaHPF and causes the 100S ribosome to dissociate (Ueta et al. 2010). However, LpHPF was not released from the 100S ribosome in L. paracasei after high salt washing, and the 100S ribosome did not dissociate (Fig. 8B). Treatment of high salt‐washed ribosomes with dissociation buffer led to the dissociation of 30S and 50S subunits; however, LpHPF remain associated with the 30S subunit (Fig. 8C). 100S ribosomes efficiently reformed when the 30S and 50S fractions were mixed together in association buffer, which suggests that LpHPF is highly efficient at mediating the formation of 100S ribosomes (Fig. 8D).
Effects of long HPF on in vitro translation
An in vitro translation experiment was carried out to examine the physiological role of long HPF in translation. GST protein made by translation of gst mRNA was quantified by immunoblotting. When a 10 : 1 molar ratio of LpHPF to ribosomes was added to the reaction mixture, translation was inhibited by approximately 65% (Fig. 9), indicating LpHPF inhibits translation in vitro.

Discussion
The 100S ribosome was first identified in E. coli as a fourth type of ribosomal particle in addition to the 30S and 50S subunits and 70S ribosomes (Wada et al. 1990; Wada 1998). RMF mediates the dimerization of 70S ribosomes in E. coli (Wada et al. 1990). Short HPF supports the function of RMF and stabilizes the 70S dimer, thereby allowing conversion from an unfolded 90S ribosome to a folded 100S ribosome (Ueta et al. 2005). Expression of short HPF and RMF is induced during stationary phase. 100S ribosomes are not detected in E. coli during exponential phase; they begin to form from early stationary phase and are most abundant during stationary phase (after 3–4 days of culture). The 100S ribosome is the most abundant ribosomal particle in E. coli in stationary phase. The 100S ribosome dissociates into two 70S ribosomes as cell viability falls (after 5–6 days of culture), and these ribosomes are finally degraded (Wada et al. 2000). 100S ribosomes were specifically generated in stationary phase in each of the five Gammaproteobacteria species tested (Fig. 1A and Fig. S1 in Supporting Information). The genes encoding RMF and short HPF are highly conserved in these species (Fig. S2A, S2B in Supporting Information), and the RMF and short HPF proteins were found in ribosomal particles in each of these strains (Fig. 1B). Bacteria belonging to other groups aside from the Gammaproteobacteria and Betaproteobacteria classes also form 100S ribosomes. Long HPF mediates the formation of 100S ribosomes in eight strains tested. Unexpectedly, 100S ribosomes formed by long HPF were observed throughout all growth phases including exponential phase (compare Fig. 1A with Figs 2B and 6B,C, and Fig. S5 in Supporting Information). The formation of 100S ribosomes specifically during stationary phase in Gammaproteobacteria may reflect changes in the expression levels of RMF and short HPF. Expression of RMF is induced during stationary phase due to an increase in the level of ppGpp, whereas ppGpp is not expressed during exponential phase meaning RMF expression is not induced (Izutsu et al. 2001). The mechanism controlling expression of long HPF is unknown; however, long HPF is continually expressed throughout all growth phases.
The ΔSahpf and ΔTthpf mutants constructed in this study could not generate 100S ribosomes (Figs 5B and 6C). Moreover, 70S ribosomes isolated from ΔSahpf or ΔTthpf cells dimerized to form 100S ribosomes in the presence of purified SaHPF or TtHPF in vitro, respectively (Figs 5C and 6C). These results show that the long HPF homologues SaHPF and TtHPF are essential for 100S ribosome formation in S. aureus and T. thermophilus, respectively. 100S ribosomes may form in all bacteria with a long HPF homologue; genes encoding long HPF are widely conserved in bacteria, except for Gammaproteobacteria and Betaproteobacteria, and the N‐terminal and C‐terminal domains of long HPF are highly homologous among species (Fig. S6 in Supporting Information).
However, only a low level of 100S ribosomes were formed when ribosomes isolated from ΔSahpf cells were mixed with purified SaHPF protein in vitro (Fig. 5). There may be unknown factors that stimulate formation of 100S ribosomes; however, we were unable to identify any such factors in CR fractions from S. aureus by RFHR 2‐D PAGE analysis. There may other unidentified reasons why the level of S. aureus 100S ribosome formation was low in vitro.
The stability of 100S ribosomes formed by RMF and short HPF differed from those formed by long HPF (Fig. 8 and Fig. S7 in Supporting Information). The behavior of 100S ribosomes in SDG centrifugation faithfully reflects the Kd of the association between two 70S ribosomes (i.e. the stability of the 100S ribosome). When SDG centrifugation analysis were carried out using 6–150 pmol of the CR fraction, changes in the relative abundances of ribosomal particles were observed reflecting the dissociation and unfolding of 70S–70S dimers, and these changes differed between the various Gammaproteobacteria species. A 100S ribosome peak was not detected when large amounts of the CR fractions (600 pmol) were applied for K. pneumoniae but detected when 150 pmol was applied for the other species, whereas 100S ribosomes dissociated into 70S monomers when 6 pmol of the CR fractions was applied. 100S ribosomes were stable in E. coli, in which the 100S ribosome peak at the end of the centrifugation step corresponded to a concentration of approximately 3 × 10−8 m. The 100S ribosomes formed by long HPF were also analyzed by SDG centrifugation; these 100S ribosomes were most stable even when only 6 pmol of the CR fraction was applied. Therefore, the Kd of 100S ribosomes formed by long HPF must be lower than that of 100S ribosomes formed by RMF/short HPF in E. coli by at least one order of magnitude. E. coli 100S ribosomes were formed in vitro using the long HPF SaHPF or LpHPF. These ribosomes were as stable as those formed by long HPF in vivo. Therefore, the stability of 100S ribosomes is determined by the factors that mediate their formation, and the binding between two 70S ribosomes may occur differently in 100S ribosomes generated by these two distinct mechanisms.
Escherichia coli HPF contains 95 amino acids and has been classified as a short HPF, whereas LpHPF, SaHPF and TtHPF are classified as long HPFs as they contain 185 amino acids. The E. coli HPF sequence was aligned with long HPF sequences from bacteria in which 100S ribosome formation has already been confirmed, that is, S. aureus, T. thermophilus, five Lactobacillaceae species and Synechocystis sp. PCC6803 (Fig. S6 in Supporting Information). The N‐terminal sequences (amino acid 1–95) of these proteins are very well conserved, as are five of the six amino acids involved in binding between YfiA and the ribosome (Lys22, Lys25, Lys79, Arg82 and Lys86) (Vila‐Sanjurjo et al. 2004). The C‐terminus‐specific regions of long HPF also show high homology. As E. coli short HPF cannot dimerize 70S ribosomes in vitro (Ueta et al. 2008), the C‐terminal sequence of long HPF might be involved in the dimerization of 70S ribosomes, a function that is carried out by RMF in E. coli.
Escherichia coli RMF inhibits in vitro translational activity in an MS2 mRNA‐dependent leucine incorporation assay, whereas E. coli short HPF inhibits poly(U)‐phenylalanine translational activity (Wada et al. 1995; Ueta et al. 2008). We examined the effect of long HPF on the translational activity of E. coli ribosomes using an in vitro translation assay. LpHPF protein was added to the in vitro translation system in which GST protein was synthesized from purified gst mRNA. When the molar ratio of LpHPF to ribosomes was 10 : 1, GST synthesis was reduced to 35% that of the control (Fig. 9A,B). The N‐terminal domain of LpHPF is similar to that of YfiA (Y protein) of E. coli, which competes with conserved translation initiation factors to fill the tRNA‐ and mRNA‐binding channel of the small ribosomal subunit (Vila‐Sanjurjo et al. 2004). It is possible that the N‐terminal domain of LpHPF prevents binding of tRNA and mRNA to 70S ribosomes and thereby inhibits translation.
Phylogenic analysis of HPF homologues shows that long HPF is an ancestor of the HPF homologue, which is widely conserved in bacteria and plant plastids (Ueta et al. 2008). A phylogenetic tree of prokaryotes (Battistuzzi & Hedges 2009) shows that the Alphaproteobacteria class and a common ancestor of the Gammaproteobacteria and Betaproteobacteria classes diverged first and then the Gammaproteobacteria and Betaproteobacteria classes diverged many years later. During this first divergence of the Alphaproteobacteria class, which has a long HPF, the common ancestor appears to have lost the C‐terminal region of long HPF and with it 100S ribosomes. The Gammaproteobacteria class diverged from the Betaproteobacteria class, acquired the rmf gene and acquired a different system to generate 100S ribosomes. Here, we used B. multivorans to confirm that the Betaproteobacteria class lacks 100S ribosomes (Fig. S3 in Supporting Information). Thus, it appears that Gammaproteobacteria have a distinct system in which formation of 100S ribosomes is mediated by RMF, HPF and YfiA, not by long HPF.
In summary, we propose there are two distinct mechanisms by which 100S ribosomes can form in bacteria. There are three major conclusions of this study: (i) Formation of 100S ribosomes is mediated by RMF and short HPF in the Gammaproteobacteria class, whereas it is mediated by long HPF in other types of bacteria. The Betaproteobacteria class has neither RMF nor long HPF and cannot form 100S ribosomes; (ii) 100S ribosomes formed by RMF and short HPF are generated specifically during stationary phase, whereas those formed by long HPF are generated in all growth phases; and (iii) The association between 70S ribosomes is much weaker in 100S ribosomes formed by RMF and short HPF than in those formed by long HPF.
Experimental procedures
Bacterial strains and plasmids
All strains used in this study are shown in Table S1 in Supporting Information, except E. coli K12 W3110 and E. coli K12 YB1008. The quadruple deletion strain YB1008 (W3110 ΔyfiA, Δhpf, Δrmf, ΔopmT::Km) was constructed by P1 transduction and elimination of the kanamycin resistance cassette using the double deletion mutant YB1003 [W3110 (ΔyfiA and ΔyhbH(hpf)::Km)] as recipient cells (Ueta et al. 2005). The Δrmf::Km and ΔopmT::Km deletion mutants (BW25113‐derived strains) used to prepare P1vir phage were obtained from the KO collection (Baba et al. 2006). In the first step, YB1005 [W3110 (ΔyfiA, Δhpf, Δrmf::Km)] was constructed by P1 transduction using the recipient strain W3110 (ΔyfiA and Δhpf), which was formed by elimination of the kanamycin resistance cassette from W3110 [ΔyfiA and ΔyhbH(hpf)::Km]. The cassette was removed using a helper plasmid (pCP20), which encodes a flippase recombinase (Datsenko & Wanner 2000) from YB1003. In the second step, W3110 (ΔyfiA, Δhpf, Δrmf) was constructed by eliminating the kanamycin resistance cassette from YB1005. The quadruple deletion mutant W3110 (ΔyfiA, Δhpf, Δrmf, ΔopmT::Km) was named YB1008. This mutant was constructed with the same procedure and using the recipient strain W3110 (ΔyfiA, Δhpf, Δrmf) and donor (BW25113 ΔopmT::Km) P1vir phage. PCR was used to confirm deletion of the rmf and ompT genes in this strain.
The expression vector pQE9 (QIAGEN, Hilden, Germany) was used to clone the Lphpf gene. The ORF of Lphpf was amplified using genomic DNA isolated from L. paracasei as a template and the following PCR primers: 5′‐GAGCGAATTCATTAAAGAGGAGAAATTAACTATGCTCACATACAATGTTCG‐3′ and 5′‐CCCAAGCTTTTATTGTTCACTAGTTTGAA‐3′. These primers were designed to remove the 6xHis‐tag from the pQE9 vector and to clone the Lphpf gene between the EcoRI and HindIII restriction sites of pQE9 to generate the pQE9‐(Δ6xHis)‐Lphpf plasmid. These restriction sites are underlined in the primer sequences. The two plasmids pQE9‐(Δ6xHis)‐Lphpf and pRep4 (QIAGEN) were transformed into the YB1008 strain to generate YB1009 [YB1008 (pRep4 and pQE9‐(Δ6xHis)‐Lphpf)]. An ompT deletion strain was used as the host strain for protein purification because protease VII (ompT) cleaves LpHPF.
Construction of the ΔSahpf mutant
Escherichia coli JM109 strain was used as the host for plasmid DNA preparations. Plasmid‐containing E. coli was grown at 37 °C in modified LB broth containing 0.5% NaCl and ampicillin (50 mg/mL). Plasmid DNA was prepared using a Sigma GenElute Plasmid Miniprep Kit (Sigma, St Louis, MO, USA) or a Qiagen Plasmid Purification Kit (Qiagen). The mutant YB2001 (S. aureus N315 ΔSahpf) was constructed in S. aureus N315 (Kuwahara‐Arai et al. 1996) using the shuttle vector pMAD‐tet (Tsai et al. 2011). This vector is a derivative of pMAD, which is designed for efficient allelic replacement in Gram‐positive bacteria (Arnaud et al. 2004). The target vector was used to replace the Sahpf gene of the host with tet from pMAD‐tet. The upstream and downstream regions of Sahpf were amplified with the following primer pairs:
- SahpfUP‐F (EcoR I): 5′‐CGCCAGATCTTTTAATGGAACAATTATATT‐3′;
- SahpfUP‐R (Bgl II): 5′‐CGGAATTCAGTAATCTCTCCTTAAACCT‐3′;
- SahpfDW‐F (Sal I): 5′‐GCATGTCGACATTAAGTTTAAAGCACTTGT‐3′; and
- SahpfDW‐R (BamH I): 5′‐GAGGATCCTTCATCAGTTAAAATTGCCG‐3′.
These fragments were ligated sequentially into the EcoRI‐BglII and BamHI‐SalI sites of pMAD‐tet to generate the pMAD‐UP gene region‐tet (ΔSahpf)‐DW gene region. The target vector was confirmed by PCR and sequencing and was introduced into S. aureus N315 by electroporation, and a Sahpf deletion mutant was isolated as described previously (Arnaud et al. 2004). Briefly, β‐galactosidase‐positive colonies carrying the target vector were plated onto tryptic soy broth agar containing 5 μg/mL tetracycline (Sigma) and 100 μg/mL 5‐bromo‐4‐chloro‐3‐indolyl‐β‐d‐galactoside (XG), followed by incubation at 42 °C overnight. Several of the resulting blue colonies were pooled and subjected to three cycles of growth in drug‐free tryptic soy broth at 30 °C for 12 h and at 42 °C for 12 h. Dilutions of these cultures were plated on drug‐free tryptic soy broth agar plates containing 100 μg/mL XG. White colonies were chosen, and the absence of the Sahpf gene was confirmed by PCR in the mutant.
Construction of the ΔTthpf mutant
The T. thermophilus HB8 mutant with the HPF deletion (ΔTthpf) was generated by substituting the target gene with the thermostable kanamycin resistance gene (HTK) through homologous recombination as described previously (Hashimoto et al. 2001). The plasmid for gene disruption (TDs07A03, RIKEN BioResource Center, Japan) is a derivative of the pGEM‐T Easy vector (Promega, Madison, WI, USA) and was constructed by inserting HTK flanked by 500 bp upstream and downstream sequences of the target gene. Thermus thermophilus HB8 was transformed as previously described (Hashimoto et al. 2001). Thermus thermophilus HB8 was grown at 70 °C in TR medium [0.4% (w/v) tryptone (Difco), 0.2% (w/v) yeast extract (Oriental Yeast, Tokyo) and 0.1% (w/v) NaCl (pH 7.5, adjusted with NaOH)]. To prepare plates, 1.5% (w/v) gellan gum (Wako, Osaka, Japan), 1.5 mm CaCl2 and 1.5 mm MgCl2 were added to the TR medium. An overnight culture was diluted 1 : 40 with TR medium and shaken at 70 °C for 2 h. This culture (0.4 mL) was mixed with 2 μg of the plasmid DNA, incubated at 70 °C for 2 h and then spread on plates containing 500 μg/mL of kanamycin, which were incubated at 70 °C for 15 h. A colony was selected, cultured in TR medium and spread onto plates containing 500 μg/mL of kanamycin to completely remove heteroplasmic recombinant cells, as T. thermophilus is a polyploid organism (Ohtani et al. 2010). Gene disruption was confirmed by PCR amplification, using isolated genomic DNA as the template.
Growth conditions for S. aureus, L. paracasei, T. thermophilus and Synechocystis sp. PCC6803
Lactobacillus paracasei was grown overnight in 5 mL modified MRS medium (Maassen et al. 1999) with 2% glucose at 37 °C and no agitation. Fresh medium (5 mL) was inoculated with 0.1 mL of the overnight culture and then grown overnight at 37 °C with no agitation. This culture (2.5 or 5 mL) was used to inoculate fresh modified MRS medium (250 mL), which was grown at 37 °C with slow shaking (80 cycles/min, TAITEC BR 40LF) or no agitation, and samples were taken at appropriate time points.
Staphylococcus aureus was grown overnight in 2.5 mL of EPY medium (Ueta et al. 2010) at 37 °C with shaking. This culture (2.5 mL) was used to inoculate 500 mL fresh EPY medium, which was grown at 37 °C with shaking (120 cycles/min, TAITEC BR 300LF), and samples were taken at appropriate time points. Cell growth was measured by estimating cell turbidity using a Klett‐Summerson photometric colorimeter (Bel‐Art Product, USA) with a green filter (#54). Turbidity was expressed in Klett units (an OD600 nm = 0.01 is approximately one Klett unit). Cells were harvested at appropriate time points in exponential and stationary phases and stored at −80 °C until use.
Thermus thermophilus was grown in 0.8% Bacto Tryptone, 0.4% Bacto Yeast Extract and 0.2% NaCl (pH 7.0) at 70 °C or 75 °C. Cell density was measured by absorbance at 600 nm.
Synechocystis sp. PCC6803 was grown at 30 °C in liquid BG‐11 medium (Ito et al. 2008) under continuous illumination with normal light (50 μmol photons/m2/s, white fluorescence lamp). Cell density was measured by absorbance at 750 nm with a UV‐1700 spectrometer (Shimadzu).
Preparation of CR fractions and ribosomal particles
CR fractions and ribosomal particles were prepared from cell extracts according to the method described by Noll et al. (1973), with slight modifications as described by Horie et al. (1981). Harvested cells were ground with approximately equal volumes of quartz sand (Wako), mixed with soybean trypsin inhibitor (Wako) (0.42 mg/g cells) and then extracted with buffer I [20 mm Tris–HCl (pH 7.5), 15 mm magnesium acetate, 100 mm ammonium acetate and 6 mm 2‐mercaptoethanol] containing 1 mm phenylmethylsulfonyl fluoride (PMSF). The homogenate was centrifuged at 9000 g for 15 min at 4 °C. The supernatant was collected, and the pellet was resuspended in buffer I containing 1 mm PMSF. The suspension was centrifuged as before. The combined supernatants (cell extracts) were layered onto a 30% sucrose cushion in buffer I and centrifuged in a 55.2Ti rotor (Beckman, Fullerton, CA, USA) at 206 000 g for 3 h at 4 °C. The pellet was resuspended in buffer I, and this suspension was used as the CR fraction.
To obtain the 30S+50S subunit, 70S ribosome and 100S ribosome fractions for RFHR 2‐D PAGE analysis, the CR fractions were layered onto a 10–40% SDG in buffer I and centrifuged in a 45Ti rotor (Beckman) at 125 000 g for 80 min at 4 °C (Maki et al. 2000). The gradient was fractionated, and the absorbance of each fraction at 260 nm was measured with a UV‐1700 spectrometer (Shimadzu, Kyoto, Japan). The 30S+50S subunit, 70S ribosome and 100S ribosome fractions were collected separately and pelleted by centrifugation in a 90Ti rotor (Beckman) at 155 000 g for 4 h at 4 °C. Each pellet was resuspended in buffer I.
High salt washes of CR fractions and fractionation of the 30S and 50S subunits
High salt washes of CR fractions were carried out by resuspending the CR fraction in buffer II [20 mm Tris–HCl (pH 7.6), 10 mm magnesium acetate, 1 m ammonium acetate and 6 mm 2‐mercaptoethanol]. After mixing for 1 h at 4 °C, the high salt‐washed suspension (20 mL) was layered onto a 30% sucrose cushion in buffer II (10 mL) and centrifuged in a 55.2Ti rotor (Beckman) at 206 000 g for 4 h at 4 °C. The pellet was resuspended in buffer I and dialyzed against buffer I.
To obtain the ribosomal subunits, the high salt‐washed ribosomal pellet was suspended in dissociation buffer I [20 mm Tris–HCl (pH 7.6), 1 mm magnesium acetate, 100 mm ammonium acetate and 6 mm 2‐mercaptoethanol] and dialyzed against this buffer overnight. The sample was layered onto a 10–40% SDG in dissociation buffer I and centrifuged in a 45Ti rotor (Beckman) at 28 000 g for 14 h at 4 °C. Fractionation was carried out as described in the previous section; each subunit was pelleted by centrifugation in a 90Ti rotor (Beckman) at 155 000 g for 4 h at 4 °C, and the pellets were resuspended in buffer I.
Analysis of ribosomes by SDG centrifugation
Each ribosome sample was layered onto a 5–20% SDG in buffer I and centrifuged in an SW 40Ti rotor (Beckman) at 25 000 g for 20 h at 4 °C. The SDG was made using a gradient maker (GRADIENT MATE 6T; Biocomp Instruments, Fredericton, Canada). The absorbance of each fraction was measured at 260 nm using a flow cell within a UV‐1700 spectrometer (Shimadzu).
RFHR 2‐D PAGE
Lactobacillus paracasei r‐proteins were prepared using the acetic acid method previously described (Hardy et al. 1969). A 0.1 volume of 1 m MgCl2 and two volumes of acetic acid were added to the ribosomal preparation, and the mixture was stirred for 1 h at 0 °C. After centrifugation at 10 000 g for 10 min, the supernatant was dialyzed three times against 2% acetic acid (volume of dialysis buffer was 300‐fold higher than the volume of the sample) for 24 h. The proteins were lyophilized and stored at −80 °C until use. The protein solution (0.5–1 mg protein in 100 μL of 10 m urea containing 0.2 m 2‐mercaptoethanol) was analyzed by RFHR 2‐D PAGE as described previously (Wada 1986a,b) with some slight modifications (Ueta et al. 2010). Sample charging electrophoresis was carried out at 100 constant volts (CV) for 15 min at room temperature (RT). Then, one‐dimensional electrophoresis was carried out at 170 CV for 8 h at RT, and two‐dimensional electrophoresis was carried out at 100 CV for 15 h at RT. Sample charging electrophoresis of the acidic region was carried out at 100 CV for 12 min. Then, one‐dimensional electrophoresis was carried out at 170 CV for 30 h at RT, and two‐dimensional electrophoresis was carried out at 100 CV for 30 h at RT. Gels were stained with CBB G‐250, and protein spots were scanned using a GS‐800 calibrated densitometer (Bio‐Rad Laboratories Inc.).
Determination of the copy numbers of ribosome‐binding proteins
‘Copy number’ refers to the molar ratio of a ribosome‐binding protein to a single 70S ribosome, 50S subunit or 30S subunit. The OD of a protein spot on a RFHR 2‐D PAGE gel was determined by scanning the stained spot with a GS‐800 calibrated densitometer. The molar amount of a protein is proportional to its OD value (OD/MW). The OD/MW was calculated as a function of the molecular weight, and LpHPF values were normalized against the value for the r‐proteins S2 and L10. S2 and L10 were used as markers to estimate LpHPF copy numbers because they are proteins whose copy numbers are known (Hardy 1975; Tal et al. 1990) and have similar isoelectric points to LpHPF. The copy numbers of spots 4–10 were calculated in the same way, and the copy numbers of spots 2 and 3 were calculated relative to those of S10 and L24, or L27, L30 and L32, respectively.
Mass spectrometry
Proteins in spots on RFHR 2‐D PAGE gels were digested using sequence‐grade modified trypsin (Promega, Madison, USA) or lysyl endopeptidase Lys‐C (Wako Purified Reagent) as described by Tanaka et al. (2008). Each protein was identified by peptide mass fingerprinting (PMF) analysis using MALDI‐TOF MS and tandem mass spectrometry with the Ultraflex mass spectrometry system (Bruker Daltonik GmbH, Bremen, Germany). The PMF results were used to search the NCBI database with the Mascot Search engine. The PMF results and at least one of the tandem mass spectrometry results were combined to ensure that the results of the search were reliable. The genome sequences of L. paracasei subsp. paracasei ATCC 25302, L. paracasei subsp. paracasei 8700:2 and L. casei ATCC 334 were used to identify proteins in ribosome fractions.
Purification of LpHPF and SaHPF
YB1009 (YB1008 [pRep4 and pQE9‐ (Δ6xHis)‐Lphpf]) cultures were grown to 50 Klett units in 1.7 L EP medium at 37 °C. Expression of transgenes was induced by the addition of 0.1 mm isopropylthiol‐β‐D‐galactoside (IPTG). After incubation for 2.5 h at 37 °C, cells were harvested and stored at −80 °C. The cell pellets were thawed, ground with an approximately equal volume of quartz sand (Wako) and then extracted with 40 mL buffer I. The cell debris was removed by centrifugation at 9000 g for 15 min at 4 °C. The supernatant was centrifuged in a 55.2Ti rotor (Beckman) for 2 h at 206 000 g at 4 °C to remove the ribosomes, and the resulting supernatant was loaded onto a DE52 column (diethylaminoethyl cellulose; Whatman, Kent, UK) equilibrated with buffer I. LpHPF protein did not bind the column and was detected in the flow‐through fraction. This fraction was dialyzed against 20 mm CH3COOK (pH 6.0) and then loaded onto a CM52 column (carboxymethylcellulose; Whatman) equilibrated with 20 mm CH3COOK (pH 6.0). LpHPF was eluted with 200 mm LiCl in 20 mm CH3COOK (pH 6.0), and the fractions were collected and dialyzed against buffer I. Samples were concentrated using an Amicon 3K Filter (Millipore, Billerica, MA, USA). LpHPF protein was more than 90% pure, as judged by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‐PAGE). SaHPF protein was purified as described previously (Ueta et al. 2010), except YB1008 was used as the host strain.
Cloning, expression and purification of TtHPF
The gene encoding T. thermophilus HPF (TTHA1294, gi:55981263) was cloned into the pET‐11a expression vector (Merck Novagen) and expressed in the E. coli BL21(DE3) strain (Merck Novagen). Bacteria were cultured in 2 L LB medium containing 50 μg/mL ampicillin. The harvested cells (12.4 g) were lysed by sonication on ice in 16 mL of 20 mm Tris–HCl buffer (pH 8.0) containing 50 mm NaCl. After centrifugation, the supernatants were heated at 70 °C for 10 min and purified by a series of HiTrap‐Butyl and HiTrap‐Heparin (GE Healthcare) column chromatography steps, followed by dialysis against 20 mm Tris buffer (pH 8.0) containing 150 mm NaCl. The sample was then applied to a HiLoad 16/60 Superdex 75 pg column (GE Healthcare Biosciences) equilibrated with 20 mm Tris–HCl buffer (pH 8.0) containing 150 mm NaCl. The protein sample was analyzed by SDS‐PAGE and was more than 90% pure. After concentration to 1.25 mg/mL by ultrafiltration, the protein yield was 20.0 mg from 12.4 g of cells.
Analysis of 100S ribosome formation in vitro
Lactobacillus paracasei 70S ribosomes prepared from cells in exponential phase (after 4 h of culture) were dialyzed against dissociation buffer II [20 mm Tris–HCl (pH 7.6), 1 mm magnesium acetate, 30 mm ammonium acetate and 6 mm 2‐mercaptoethanol] to dissociate each subunit. The buffer was then changed to buffer I by the addition of magnesium acetate and ammonium acetate. This 70S ribosome fraction was mixed with purified LpHPF (molar ratio of LpHPF to ribosomes was 1.5 : 1) and incubated at 37 °C for 30 min. The mixture was layered onto a 30% sucrose cushion containing buffer I and centrifuged in a 90Ti rotor (Beckman) at 155 000 g for 4 h at 4 °C. Each pellet was resuspended in buffer I, and the suspensions were analyzed using 5–20% SDG centrifugation. The dissociated high salt‐washed ribosomes were prepared in the same way from YB2001 (S. aureus N315 ΔSahpf) and SP2011A (T. thermophilus HB8 ΔTthpf) cells. In vitro binding using these ribosomes and purified SaHPF or TtHPF were carried out and analyzed by 5–20% SDG centrifugation.
Formation of 100S ribosomes from E. coli 70S ribosomes by long HPF
Escherichia coli CR fractions were prepared from YB1008 cells in transition phase. The CR fraction was washed with high salt buffer, dialyzed against dissociation buffer II and separated into two aliquots. One aliquot was mixed with purified SaHPF or LpHPF (molar ratio of SaHPF or LpHPF to ribosomes was 1.5 : 1), and the other aliquot was mixed with buffer I, and samples were incubated at 37 °C for 30 min. The mixture was layered onto a 30% sucrose cushion prepared in buffer I and centrifuged in a 90Ti rotor (Beckman) at 155 000 g for 4 h at 4 °C. Each pellet was resuspended in buffer I and analyzed by 5–20% SDG centrifugation. This separated each sample into 18 SDG fractions, which were precipitated with 10% TCA, separated on 12% SDS‐PAGE gels and analyzed by immunoblotting with an anti‐SaHPF antibody, which reacted with SaHPF and LpHPF.
In vitro translation
A derivative of plasmid pET49b (+) (Novagen), which contains the T7 RNA polymerase promoter and a gst‐tag, was used to produce gst mRNA for in vitro translation. The terminator sequence of the tryptophan operon, which inhibits read‐through transcription of gst, was amplified using E. coli W3110 genomic DNA as a template and the following PCR primers: 5′‐GGACTAGTTAATCCCACAGCCGCCAGTT‐3′ and 5′‐CCCAAGCTTAAAATGCCGCCAGCGGAACT‐3′. The underlined sequences indicate the SpeI and HindIII restriction sites. The amplified fragments were digested with the restriction enzymes SpeI and HindIII and cloned into pET49b (+) to generate the pET49b (+)‐gst‐trp terminator plasmid. This plasmid was transformed into BL21 (λDE3) pLysS CmR to generate BL21 (λDE3) pLysS CmR (pET49b (+)‐gst‐trp terminator). The gst mRNA template for in vitro translation was prepared by transcribing the plasmid (pET49b (+)‐gst‐trp terminator) DNA with the ScriptMAX™ Thermo T7 Transcription Kit (TOYOBO). The transcript (672 nt), which contains the gst ORF (660 nt) and additional sequences (12 nt), was purified using the RNeasy Mini Kit (Qiagen).
S30 fractions were prepared from YB1008 cells as described by Chadani et al. (2010). gst mRNA was translated for 30 min at 37 °C in a 50 μL reaction mixture, containing 0.3 volumes of S30, 4 μg gst mRNA, 15 μg tRNA (Sigma), 50 μm amino acids, 30 mm ammonium acetate, 43 mm Tris–HCl [pH 7.6], 175 mm potassium glutamate, 7.5 mm magnesium acetate, 1 mm ATP, 0.2 mm GTP, 5 mm phosphoenolpyruvate, 1.5 μg phosphoenolpyruvate kinase, 6 mm 2‐mercaptoethanol and 10 U ribonuclease inhibitor (Wako). Translation was stopped by adding an equal volume of SDS sample buffer [125 mm Tris–HCl (pH 6.8), 10% 2‐mercaptoethanol, 4% SDS, 0.005% bromophenol blue and 20% glycerol]. The samples were incubated at 95 °C for 20 min and analyzed by Western blotting using an anti‐GST antibody.
Immunoblotting
Protein samples were separated on 12% SDS‐PAGE gels and transferred to PVDF membranes (Immobilon‐P transfer membrane; Millipore). GST proteins were detected with an anti‐GST antibody (Wako). Goat anti‐mouse IgG (H&L)‐AP conjugate (KPL, Gaithersburg, USA) was used as a secondary antibody, which was detected using the ECF substrate (GE Healthcare, Buckingham, UK) with a FLA 2000 imager (Fujifilm, Tokyo, Japan).
SaHPF and LpHPF proteins were detected using purified polyclonal rabbit antisera against SaHPF. Anti‐rabbit IgG alkaline phosphatase conjugate (Promega) was used as a secondary antibody.
Acknowledgements
This work was supported in part by Grants‐in‐Aid for Scientific Research from the Japan Society for the Promotion of Science, by the X‐ray Free Electron Laser Priority Strategy Program (to Y.B.), by a Grant‐in‐Aid for Scientific Research (23651126 to Y.B. and 22510210 to A.W.) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (MEXT). We thank Tetsuo Hashimoto for helpful discussions, Tatsuhiko Abo and Yuhei Chadani for technical support with the in vitro translation system, Ayumi Tanaka and Hisashi Ito for providing the Synechocystis sp. PCC6803 strain and technical support with its culture, Shige H. Yoshimura for providing purified GST, and Akiko Sakai for support with the MALDI‐TOF MS analysis. We thank Aimi Osaki, Kayoko Matsumoto and Akemi Shibuya for technical assistance with the preparation of T. thermophilus materials.




