Regulation of LRG1 expression by RNA‐binding protein Puf5 in the budding yeast cell wall integrity pathway

Abstract

The PUF RNA‐binding protein Puf5 is involved in regulation of the cell wall integrity (CWI) pathway in yeast. Puf5 negatively regulates expression of LRG1 mRNA, encoding for a GTPase‐activating protein for Rho1 small GTPase. Here, we further analyzed the effect of Puf5 on LRG1 expression, together with Ccr4 and Pop2 deadenylases, Dhh1 decapping activator, and other PUF proteins. We found that the growth defect of puf5∆ mutant was enhanced by ccr4∆ mutation, which was partially suppressed by LRG1 deletion. Consistently, Lrg1 protein level was much more up‐regulated in ccr4Δ puf5Δ double mutant than in each single mutant. Interestingly, LRG1 poly(A) tail length was longer in ccr4∆ mutant but not in puf5∆ mutant. Thus, Puf5 regulates LRG1 expression independently from Ccr4, although Puf5 recruits the Ccr4‐Not deadenylase complex for mRNA destabilization. Unexpectedly, puf6Δ mutation suppressed the growth defect caused by ccr4Δ puf5∆ mutation. Loss of Rpl43a and Rpl43b ribosomal proteins, the previously identified Puf6 interactors, also suppressed the growth defect of ccr4Δ puf5Δ mutant. Our results suggest that Puf5 functions in the CWI pathway by regulating LRG1 expression in a deadenylase‐independent manner, and that Puf6 is involved in the Ccr4‐ and Puf5‐mediated regulation of cell growth through association with Rpl43.

1 INTRODUCTION

Gene expression is controlled at many steps including the regulation of mRNA degradation and translation. These post‐transcriptional regulations play crucial roles for yeast cells to respond to environmental stimulations. mRNA can be degraded by two general mechanisms: one is 5'–3' degradation mediated by Xrn1 exonuclease; the other is 3'–5' degradation mediated by RNA exosome complex. Both are initiated by a common first process of poly(A) tail shortening referred to as deadenylation, which is catalyzed by the Ccr4/Pop2/Not complex and the Pan2/Pan3 complex (Parker, 2012). In 5'–3' mRNA degradation, mRNAs are decapped by the decapping enzyme complex composed of Dcp1 and Dcp2, and then degraded by Xrn1 exonuclease (Parker, 2012). The activity of the decapping enzyme is stimulated by decapping activators such as Dhh1, Scd6, Edc3 and Pat1 (Nissan et al., 2010).

The Ccr4‐Not complex is an essential multi‐subunit complex that is conserved from yeast to human and plays an important role in regulation of mRNA decay (Collart, 2016; Collart & Panasenko, 2012). In Saccharomyces cerevisiae, the Ccr4‐Not complex is comprised of nine core subunits: Ccr4, Pop2/Caf1, five Not proteins (Not1–5), Caf40, and Caf130 (Collart, 2003). Ccr4 and Pop2 are active 3’–5’ exonucleases of this complex. Ccr4 is the major deadenylase, whereas Pop2 may modulate specific mRNA expression in certain conditions (Parker, 2012). The loss of CCR4 resulted in abnormal morphology, temperature sensitivity, and defects in checkpoint control and cell cycle progression (Ito et al., 2011; Manukyan et al., 2008; Traven et al., 2009).

The family of mRNA‐binding proteins that binds to 3' untranslated region (3'‐UTR) of mRNAs plays an important role in the post‐transcriptional regulations such as deadenylation, decapping, and translation. One of the most evolutionarily conserved mRNA regulators is the PUF (Pumilio and FBF) family of RNA‐binding proteins (Wickens et al., 2002), which has the key functions in cell division, differentiation, and development (Quenault et al., 2011). Saccharomyces cerevisiae contains six PUF proteins, Puf1, Puf2, Puf3, Puf4, Puf5, and Puf6 (Wickens et al., 2002). Recent studies showed that Puf5 is a broad mRNA regulator that interacts with more than 1,000 mRNAs and is involved in multiple cellular processes such as lifespan, chromatin structure, cell wall integrity (CWI), and mating type switching (Kennedy et al., 1997; Stewart et al., 2007; Tadauchi et al., 2001; Wilinski et al., 2015). Deletion of PUF5 leads to the weakened cell wall, temperature sensitivity, and short life span (Kaeberlein & Guarente, 2002; Stewart et al., 2007). Furthermore, it has been shown that Puf5 promotes deadenylation and translational repression of target mRNAs by recruiting the Ccr4‐Not complex (Goldstrohm et al., 2006; Hook et al., 2007; Quenault et al., 2011). The interaction between PUF proteins and the Ccr4‐Not complex is a universal mode for mRNA repression in yeast cells as well as in higher organisms (Quenault et al., 2011; Wang et al., 2018).

The yeast cell controls the cell shape as well as cell integrity through the CWI signaling pathway which is essential for detecting and responding to cell wall stress (Levin, 2005). Rho1, a small GTPase, acts as a master regulator in the CWI pathway because it integrates signals from upstream stress sensors and produces outputs to downstream effectors (Levin, 2011). Rho1 activity is negatively regulated by a GTPase‐activating protein Lrg1 (Levin, 2005). Our previous studies suggest that LRG1 expression is down‐regulated by Ccr4 and Pop2 (Ito et al., 2011; Li et al., 2016). We also found that the deletion of LRG1 could suppress the high temperature‐sensitive growth caused by loss of Ccr4 and Pop2 (Ito et al., 2011; Li et al., 2016). A previous study showed that deletion of LRG1 suppresses the high temperature sensitivity and CWI signaling defects caused by puf5Δ mutation (Stewart et al., 2007). Thus, it is possible that Puf5 recruits the Ccr4‐Not complex to LRG1 mRNA and consequently negatively regulates LRG1 mRNA. However, our data presented here suggested that Puf5 has a deadenylation‐independent role in LRG1 mRNA repression. We additionally showed that another Puf protein, Puf6, is involved in the Ccr4‐ and Puf5‐mediated regulation of CWI pathway by interacting with Rpl43a and Rpl43b, two homologous ribosomal proteins.

2 RESULTS

2.1 Puf5 acts as a positive regulator of the CWI pathway

It has been reported that Puf5 negatively regulates LRG1 mRNA, and that deletion of LRG1 suppresses the high temperature‐sensitive growth observed in the puf5∆ mutant (Stewart et al., 2007). To confirm the involvement of Puf5 in regulation of the CWI pathway, we deleted PUF5 together with ROM2 encoding a guanine nucleotide exchange factor (GEF) for Rho1 small GTPase that acts antagonistically to Lrg1 (Levin, 2011). Tetrad analysis showed that the puf5∆ mutant has no obvious phenotype at room temperature, whereas the rom2∆ mutant grew slowly and the puf5∆ rom2∆ double mutant showed a severe growth defect (Figure 1a). The lethality of the puf5∆ rom2∆ double mutant was not because of defective spore germination, as tiny colonies were formed from the spores that were deduced to be the puf5∆ rom2∆ double mutant (data not shown). These results suggest that the CWI pathway is strongly inhibited when the loss of Rom2 is combined with increased Lrg1 expression caused by PUF5 deletion. We next examined whether Lrg1 is really involved in the growth defect associated with the puf5∆ rom2∆ double mutant. We disrupted the LRG1 gene in the puf5∆ rom2∆ background and found that the puf5∆ rom2∆ lrg1∆ triple mutant grew better than the rom2∆ mutant (Figure 1b). The elevated levels of Lrg1 protein probably caused decreased CWI signaling because of the inactivation of Rho1; deletion of LRG1 that led to increased active Rho1‐GTP could compensate for the decreased CWI signaling in the mutant strains. These results confirm the functional significance of Puf5 in regulation the CWI pathway.

Figure 1

Loss of LRG1 suppresses the synthetic growth defect of the puf5Δ rom2Δ mutant strain. The strains that were heterozygous for favorite alleles were sporulated, and tetrads were dissected onto YPD sorbitol plate. The growth of segregants after 4 days at 25°C is shown. Genotypes are indicated on the both sides. More than 50 tetrads were dissected, and representative data are shown. (a) Tetrad analysis of strain 10BD‐r2p5 that was heterozygous for puf5Δ and rom2Δ alleles. (b) Tetrad analysis of strain 10BD‐r2p5lU that was heterozygous for puf5Δ, rom2Δ, and lrg1Δ alleles

2.2 Puf5 operates in a manner independent of Ccr4, Pop2, and Dhh1

Puf5 binds to Pop2 and recruits the complex containing Ccr4 and Dhh1, which causes poly(A) tail shortening and decapping of their target mRNAs (Goldstrohm et al., 2006). In addition, we have previously reported that LRG1 mRNA is negatively regulated by Ccr4, Pop2, and Dhh1 (Li et al., 2016). To investigate whether Puf5 regulates LRG1 expression in a manner cooperative with these factors, we examined the genetic interactions between puf5Δ mutation and either ccr4Δ, pop2Δ, or dhh1Δ mutation. Tetrad analysis using diploid strains that were heterozygous for puf5Δ and ccr4Δ, pop2∆, or dhh1∆ showed that the puf5∆ mutant cells grew similarly to wild‐type cells, whereas the ccr4Δ, pop2Δ, and dhh1Δ mutant cells did slower than wild‐type cells (Figure 2a–c). Remarkably, the ccr4Δ puf5Δ, pop2Δ puf5Δ, and dhh1Δ puf5Δ double mutant cells grew much more slowly than these single mutant cells (Figure 2a–c). These results suggest that Puf5 can operate even in the absence of Ccr4, Pop2, and Dhh1.

Figure 2

Loss of LRG1 suppresses the growth defect of the ccr4Δ puf5Δ, pop2Δ puf5Δ, and dhh1Δ puf5Δ mutants. The strains that were heterozygous for favorite alleles were sporulated, and tetrads were dissected onto YPD sorbitol plate. The growth of segregants after 4 days at 25°C is shown. Genotypes are indicated on the both sides. More than 50 tetrads were dissected, and representative data are shown. (a) Tetrad analysis of strain 10BD‐cp5lU that was heterozygous for ccr4Δ, puf5Δ, and lrg1Δ alleles. (b) Tetrad analysis of strain 10BD‐pp5lU that was heterozygous for pop2Δ, puf5Δ, and lrg1Δ alleles. (c) Tetrad analysis of strain 10BD‐dp5lU that was heterozygous for dhh1Δ, puf5Δ, and lrg1Δ alleles

We next examined the effect of LRG1 deletion on the growth defect observed in the ccr4Δ puf5Δ, pop2Δ puf5Δ, and dhh1Δ puf5Δ double mutants. The lrg1Δ mutation partially suppressed their growth defect (Figure 2a–c), suggesting that the defective growth caused by ccr4Δ puf5Δ, pop2Δ puf5Δ, and dhh1Δ puf5Δ mutations is attributed, at least in part, to increased LRG1 expression (Figure 2a–c). Yet, it is also suggested that targets other than LRG1 mRNA are involved in the growth defect of these double mutants.

2.3 Puf5 regulates LRG1 mRNA independently of deadenylation

We have previously reported that both Ccr4 and Puf5 are required for translational repression of the LRG1 mRNA in stationary phase (Duy et al., 2017). The observation that puf5Δ mutation enhanced the growth defect caused by ccr4Δ mutation raised the possibility that Puf5 negatively regulates LRG1 expression even in the absence of Ccr4. Thus, we examined Lrg1 protein levels in the ccr4Δ puf5Δ double mutant cells using the 3xFLAG‐tagged LRG1 construct. We found that Lrg1 protein level in the stationary phase is much more strongly up‐regulated in ccr4Δ puf5Δ mutant than that in ccr4Δ or puf5Δ single mutant (Figure 3a). This result further suggests that Puf5 negatively regulates LRG1 expression in a manner independent of Ccr4.

Figure 3

Effect of puf5∆ mutation on Lrg1 protein levels and LRG1 poly(A) tail length. (a) The 3xFLAG‐Lrg1 protein levels in the wild‐type, ccr4Δ, puf5Δ, and ccr4Δ puf5Δ mutant strains in the log phase and stationary phase. Wild‐type, ccr4Δ, puf5Δ, and ccr4Δ puf5Δ cells harboring pRS316–3xFLAG‐LRG1 plasmid were grown at 28°C from the log phase (4 hr) to the stationary phase (72 hr) in SC‐Ura medium. The cells were collected at indicated times and total proteins were prepared. Western blot analysis as described in Materials and Methods was carried out to visualize 3xFLAG‐Lrg1 protein (upper panel), and Pgk1 protein (lower panel) as a loading control. The 3xFLAG‐Lrg1 protein levels are indicated as percentage of wild‐type levels and represent the mean of three independent experiments with standard deviation. (b) The LRG1 poly(A) tail lengths in the wild‐type, ccr4Δ, puf5Δ, and ccr4Δ puf5Δ mutant strains. The strains were harboring pRS316–3xFLAG‐LRG1 plasmid were grown at 28°C in SC‐Ura media. Cells were collected for total RNA extraction in order to perform poly(A) tail length assay using specific primer for LRG1 mRNA. The average length of poly(A) tail was determined by sequencing

Previous studies suggested that Puf5 recruits the Ccr4‐Not deadenylase complex to its target mRNAs for deadenylation. Thus, we investigated whether Puf5 is required for deadenylation of LRG1 mRNA. As shown in our previous study (Duy et al., 2017), LRG1 poly(A) tail in the ccr4∆ mutant was longer than that in wild‐type cells (Figure 3b). However, unexpectedly, the LRG1 poly(A) tail lengths in the puf5∆ mutant were comparable with those in wild‐type cells (Figure 3b). The LRG1 poly(A) tail lengths in the ccr4∆ puf5Δ mutant were similar to those in the ccr4∆ mutant. Thus, Puf5 is not involved in LRG1 poly(A) tail shortening.

We previously showed that LRG1 poly(A) tail length, and LRG1 mRNA and protein levels in the ccr4Δ mutant were decreased by the deletion of PBP1, which encodes poly(A)‐binding protein (Pab1)‐binding protein 1 (Duy et al., 2017). Shortening of LRG1 poly(A) tail length by pbp1∆ mutation is dependent on another deadenylase, Pan2. A previous report also showed that pbp1Δ suppresses the temperature‐sensitive phenotype associated with ccr4Δ mutant (Kimura et al., 2013). Thus, we examined whether pbp1Δ affects the growth defect of puf5Δ at high temperature. Consistent with our previous report, pbp1Δ mutation clearly suppressed the growth defect of ccr4Δ mutant at both low and high temperatures (Figure 4). In contrast, the pbp1Δ mutation only slightly suppressed the growth defect of puf5Δ mutant at high temperature (Figure 4). Thus, pbp1Δ mutation has less effect on the growth of puf5Δ mutant than that of ccr4Δ mutant. These data further support the view that Puf5 operates in a manner independent of Ccr4‐mediated deadenylation.

Figure 4

Effect of pbp1Δ mutation on the growth of ccr4Δ and puf5Δ mutant cells. Loss of PBP1 clearly suppressed growth defect of ccr4Δ mutant at low and high temperatures, but loss of PBP1 weakly suppressed growth defect of puf5Δ mutant at high temperature. Wild‐type, puf5Δ, ccr4Δ, puf5Δ pbp1Δ, ccr4Δ pbp1Δ, and pbp1Δ cells were spotted onto YPD medium plates and grown at either 25°C or 37.5°C for 3 days

2.4 Puf6 and Rpl43 ribosomal proteins are involved in the Ccr4‐mediated regulation of gene expression

Saccharomyces cerevisiae contains other PUF proteins, Puf1, Puf2, Puf3, Puf4, and Puf6 (Wickens et al., 2002). Then, we examined whether other PUF genes (PUF1, PUF2, PUF3, PUF4, and PUF6) are involved in regulation of the CWI pathway. We investigated whether the deletion of PUF genes has an impact on the growth of the rom2Δ mutant by tetrad analysis. The deletions of PUF1, PUF2, PUF3, PUF4, and PUF6 showed no effect on the growth of rom2Δ mutant cells (data not shown). Thus, these PUF proteins are unlikely to be involved in the regulation of LRG1 expression.

We next examined whether deletions of PUF genes affect the growth of the ccr4Δ mutant cells. Each deletion of PUF1, PUF2, PUF3, and PUF4 genes had no effect on the growth of the ccr4Δ mutant cells (data not shown). On the other hand, the growth defect of ccr4Δ was slightly suppressed by puf6Δ (Figure 5a). Deletion of PUF6 could also suppress the growth defect of ccr4Δ puf5Δ double mutant (Figure 5b). These results suggest the possibility that Puf6 is involved in regulation of gene expression mediated by Ccr4. We next addressed whether puf6∆ mutation suppresses the growth defect of ccr4∆ and ccr4∆ puf5∆ mutants through regulation of Lrg1 expression. We examined Lrg1 protein level in the puf6∆ mutant; however, no significant effect of puf6∆ on Lrg1 protein levels was observed (Figure 6a,b). These results are consistent with the observation that the growth of rom2Δ mutant cells was unaffected by puf6∆ mutation. Thus, puf6∆ mutation suppresses the growth defect of ccr4∆ and ccr4∆ puf5∆ mutants without altering Lrg1 expression.

Figure 5

Deletion of PUF6 suppressed the growth defect of ccr4Δ and ccr4Δ puf5Δ mutants. The strains that were heterozygous for favorite alleles were sporulated, and tetrads were dissected onto YPD or YPD sorbitol plate. The growth of segregants after 4 days at 25°C is shown. Genotypes are indicated on the both sides. More than 50 tetrads were dissected, and representative data are shown. (a) Tetrad analysis of strain 10BD‐cp6 that was heterozygous for ccr4Δ and puf6Δ alleles on YPD plate. (b) Tetrad analysis of strain 10BD‐cp5p6 that was heterozygous for ccr4Δ, puf5Δ, and puf6Δ alleles on YPD sorbitol plate

Figure 6

Effect of puf6∆ mutation on Lrg1 protein levels. The 3xFLAG‐Lrg1 protein levels in the wild‐type, ccr4Δ, puf6Δ, and ccr4Δ puf6Δ mutant strains (a), and in the wild‐type, puf6Δ, ccr4Δ puf5Δ, and ccr4Δ puf5Δ puf6Δ mutant strains (b). The strains harboring pRS316–3xFLAG‐LRG1 plasmid were grown at 28°C from the log phase (4 hr) to the stationary phase (72 hr) in SC‐Ura medium. The cells were collected at indicated times and total proteins were prepared. Western blot analysis as described in Materials and Methods was carried out to visualize 3xFLAG‐Lrg1 protein (upper panel), and Pgk1 protein (lower panel) as a loading control. The 3xFLAG‐Lrg1 protein levels are indicated as percentage of wild‐type levels and represent the mean of three independent experiments with standard deviation

A recent study proposed that Puf6 directly interacts with Rpl43 ribosomal proteins and regulates ribosome biogenesis (Yang et al., 2016). Yeast has two homologues of RPL43, RPL43A, and RPL43B. Thus, we investigated the effect of rpl43aΔ and rpl43bΔ on the growth defect of the ccr4Δ puf5Δ mutant. Tetrad analyses showed that the ccr4Δ puf5Δ rpl43aΔ and ccr4Δ puf5Δ rpl43bΔ triple mutant cells grew better than the ccr4Δ puf5Δ double mutant cells (Figure 7a,b). These data suggest that Rpl43, together with Puf6, is involved in the Ccr4‐mediated regulation of gene expression.

Figure 7

Deletion of RPL43A or RPL43B suppressed the growth defect of ccr4Δ puf5Δ mutant. The strains that were heterozygous for favorite alleles were sporulated, and tetrads were dissected onto YPD sorbitol plate. The growth of segregants after 4 days at 25°C is shown. Genotypes are indicated on the both sides. More than 50 tetrads were dissected, and representative data are shown. (a)Tetrad analysis of strain 10BD‐cp5r43 that was heterozygous for ccr4Δ, puf5Δ, and rpl43aΔ alleles. (b) Tetrad analysis of strain 10BD‐cp5r43 that was heterozygous for ccr4Δ, puf5Δ, and rpl43bΔ alleles

3 DISCUSSION

3.1 Puf5 regulates LRG1 independently of deadenylation

A previous study has shown that Ccr4 acts as the main deadenylase of LRG1 mRNA (Duy et al., 2017). LRG1 mRNA physically interacts with Puf5 through a consensus binding site located in its 3'‐UTR (Gerber et al., 2004; Wilinski et al., 2015). If Puf5 decreases LRG1 mRNA by recruiting the Ccr4‐Not complex, the deletion of PUF5 in ccr4Δ background would not cause further increase in Lrg1 protein level. However, Lrg1 proteins in the ccr4Δ puf5Δ double mutant were much more abundant than that in ccr4Δ or puf5Δ single mutant (Figure 3a). This result suggests that Ccr4 and Puf5 function independently of each other. We further found that the poly(A) tail length of LRG1 mRNA was unaffected by puf5Δ (Figure 3b), suggesting that the regulation of LRG1 mRNA by Puf5 is separated from the Ccr4‐mediated deadenylation. How does Puf5 negatively regulate LRG1 expression in a deadenylation‐independent manner? Previous studies have shown that Puf5 can repress a reporter mRNA harboring 3'‐UTR of HO mRNA, a known target of Puf5, by recruiting an eIF4E‐binding protein Eap1 (Blewett & Goldstrohm, 2012; Hook et al., 2007; Tadauchi et al., 2001). Eap1 associates with Dhh1 decapping activator and Dcp1‐Dcp2 decapping enzymes, and promotes decapping of the reporter mRNA (Blewett & Goldstrohm, 2012). Furthermore, other PUF proteins, including Puf3 and Puf6 in yeast and Drosophila Pumilio, have been reported to act independently of deadenylation to repress mRNAs (Miller & Olivas, 2010; Wickens et al., 2002). Thus, it is possible that Puf5 destabilizes LRG1 mRNA in a Ccr4‐independent manner by removing 5'‐cap of LRG1 mRNA. Further works need to provide further insight into the molecular mechanism in which Puf5 regulates LRG1 mRNA.

3.2 Puf6 together with Rpl43 is involved in the Ccr4‐ and Puf5‐mediated regulation of cell growth

Our tetrad analysis showed that, in contrast to puf5Δ mutation, puf6Δ mutation suppresses the growth defect of ccr4Δ (Figure 5a). Furthermore, puf6Δ mutation suppresses the growth defect of ccr4Δ puf5Δ mutant cells (Figure 5b). Puf6 may not be involved in the regulation of LRG1 mRNA as the deletion of PUF6 did not alter Lrg1 protein levels (Figure 6a,b). It has been supposed that Puf6 has important roles in 60S ribosomal subunit biogenesis (Yang et al., 2016). Puf6 directly interacts with Rpl43 ribosomal protein, then facilitates the incorporation of Rpl43 into 60S ribosomal subunit (Yang et al., 2016). Our data suggest that Rpl43 is also involved in the regulation of cell growth that mediated by Ccr4 and Puf5. Both Ccr4 and Puf5 have important functions in mRNA repression. Thus, aberrant translation may occur in the absence of these proteins. Consistently, we previously showed that polysomes in the ccr4Δ mutant were more abundant than that in wild type (Duy et al., 2017). We anticipate that the loss of PUF6 would reduce the biogenesis of 60S ribosomal subunit, resulting in decreased aberrant translation in the ccr4Δ mutant. Loss of PUF6 failed to suppress the temperature‐sensitive growth of puf5∆ (data not shown), although it slightly suppressed the growth defect of ccr4Δ (Figure 5a). These observations might imply that Ccr4 is more important than Puf5 in the proper translational control.

Taken together, we propose that Puf5 regulates LRG1 mRNA in a manner independent of deadenylation. Moreover, we showed that Puf6 is also likely to be involved in cell growth regulation of Ccr4 and Puf5. Our study provides valuable insights into the roles of two PUF RNA‐binding proteins, Puf5 and Puf6, in the growth of yeast cells. The molecular mechanism how Puf5 regulates LRG1 mRNA will be the focus of future studies. Further experiments are also needed to identify other mRNAs regulated by Puf5 in deadenylation‐independent mechanisms.

4 EXPERIMENTAL PROCEDURES

4.1 Strains and general methods

Escherichia coli DH5α was used for DNA manipulations. Strains used in this study are described in Table 1. Standard procedures were followed for yeast manipulations (Adams et al., 1997). The media used in this study included rich medium, synthetic complete medium (SC), and synthetic minimal medium (SD) (Adams et al., 1997). Synthetic complete media lacking amino acids or other nutrients (e.g., SC‐Ura corresponds to SC lacking uracil) were used to select transformants. Recombinant DNA procedures were carried out as described (Sambrook et al., 1989).

Table 1. Strains used in this study

Strains	Genotype	Source or reference
10B	MATα ade2 trp1 can1 leu2 his3 ura3 GAL psi+HOp‐ADE2‐HO 3' UTR	Tadauchi et al., 2001
10BD	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3	Tadauchi et al., 2001
10BD‐r2p5	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 ROM2/rom2 ∆ ::CgLEU2 PUF5/puf5 ∆ ::CgHIS3	This study
10BD‐r2p5lU	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 ROM2/rom2 ∆ ::CgLEU2 PUF5/puf5 ∆ ::CgHIS3 LRG1/lrg1Δ::KlURA3	This study
10BD‐r2p1	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 ROM2/rom2 ∆ ::CgLEU2 PUF1/puf1 ∆ ::CgHIS3	This study
10BD‐r2p2	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 ROM2/rom2 ∆ ::CgLEU2 PUF2/puf2 ∆ ::CgHIS3	This study
10BD‐r2p3	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 ROM2/rom2 ∆ ::CgLEU2 PUF3/puf3 ∆ ::CgHIS3	This study
10BD‐r2p4	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 ROM2/rom2 ∆ ::CgLEU2 PUF4/puf4 ∆ ::CgHIS3	This study
10BD‐r2p6	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 ROM2/rom2 ∆ ::CgLEU2 PUF6/puf6 ∆ ::CgHIS3	This study
10BD‐cp5lU	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 CCR4/ccr4 ∆ ::CgLEU2 PUF5/puf5 ∆ ::CgTRP1 LRG1/lrg1∆::KlURA3	This study
10BD‐pp5lU	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 POP2/pop2 ∆ ::CgLEU2 PUF5/puf5 △ ::CgTRP1 LRG1/lrg1 ∆ ::KlURA3	This study
10BD‐dp5lU	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 DHH1/dhh1 ∆ ::CgLEU2 PUF5/puf5 ∆ ::CgTRP1 LRG1/lrg1∆::KlURA3	This study
10BD‐c6	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 CCR4/ccr4 ∆ ::CgLEU2 PBP1/pbp1 ∆ ::CgHIS3	This study
10BD‐p56	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 PUF5/puf5 ∆ ::CgTRP1 PBP1/pbp1 ∆ ::CgHIS3	This study
cp5‐1A	MAT α ade2 trp1 can1 leu2 his3 ura3	This study
cp5‐1B	MAT α ade2 trp1 can1 leu2 his3 ura3 ccr4 ∆ ::CgLEU2	This study
cp5‐1C	MAT a ade2 trp1 can1 leu2 his3 ura3 ccr4 ∆ ::CgLEU2 puf5 ∆ ::CgTRP1	This study
cp5‐1D	MAT a ade2 trp1 can1 leu2 his3 ura3 puf5 ∆ ::CgTRP1	This study
c6‐1A	MAT α ade2 trp1 can1 leu2 his3 ura3	This study
c6‐1B	MAT α ade2 trp1 can1 leu2 his3 ura3 ccr4 ∆ ::CgLEU2	This study
c6‐1C	MAT a ade2 trp1 can1 leu2 his3 ura3 ccr4 ∆ ::CgLEU2 pbp1 ∆ ::CgHIS3	This study
c6‐1D	MAT a ade2 trp1 can1 leu2 his3 ura3 pbp1 ∆ ::CgHIS3	This study
p56‐1A	MAT α ade2 trp1 can1 leu2 his3 ura3	This study
p56‐1B	MAT α ade2 trp1 can1 leu2 his3 ura3 puf5 ∆ ::CgTRP1	This study
p56‐1C	MAT a ade2 trp1 can1 leu2 his3 ura3 puf5 ∆ ::CgTRP1 pbp1 ∆ ::CgHIS3	This study
p56‐1D	MAT a ade2 trp1 can1 leu2 his3 ura3 pbp1 ∆ ::CgHIS3	This study
10BD‐cp6	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 CCR4/ccr4 ∆ ::CgLEU2 PUF6/puf6 ∆ ::CgHIS3	This study
10BD‐cp5p6	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 CCR4/ccr4 ∆ ::CgLEU2 PUF5/puf5 △ ::CgTRP1 PUF6/puf6 ∆ ::CgHIS3	This study
cp6‐1A	MAT α ade2 trp1 can1 leu2 his3 ura3	This study
cp6‐1B	MAT α ade2 trp1 can1 leu2 his3 ura3 ccr4 ∆ ::CgLEU2 puf6 ∆ ::CgHIS3	This study
cp6‐1C	MAT a ade2 trp1 can1 leu2 his3 ura3 puf6 ∆ ::CgHIS3	This study
cp6‐1D	MAT a ade2 trp1 can1 leu2 his3 ura3 ccr4 ∆ ::CgLEU2	This study
cp5p6‐2A	MAT α ade2 trp1 can1 leu2 his3 ura3 puf6 ∆ ::CgHIS3	This study
cp5p6‐2B	MAT α ade2 trp1 can1 leu2 his3 ura3 ccr4 ∆ ::CgLEU2 puf5 ∆ ::CgTRP1 puf6 ∆ ::CgHIS3	This study
cp5p6‐2C	MAT α ade2 trp1 can1 leu2 his3 ura3 ccr4 ∆ ::CgLEU2 puf5 ∆ ::CgTRP1	This study
cp5p6‐2D	MAT α ade2 trp1 can1 leu2 his3 ura3	This study
10BD‐cp5‐43a	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 CCR4/ccr4 ∆ ::CgLEU2 PUF5/puf5 ∆ ::CgTRP1 RPL43A/rpl43a∆::CgHIS3	This study
10BD‐cp5‐43b	MAT a /MAT α ade2/ade2 trp1/trp1 can1/can1 leu2/leu2 his3/his3 ura3/ura3 CCR4/ccr4 ∆ ::CgLEU2 PUF5/puf5 ∆ ::CgTRP1 RPL43B/rpl43b∆::CgHIS3	This study

4.2 Plasmids

Plasmids used in this study are described in Table 2. Plasmids pCgLEU2, pCgHIS3, and pCgTRP1 are pUC19 carrying the Candida glabrata LEU2, HIS3, and TRP1 genes, respectively (Sakumoto et al., 1999). Plasmid pKlURA3 is pUC19 carrying the Kluyveromyces lactis URA3. Plasmid pRS316–3xFLAG‐LRG1 expressing 3xFlag‐Lrg1 driven by LRG1 endogenous promoter and terminator was used for the experiment for Western blotting of Lrg1 protein (Duy et al., 2017).

Table 2. Plasmids used in this study

Plasmids	Relevant markers	Source or reference
pRS316‐3xFLAG‐LRG1	URA3, CEN‐ARS, 3xFLAG‐LRG1‐LRG1 3’UTR	Duy et al. (2017)
pCgLEU2	Candida glabrata LEU2 in pUC19	Sakumoto et al. (1999)
pCgHIS3	C. glabrata HIS3 in pUC19	Sakumoto et al. (1999)
pCgTRP1	C. glabrata TRP1 in pUC19	Sakumoto et al. (1999)
pKlURA3	Kluyveromyces lactis URA3 in pUC19	Sakumoto et al. (1999)

4.3 Gene deletion and protein tagging

Deletions of PUF5, CCR4, POP2, DHH1, LRG1, ROM2, PUF6, RPL43A, and RPL43B were constructed by a PCR‐based gene deletion method (Baudin et al., 1993; Sakumoto et al., 1999; Schneider et al., 1996). Primer sets were designed such that 46 bases at the 5' end of the primers were complementary to those at the corresponding region of the target gene, and 20 bases at their 3' end were complementary to the pUC19 sequence outside the polylinker region in the plasmid pCgLEU2, pCgHIS3, pCgTRP1, or pKlURA3. Primer sets for PCR were designed to delete the ORF completely. The PCR products were transformed into the wild‐type strain and selected for Leu⁺, His⁺, Trp⁺, or Ura⁺.

4.4 Western blot analysis

Extracts were prepared as described previously (Kushnirov, 2000). Extracts were subjected to SDS‐PAGE on 8% acrylamide gels followed by electroblotting onto an Immobilon membrane (MILLIPORE). To detect 3 × Flag‐Lrg1 protein, the membrane was incubated with anti‐FLAG polyclonal antibody M2 (Sigma) (1:1,000). To control for equal loading of the lanes, the blots were probed with anti‐Pgk1 antibody (Invitrogen) (1:1,000). Signal intensities were quantified using ImageJ, and statistical analysis was carried out with Excel (Microsoft).

4.5 RNA extraction and poly(A) tail length assay

Cells were grown from the exponential phase to the stationary phase in SC‐Ura medium and then collected. Total RNAs were then prepared using ISOGEN reagent (Nippon Gene) and the RNeasy Mini kit (Qiagen). The poly(A) tail length of LRG1 mRNA was measured by using the poly(A) tail length assay kit (Affymetrix) according to the manufacturer's instruction. A fragment including LRG1 poly(A) tail was amplified by using the forward primer anneals to LRG1 3'‐UTR (AAGATTCGACCACAACGGTCATAC) and the universal reverse primers included in the kit. The difference in poly(A) tail size was visualized by 2.5% agarose gel electrophoresis. The average length of poly(A) tail was determined by sequencing.

ACKNOWLEDGMENTS

We thank the members of Molecular Cell Biology Laboratory for valuable discussions. This research was supported by JSPS KAKENHI Grant Numbers 15K06944 and 18K06053 (to K.I.).