Journal of Applied Microbiology

Volume 108, Issue 5

Transcriptional analysis of virulence‐related genes in enterococci from distinct origins

A.R. Carlos

Universidade de Lisboa, Faculdade de Ciências, Centro de Biodiversidade, Genómica Integrativa e Funcional (BioFIG), Edifício ICAT, Campus da FCUL, Campo Grande, Lisboa, Portugal

Search for more papers by this author
T. Semedo‐Lemsaddek

Universidade de Lisboa, Faculdade de Ciências, Centro de Biodiversidade, Genómica Integrativa e Funcional (BioFIG), Edifício ICAT, Campus da FCUL, Campo Grande, Lisboa, Portugal

Search for more papers by this author
M.T. Barreto‐Crespo

Instituto de Biologia Experimental e Tecnológica (IBET) and Instituto de Tecnologia Química e Biológica Universidade Nova de Lisboa (ITQB‐UNL), Qta do Marquês, Oeiras, Portugal

Search for more papers by this author
R Tenreiro

Universidade de Lisboa, Faculdade de Ciências, Centro de Biodiversidade, Genómica Integrativa e Funcional (BioFIG), Edifício ICAT, Campus da FCUL, Campo Grande, Lisboa, Portugal

Search for more papers by this author
First published: 08 April 2010
Cited by: 15
Teresa Semedo‐Lemsaddek, Faculdade de Ciências da Universidade de Lisboa, Edifício ICAT, Campus da FCUL, Campo Grande, 1749‐016 Lisboa, Portugal.
E‐mail: tmsemedo@fc.ul.pt

Abstract

Aims: The role of enterococci in food fermentation and as probiotics counteracts with their increasing importance as human pathogens. Over the years, several virulence factors have been described, mainly in clinical strains but also in food isolates. However, differential expression of such traits may modulate the pathogenic potential of the harbouring enterococci. To further unravel such differential response, this study aims to identify environmental cues responsible for triggering the expression of virulence‐related genes.

Methods and Results: The differential expression of eight virulence‐related genes (cylMBAI, agg, esp, efaAfs and efaAfm) in 16 enterococci from distinct origins, grown in conditions simulating environmental colonization and infection sites, was analysed by reverse transcriptase PCR. The expression profiles were environmental and strain‐dependent, because no constant response was observed neither for clinical nor food enterococci.

Conclusions: Virulence expression profiles are strain‐specific and unrelated with strain’s origin or species allocation.

Significance and Impact of the Study: The current study constitutes the first approach aimed at the evaluation of the differential expression of enterococcal virulence‐related genes combining so many growth environments, enterococcal species and origins. So, with this investigation, we intend to contribute to the clarification of enterococcal pathogenicity potential, especially for food strains.

Introduction

Enterococci have been described as extremely hardy micro‐organisms capable of inhabiting environments with a wide range of temperatures (10 and 45°C), pH values (4·6 and 9·6) and NaCl concentrations (up to 6·5%). Because of this high adaptability, they can be found in soil, water, plants and the gastrointestinal tracts of humans and animals. Although usually viewed as commensals, they are now acknowledged as opportunistic pathogens responsible for a broad variety of diseases, namely, bacteraemia, endocarditis, urinary tract infections and surgical wound infections (Jett et al. 1994; Seno et al. 2005; Stevens and Edmond 2005; Shaked et al. 2006). Enterococcal pathogenic potential is greatly increased because of their intrinsic and acquired resistance against several antimicrobial agents (Moellering and Krogstad 1979; Eliopoulos et al. 1988; Wade and Uttley 1996) and highly efficient ability to transfer genetic material (Clewell 1990).

Enterococcus faecalis is considered responsible for nearly 80% of the infections, while Enterococcus faecium accounts for the majority of the remainder but other species have been increasingly reported as causes of human infection (Higashide et al. 2005; Iaria et al. 2005).

Although a concern as human pathogens, these bacteria also play a beneficial role in the development of sensory characteristics of fermented foods, such as traditional cheeses produced in Mediterranean countries (Tsakalidou et al. 1993; Desmasures et al. 1997; Mannu et al. 1999; Andrighetto et al. 2001). In Portugal, enterococci represent the predominant lactic acid bacteria present in several artisanal cheeses produced from raw ewe’s milk (Lopes et al. 1999). Enterococci have also been successfully used as starter and adjunct cultures, and as probiotics (Bellomo et al. 1980; Agerholm‐Larsen et al. 2000). Therefore, the presence of enterococci in foods, associated with their dual role as opportunistic pathogens and as food fermenters, poses apprehension regarding their potential pathogenicity.

The first virulence factor to be described in enterococci was cytolysin, a post‐translationally modified protein‐toxin, encoded by the cylLLLSMBAI operon, which causes a β‐haemolytic reaction on certain blood erythrocytes and also possesses bactericidal activity against a broad range of bacteria. The genes cylLL and cylLS code for the cytolysin structural subunits and the remaining genes code for proteins involved in post‐translational modifications (cylM), transport (cylB), activation (cylA) and self‐protection (cylI) (for review see Shankar et al. 2004).

As adherence to host tissues is a crucial step in the infection process, adhesins are expected to play an important role in the establishment and maintenance of colonization. Several adhesins have been associated with enterococcal pathogenicity. Aggregation substance (AS, encoded by the agg gene) is a pheromone‐inducible surface protein which mediates binding of donor cells to plasmid‐free recipients (Wirth 1994) and adherence to different host cells (Guzman et al. 1989; Kreft et al. 1992; Sartingen et al. 2000). Enterococcal surface protein (Esp, encoded by the esp gene) is a high molecular weight extracellular surface protein which contributes to colonization and persistence in the urinary tract and is suggested to be associated with increased virulence of the species Ent. faecalis and Ent. faecium (Shankar et al. 1999; Willems et al. 2001). EfaAfs and EfaAfm are adhesin‐like Ent. faecalis and Ent. faecium antigens detected in the serum of endocarditis patients.

Studies recently performed (Shankar et al. 2002; Leavis et al. 2004) revealed that some of these determinants (e.g. cyl operon, agg and esp) can be clustered in the same region of the genome as part of pathogenicity islands. These islands have already been described for Ent. faecalis (Shankar et al. 2002) and Ent. faecium (Leavis et al. 2004), but other species can also harbour these genetic elements.

Over the last decade, studies have been accomplished to screen for the presence of virulence determinants especially in clinical but also in food‐related enterococci (Eaton and Gasson 2001; Semedo et al. 2003a,b). These reports detected the presence of virulence genes in food enterococci, but little is known about the environmental cues that regulate their expression. In this study, the differential expression of eight virulence determinants was analysed after growth of 16 enterococci (from distinct origins and species) in conditions simulating environmental colonization and infection sites.

Materials and methods

Micro‐organisms

Sixteen enterococcal strains were selected based on previous work (Semedo et al. 2003a,b; Alves et al. 2004) including eight enterococci isolated from ewe’s milk (L) and cheese (Q) from hereafter designated by food strains (LA78, LA160, QA29a, QA40, QCB54, LN9, LN11 and QSE123); clinical isolates of human (H1881) and veterinarian (V95 and V434) origin and the type and reference strains Enterococcus casseliflavus DSMZ 20680T and Enterococcus raffinosus DSMZ 5633T. The clinical isolates Ent. faecalis MMH594 and V583 and Ent. faecium E300 and the food strain Ent. faecium F10 were also included in this analysis.

Growth conditions

2× yeast tryptone medium (2YT) broth was used as the basic environmental condition to which all other media were compared. Brain heart infusion (BHI) (Biokar Diagnostics, Brookline, MA) broth was selected because of the association between enterococci and heart (endocarditis) and central nervous system (e.g. meningitis) infections. Urine was used because of the high level of enterococcal‐related urinary tract infections in both humans and animals. The occurrence of enterococci as aetiological agents of bacteraemia led to the inclusion of lot‐controlled sterile rabbit serum (Invitrogen Life Technologies, Paisley, UK), from now on referred as serum. For culture in urine, human urine was collected from healthy volunteers (i.e. without a recent history of urinary tract infections or antibiotic usage) and sterilized by filtration through a 0·2‐μm‐pore‐size membrane. Skim milk (AppliChem, Darmstadt, Germany) was used to simulate ewe’s milk/cheese products (environmental colonization) and sterilized by autoclaving 5 min at 121°C followed by rapid cooling. The efficiency of the sterilization methods applied for both urine and skim milk was confirmed by plate inoculation (2YT and BHI) followed by overnight incubation at 30 and 37°C. The different pH values used represent the values registered for BHI (7·4), urine (6·0), serum (7·0) and skim milk (7·0). The saline concentrations used in 2YT and skim milk resemble the ones applied for some traditional cheese production (2·5%) and the maximum NaCl values enterococci are reported to tolerate (6·5%). To prepare skim milk with NaCl, because the addition of the salt to the skim milk caused coagulation during autoclave sterilization, a concentrated saline solution was prepared, sterilized and added to the previously prepared medium. The temperatures included in this analysis, 30 and 37°C, represent the temperature used for milk coagulation during some artisanal cheese production processes and human body temperature, respectively.

In sum, distinct environments related to commensal or environmental colonization and infection sites were analysed, such as laboratorial medium BHI (pH 7·4 at 37°C), rabbit serum (pH 7·0 at 37°C), urine (pH 6·0 at 37°C), skim milk (pH 7·0 at 30 and 37°C) and salted skim milk (pH 7·0 with 2·5%, 5·0% and 6·5% NaCl at 30°C). The medium 2YT was used as control condition at different pH values (6·0, 7·0 and 7·4), temperatures (30 and 37°C) and NaCl concentrations (0%, 2·5%, 5·0% and 6·5%). All strains were grown in all conditions, regardless their origin (clinical or food related).

DNA and RNA extraction, quantification and DNase treatment

For DNA and RNA extraction, strains were cultivated overnight in 2YT broth at 37°C to guarantee that all cultures were in active growth. Following incubation, and under sterility conditions, the cells were collected by centrifugation (c. 109 CFU), the pellets were washed twice with phosphate buffer saline (PBS) pH 7·0 at 10 mmol l−1 and resuspended in 100 μl of the same buffer. Bacterial suspensions were used to inoculate 10 ml of each medium using a 1% inoculum (v/v) and incubated, either at 30 or 37°C, without aeration. When cultures achieved late log phase of growth, previously determined using Microbiology Workstation Bioscreen C® (ThermoLabSystems, Helsinki, Finland) for each strain in each condition (data not shown), cells were harvested by centrifugation, pellets washed twice with 10 mmol l−1 PBS at pH 7·0, resuspended in 250 μl Tris–EDTA with 10 mg ml−1 lysozyme and incubated at 37°C for 1 h.

Genomic DNA was extracted from cultures grown in 2YT pH 7·0 at 37°C by the guanidium thiocyanate method (Pitcher et al. 1989) and for RNA preparation (after growth in all the conditions under analysis) the Trizol® reagent (Invitrogen, Life Technologies) was added and the process continued according to the manufacturer’s instructions. Briefly, cells were homogenized in 1 ml of Trizol® reagent and centrifuged at 12 000 g for 10 min at 4°C. Samples were incubated at 28°C for 5 min followed by the addition of 200 μl chloroform, incubation at 28°C an extra 3 min and centrifugation at 12 000 g for 15 min at 4°C. Aqueous phase was collected to a fresh tube diethylpyrocarbonate (DEPC) treated and the RNA present was precipitated by the addition of 500 μl isopropyl alcohol followed by incubation at 28°C for 10 min and centrifugation at 12 000 g for 10 min at 4°C. RNA was washed by gentle mixing with 1 ml of 75% ethanol followed by centrifugation at 7400 g for 5 min at 4°C. After air drying, the purified RNA was resuspended in 50 μl of DEPC‐treated water.

All DNA and RNA samples were quantified by measuring the absorbance at 260 nm with Anthos Zenyth 3100 (Anthos Labtec Instruments, Salzburg, Austria). Nucleic acids of known concentration were used for calibration.

To avoid false positive amplification in reverse transcriptase PCR (RT‐PCR), the residual contaminating DNA was removed by DNase treatment. For each sample, 3 μg of RNA were treated with 50 U DNase I (Invitrogen, Life Technologies) and incubated at 37°C for 45 min. The reaction was stopped, after the addition of EDTA to a final concentration of 25 mmol l−1, by heating at 65°C for 15 min. The efficiency of the treatment was confirmed by PCR amplification of the housekeeping gene rpoA (RNA polymerase). After DNase treatment, RNA integrity was assessed by agarose gel electrophoresis; 2 μg of RNA of each DNase‐treated sample were loaded on a 1% agarose gel in 0·5% TBE buffer at a voltage of 120 V for 1 h 30 min. The remaining RNA (1 μg) was stored at −80°C and further used for cDNA synthesis.

RT‐PCR amplification

All the primers and reagents used for RT‐PCR and PCR amplifications were purchased from Invitrogen, Life Technologies. The RT‐PCR reactions were performed using SuperScript™ III reverse transcriptase in accordance with the manufacturer’s instructions, but with some modifications. Briefly, 210 ng of random primers, 0·1 mmol l−1 deoxynucleoside triphosphates (dNTPs) and sterile DEPC‐treated water were added to 1 μg of total RNA to a final volume of 13 μl. The mixture was heated to 65°C for 5 min, followed by incubation on ice during at least 1 min. Thereafter, 4 μl of 5× First‐Strand buffer, 1 μl 0·1 mol l−1 dithiothreitol (DTT), 1 μl RNaseOUT™ recombinant RNase inhibitor (40 U μl−1) and 0·5 μl of SuperScript™ III RT (200 U μl−1) were added (final volume 20 μl). Subsequent RT‐PCR reactions were performed in a Thermo RoboCycler (Stratagene, La Jolla, CA, USA) as follows: incubation at 25°C for 5 min followed by incubation at 50°C for 1 h and heat inactivation of the enzyme at 70°C for 15 min. The obtained cDNA was used directly for PCR amplification.

PCR amplification

DNA and cDNA were amplified by gene‐specific PCR with primers directed for the amplification of the virulence genes cylM, cylB, cylA, cylI, agg, esp, efaAfm and efaAfs, and the housekeeping genes, 16S rRNA gene (rrs) and rpoA (see Table 1). For primers developed in this study the complete genome sequence of Ent. faecalis V583 (GenBank accession number AE016830) and the complete sequence of Ent. faecalis MMH594 pathogenicity island (GenBank accession number AF454824) were used.

Table 1. Primers used for gene‐specific PCR
Gene Sequence (5′→3′) Product size (bp) Reference or source
cylM F – AGGGAAATGATAGTAGCAAGC
R – AAATATGGTACTAGCCCTGTCACC
694 This study
cylB F – TAATGGAACAAGGAAACGTCCAG
R – GTAAAGTAGATTTCCCTGACCCAC
573 This study
cylA F – CGGGGATTGATAGGCTTCATCC
R – TAACCATCTGGAAAGTCAGCAG
628 This study
cylI F – GTTGTTAACCGGAGGACCAA
R – TGGCTTATTTCATCATCAGCA
597 This study
agg F – CGGTACAGTTGGCAGTGTTTCG
R – GGCTTGTGGGTCTTTGGCAGAG
518 This study
esp F – TTGCTAATGCTAGTCCACGACC
R – GCGTCAACACTTGCATTGCCGAA
933 Eaton and Gasson (2001)
efaA fm F – AACAGATCCGCATGAATA
R – CATTTCATCATCTGATAGTA
735 Eaton and Gasson (2001)
efaA fs F – GGCTTCTGGTGCGACGATTG
R – AAGCATGCGGATCTTCTGTTTG
534 This study
rpoA F – CGCGGTTACGGAACTACTTTAG
R – GTTAACACGAAGAACGGGTGTG
444 This study
rrs F – AGAGTTTGATCCTGGCTCAG
R – CCGTCAATTCMTTTRAGTTT
907 Massol‐Deya et al. (1995)

PCR amplifications were performed in a Thermo RoboCycler in 0·2 ml reaction tubes with 25 μl mixtures containing PCR buffer (200 mmol l−1 Tris–HCl, 500 mmol l−1 KCl; pH 8·4), 1·5 mmol l−1 MgCl2, 0·1 mmol l−1 dNTPs, 0·5 μmol l−1 of each primer, 1 U of Taq DNA polymerase and 1 μl of DNA or cDNA. Samples were subjected to an initial cycle of denaturation at 94°C for 5 min, followed by 40 cycles of 94°C for 1 min, the adequate annealing temperature for 1 min (54°C for efaAfm, 56°C for esp and 57°C for the remainder) and 72°C for 1 min; a final extension step was performed at 72°C for 5 min and thereafter the samples were cooled to 4°C. Positive and negative control reactions were included at all times. For product visualization an, 8 μl aliquot of the amplification mixture was combined with 2 μl of loading buffer and the preparation was electrophoresed on 1% (w/v) agarose gels at 85 V for 1 h 10 min. After staining with ethidium bromide, the gel images were acquired with Kodak 1D Image Analysis Software (ver. 3.5.2).

Data analysis

Following acquisition, gel images were analysed using ImageJ 1.40g (National Institute of Health, USA) to obtain integrated density parameters (area × mean gray value) of the entire area of each amplicon. The values obtained were used to assess for differences in gene expression after growth in the selected environments. When comparing the influence of parameters such as pH, temperature or NaCl concentration on the expression profiles each gene was normalized to a housekeeping gene, according to eqn 1, to obtain its corresponding expression level (EL).

image(1)

To further analyse how the growth conditions affected gene expression, in comparison with the corresponding control medium, eqn 2 was applied to obtain relative expression ratios (RER).

image(2)

To test the reproducibility of the assay, biological and technical replicates representing 10% of the samples were analysed. Regarding the biological replicates, 5% of the strains were randomly selected, grown under the chosen condition and the corresponding RNA was isolated, followed by RT‐PCR, PCR amplification, separation of the products by agarose gel electrophoresis and determination of the corresponding integrated density values. For the technical replicates, 5% of all the amplification samples were revisualized in agarose gels and the integrated density values of each amplicon were determined as previously explained.

Results

Screening for virulence determinants

Enterococcal strains, selected from previous work (Semedo et al. 2003a,b; Alves et al. 2004) and representing distinct species and origins, were screened for the presence/absence of the virulence‐related genes cylM, cylB, cylA, cylI, agg, esp, efaAfm and efaAfs. The size of the amplification products was compared with the amplicons of Ent. faecalis MMH594, which harbours all the genes under analysis, either disperse in the genome or clustered in a pathogenicity island (Shankar et al. 2002), exception made for the gene efaAfm which product was compared to Ent. faecium F10.

Analysis of the PCR amplification results showed distinct virulence genotypes amongst the clinical, food and reference enterococci (Table 2). For six of the strains under analysis, six or more genes were detected; of these three are food strains (Ent. casseliflavus LN11, Ent. faecalis QA29a and Ent. faecalis QSE123), two are clinical (Ent. faecalis MMH594 and Ent. faecium V95) and one is a reference strain (Ent. casseliflavus DSMZ 20680T). Amongst the virulence genes efaAfs was the most common, because it was identified in all enterococci included in this study, while efaAfm was the least to be detected, found only in Ent. faecium E300 and Enterococcus durans LA160.

Table 2. PCR detection of virulence‐related genes
Origin Strains Species Genotype
Reference DSMZ 5633T Enterococcus raffinosus cylI + esp + efaA fs +
DSMZ 20680T Enterococcus casseliflavus cylMBAI + agg + esp + efaA fs +
Clinical H1881 Enterococcus faecalis cylM + agg + efaA fs +
V434 Ent. faecalis agg + esp + efaA fs +
V583 Ent. faecalis cylMI + agg + efaA fs +
MMH594 Ent. faecalis cylMBAI + agg + esp + efaA fs +
E300 Enterococcus faecium esp + efaA fs + efaA fm +
V95 Ent. faecium cylMBAI + esp + efaA fs +
Food LA78 Enterococcus hirae esp + efaA fs +
QA40 Ent. raffinosus esp + efaA fs +
QCB54 Enterococcus durans esp + efaA fs +
LA160 Ent. durans efaA fs + efaA fm +
LN9 Ent. durans cylMBAI + efaA fs +
QA29a Ent. faecalis cylMBAI + agg + efaA fs +
QSE123 Ent. faecalis cylMBAI + agg + efaA fs +
LN11 Ent. casseliflavus cylMBAI + agg + esp + efaA fs +

Differential expression analysis

To identify the environmental cues that trigger the expression of virulence genes and the influence of parameters like pH, temperature and NaCl concentration on the expression profiles, RT‐PCR was applied. It was formerly demonstrated that the expression of enterococcal virulence genes varies during the life cycle and, for the majority of those genes, the corresponding mRNA levels in 2YT, serum and urine tend to decrease from log to stationary phase (Shepard and Gilmore 2002), reason why in the present study late log phase of growth was selected for RNA isolation.

To select the best normalization approach, standard deviations were calculated for each virulence gene normalized with the housekeeping genes rrs (values between ± 0·000 and ± 0·216) and rpoA (values between ± 0·000 and ± 0·231). Although the overlapping of these standard deviations points to the equivalence of both control genes, rrs was selected for further analysis because it revealed a more constant expression for the majority of the strains in all the conditions assayed.

To determine the effect of temperature on the expression of enterococcal virulence genes, assays in 2YT and skim milk at 30 and 37°C were analysed and ELs for each gene in each condition were determined, using eqn 1, and compared (Fig. 1a and data not shown). Amongst the enterococci included in this study a strain‐specific behaviour was evident with opposite results being obtained, such as the up‐regulation of most virulence genes at human body temperature (2YT at 37°C) for Ent. casseliflavus DSMZ 20680T and LN11 and their down‐regulation for the clinical and food Ent. faecalis MMH594 and QSE123, respectively. Growth in skim milk led to distinct and more homogeneous responses because the increase in temperature to 37°C induced the expression of most virulence genes for the majority of the strains under analysis.

image

Influence of temperature and pH on the expression levels (EL) of virulence genes in enterococci. (a) Growth in 2YT pH 7·0 at 30 ( inline image ) and 37°C ( inline image ); (b) growth in 2YT at 37°C with pH 6·0 ( inline image ), 7·0 ( inline image ) and 7·4 ( inline image ). Calculations were performed using eqn 1 and normalization applied with the housekeeping gene rrs. EL = 1 corresponds to expression similar to the housekeeping gene (represented by a dotted line); EL < 1 corresponds to down‐regulation of the virulence gene relatively to rrs; EL > 1 corresponds to up‐regulation of the virulence gene relatively to rrs.

When comparison of different pH values (6·0, 7·0 and 7·4) was carried on, a decrease on the expression of enterococcal virulence‐related genes associated with a pH increase was evident, with the majority of the genes up‐regulated in 2YT pH 6·0 being down‐regulated in 2YT pH 7·4 (Fig. 1b and data not shown).

Besides pH and temperature, the effect of osmolarity was also analysed. ELs were evaluated in 2YT with NaCl concentrations of 2·5%, 5·0% and 6·5%, after incubation at 30 and 37°C, and skim milk at 30°C with NaCl concentrations of 2·5%, 5·0% and 6·5% (data not shown). For the majority of the virulence genes, the increase in NaCl concentration at 30°C and 37°C had a reduced effect on the expression profiles of each strain. The genes that were up‐ or down‐regulated at 2YT 2·5% NaCl suffered the same type of regulation when NaCl concentration increased. Regarding salt addition in skim milk (Fig. 2a), the effects were similar to the ones obtained after growth in 2YT, i.e. the regulation of gene expression was strain specific and mainly unaffected by the increase of NaCl.

image

Differential expression of virulence genes in enterococci grown in conditions simulating environmental colonization and infection sites. (a) Skim milk at 37°C vs 2YT at 37°C and skim milk (0%, 2·5%, 5% and 6·5% NaCl) vs 2YT (0%, 2·5%, 5% and 6·5% NaCl) at 30°C. ( inline image ) Skim milk 37°C; ( inline image ) skim milk 30°C; ( inline image ) skim milk 2·5% NaCl 30°C; ( inline image ) skim milk 5% NaCl 30°C and ( inline image ) skim milk 6·5% NaCl 30°C. (b) Brain heart infusion (BHI) broth vs 2YT (pH 7·4); serum vs 2YT (pH 7·0) and urine vs 2YT (pH 6·0) at 37°C. ( inline image ) BHI; ( inline image ) serum and ( inline image ) urine. Calculations were performed using eqn 2 and normalization applied with the housekeeping gene rrs. Classes of relative expression ratios (RER) were assigned as follows: RER < 0·4 correspond to strong down‐regulation and are represented as 0 (zero); 0·4 ≤ RER < 0·8 correspond to down‐regulation and are represented as 0·5; 0·8 ≤ RER < 1·5 correspond to expression similar to the control medium (no regulation) and are represented as 1; 1·5 ≤ RER < 10 correspond to up‐regulation and are represented as 2; RER ≥ 10 correspond to strong up‐regulation and are represented as 3.

Virulence gene RERs were also determined for all strains and genes under analysis (using eqn 2) after growth in the conditions simulating environmental colonization (Fig. 2a) and infection sites (Fig. 2b).

Regarding the media simulating environmental colonization (skim milk with 0%; 2·5%; 5·0% and 6·5% NaCl, at 30°C and skim milk 0% NaCl at 37°C) represented in Fig. 2a, the genes under analysis were mostly down‐regulated at 30°C with agg being the exception. For example, in strains MMH594 and LN11 the expression of aggregation encoding gene was highly induced by growth in skim milk without NaCl and for strain QSE123 skim milk with 6·5% had the same effect. Growth in skim milk at 37°C had rather distinct effects because this setting led to a strong up‐regulation of all virulence genes except efaAfs.

In our study, the environments simulating infection sites included growth in BHI (central nervous system and heart infections), serum (bacteraemia) and urine (urinary tract infections) at 37°C (Fig. 2b). Considering the results obtained, the regulation of gene expression under the selected growth conditions was found to be mainly strain specific, with urine being the medium inducing the more relevant up‐ or down‐regulations. In fact, growth in urine induced both the up‐regulation of AS (for the clinical strain MMH594) and its down‐regulation (V583, H1881 and V434, also clinical isolates); similar results were obtained for genes esp and cylI. Serum growth also resulted in opposite outcomes for the virulence genes cylMBAI and agg, because expression of the cytolysin operon and AS was induced for strains MMH594 and QSE123 and clearly repressed for the reference enterococci DSMZ 20680T. Regarding BHI, its effects on the RER were not so obvious. However, considering the average values obtained for all the enterococci under analysis, growth in this medium up‐regulated cylBAI and esp.

Amongst the 16 enterococci analysed, four (one clinical, one reference and two food strains) were selected to explain in detail their expression profiles (Figs 1 and 2 and data not shown).

For the human clinical Ent. faecalis MMH594, the cytolysin genes cylMBA and agg were up‐regulated by infection‐related media (especially serum); regarding the genes cylI and esp, they were up‐regulated by growth in serum, but down‐regulated by urine. For the conditions simulating environmental colonization (skim milk 0% and 2·5% NaCl), the cyl operon and esp were down‐regulated, while agg was up‐regulated. Incubation in 2YT at 30°C had similar results because it also led to the repression of genes cylMBAI and esp. As for the influence of pH in the regulation of virulence expression, the enhancement of pH values from 6·0 to 7·4 resulted in the switch between up‐ and down‐regulation for the cyl genes. Growth in 2YT at 30°C with increasing concentrations of NaCl led to the up‐regulation of cylI and esp but, at 37°C, the response was quite different with the same genes being down‐regulated by 2YT 6·5% NaCl. The addition of NaCl to the skim milk, followed by incubation at 30°C, led to an enhancement of virulence gene expression (data not shown).

For Ent. casseliflavus DSMZ 20680T, all the media simulating infection sites repressed the expression of the cyl operon but for the AS divergent results were obtained, BHI up‐regulated while serum down‐regulated this gene. Incubation in 2YT at 37°C up‐regulated the genes cylMBAI, when compared to incubation at 30°C. Similar results were obtained after incubation in skim milk at the same temperatures. Regarding pH variation, growth in 2YT demonstrated that for this reference enterococci virulence genes, cylMBAI, agg and efaAfs, are more expressed at pH 7·0 than pH 6·0 or 7·4. As for the effect of the NaCl concentration at 30 and 37°C, gene expression was mainly unaffected.

For the food enterococci LN11 (Ent. casseliflavus), growth in urine led to the down‐regulation of the cyl operon and esp while the expression of AS and cylBI were up‐regulated by skim milk at 30°C. The temperature, pH and NaCl variations analysed in this study did not provoke major changes in the expression profile of this strain.

Concerning the food strain Ent. faecalis QSE123 grown in the infection‐related media, serum induced the strongest response, leading to the up‐regulation of the genes cylMBAI and agg. Growth in skim milk and 2YT at 30 and 37°C led to an induced expression of the virulence genes when the temperature rose to human body temperature. The variation of 2YT pH values gave interesting results for this food enterococci, pH values of 6·0 and 7·4 up‐regulated cylMBA while pH 7·0 strongly down‐regulated those genes; cylI and agg were mainly unaffected by pH variation with very low expression being registered for all pH values assayed. The addition of NaCl in 2YT led to more adjustments of gene expression at 37°C, NaCl concentrations up to 5·0% NaCl induced the expression of the cyl operon but at 6·5% NaCl their expression was clearly impaired. Concerning the results obtained for AS after growth in 2YT, the expression values were so reduced that the influence of temperature, pH and NaCl concentration could not be fully investigated.

Discussion

Enterococci, micro‐organisms traditionally viewed as commensal bacteria, are nowadays acknowledged as responsible for life‐threatening infections in humans and animals. However, in spite of their increasing importance as human pathogens, an understanding of the molecular pathogenesis of enterococcal infections is still very limited. While the genes involved in the pathogenicity of these micro‐organisms are slowly being identified, along with the mechanisms behind their regulation, little is known about the environmental signals involved in the conversion of enterococci from commensalism to pathogenicity. There are some indications that environmental cues, including those produced by the bacteria themselves (quorum sensing), may play a role in the regulation of virulence gene expression, and that this may influence the switch to pathogenicity in a potential host (Hew et al. 2007) but, in general, the knowledge on gene expression in enterococci is scarce with very few studies directed towards the analysis of enterococcal genes differentially expressed in environments related to commensal or environmental colonization and infection sites.

To assess if enterococcal virulence determinants are differentially expressed in environments related to colonization and infection, isolates from food products (milk and cheese), clinical strains from both human and veterinarian origin, as well as reference strains from international culture collections were selected. The eight virulence genes selected for this study were previously identified (Jett et al. 1992; Kreft et al. 1992; Schlievert et al. 1998; Singh et al. 1998; Shankar et al. 2001, 2004) and included both cytolysin, an important cellular toxin, and proteins involved in the adhesion to host tissues, which is a crucial step in the infection process.

Regarding the infection‐related environments, BHI, serum and urine, although the expression profile was clearly strain specific, these media induced more than repressed the expression of virulence genes. Looking at all strains and genes and considering values of up‐ or down‐regulation superior to tenfold, for BHI four genes were up‐regulated (cylI for clinical; agg for reference; cylAI and esp for food enterococci) and none down‐regulated, for serum six up‐ (cylBAI and agg for clinical; cylMBAI, efaAfm and agg for food enterococci) and five down‐regulated (cylMBAI and agg for DSMZ 20680T) and for urine seven up‐ (cylMAI, agg and esp for clinical; cylI and esp for reference; cylMBAI, efaAfm and agg for food enterococci) and three down‐regulated (efaAfm for E300 and cylBA for DSMZ 20680T). These data are in accordance with the results previously obtained by Shepard and Gilmore (2002), who also verified a strong inducting effect of serum and urine for the clinical strain Ent. faecalis MMH594. Nevertheless, an important difference between both studies was observed; in our analysis for the clinical strain MMH594 the genes cylI and esp were down‐regulated by urine, while in the study performed by Shepard and Gilmore (2002) their expression was induced. These discrepant results may be explained by the composition of urine as this organic fluid was collected from healthy volunteers and its composition is known to be highly influenced by diet and lifestyle, the cues present in one of the samples can easily be absent from the other.

For the media simulating environmental colonization (skim milk vs 2YT), the effect on gene expression was also evident. Growth on skim milk at 30°C had a strong inducing effect on four virulence genes (cylI, agg, esp and efaAfm for clinical; cylI for reference; efaAfm and agg for food enterococci), while five were repressed (cylBA for clinical; cylMA and efaAfs for reference; cylA and esp for food enterococci). The increase of skim milk's temperature from 30°C to 37°C (human body temperature) raised to six the number of up‐regulated genes (cylMBAI and agg for clinical; cylI for reference; cylMBAI and efaAfm for food enterococci). The majority of the up‐regulated genes belong to the cyl operon.

Altogether, these results suggest that the environmental cues present in infection‐related media, and to a lesser extent in skim milk, somehow stimulate enterococcal expression of virulence genes. This is even more evident when the influence of incubation temperature is taken into account. This temperature‐dependent induction may constitute an evolutionary mechanism through which virulence‐related genes are activated when bacteria enter the human body.

The influence of pH is also very important because, for the majority of the strains under analysis, its increase led to a decrease of enterococcal virulence gene expression. Inside the human body that effect becomes even more significant considering that pH varies in the areas where enterococci are known to colonize and infect. For example, in urine pH values can range from 4·5 to 8·0 (http://www.rnceus.com/ua/uaph.html) and in vegetarians it tends to be acidic. So, pH values bellow 7·0 can favour urinary tract enterococcal infections because virulence genes appear to prefer acidic environments (pH 6·0), in particular the adhesin esp.

As for the influence of NaCl increase, the strains under analysis were mainly unaffected, demonstrating once again that enterococci tolerate high salt concentrations and suggesting that other environmental cues must be more relevant for the regulation of the expression of virulence determinants.

In the genus Enterococcus the most studied virulence factor is cytolysin, a protein‐toxin which causes a β‐haemolytic reaction on blood erythrocytes, possesses bactericidal activity against a broad range of bacteria (Tomich et al. 1979; Gilmore et al. 1994; Haas and Gilmore 1999) and is known to contribute to pathogenicity (Ike et al. 1984; Huycke et al. 1991; Jett et al. 1992, 1995; Callegan et al. 1999).

Previous reports by Day et al. (2003) also demonstrated that cytolysin expression is auto‐induced by a quorum‐sensing mechanism, with such effect being observed at cell densities above 107 CFU ml−1. Because in our study all media were inoculated with 109 CFU ml−1 and RNA isolation was performed at late log phase of growth, the quorum‐sensing gene regulation mechanism was expected to be activated and the expression of the cyl operon induced. Looking at the enterococci under analysis grown in the assayed conditions no constant expression profile of cylMBAI genes was observed neither for strains nor conditions, revealing that mechanisms other than cell density are probably interfering on the expression of the cytolysin genes.

In this study, the expression of cylMBAI genes was also evaluated to check for operon directionality. The cylLLLSMBAI operon is transcribed from the PL promoter and can generate two different transcripts: a short one, if the transcription terminates in the attenuator region between cylLs and cylM, or a full‐length transcript bearing all the six genes (Shankar et al. 2004). Considering the food enterococci LN9, LN11 and QSE123 grown in infection‐related media (BHI and serum) and environmental settings (skim milk at 37°C), the expression values obtained for each cyl gene showed a decrease, which is in accordance with the operon directionality and could be because of the fact that genes closer to the promoter are more likely to be transcribed than the ones that are far apart. However, the same strains grown in urine or skim milk at 30°C revealed distinct results. So, to further unravel this question, additional studies on cyl operon mRNA processing, stability, degradation and regulation of gene expression still need to be performed.

Adherence to host tissues is the first and crucial step in the infection process. For gastrointestinal commensals, such as enterococci, adhesins that promote binding to eukaryotic cells or extracellular matrices are expected to play an important role in the establishment and maintenance of colonization because without specific means of attachment enterococci would likely be eliminated through normal intestinal motility. Several enterococcal adhesion factors that confer binding to mucosal and other epithelial surfaces and facilitate colonization or the formation of vegetations have already been identified (Galli and Wirth 1991; Wirth 1994; Lowe et al. 1995; Singh et al. 1998; Shankar et al. 1999, 2001; Franz et al.2001; Willems et al. 2001; Eaton and Gasson 2002; Leavis et al. 2004). Amongst the adhesins previously reported for this genus AS, Esp, EfaAfs and EfaAfm are the most important and well characterized.

The expression of AS is regulated by quorum sensing (Wirth 2000), enterococci monitor their own cell density using sex pheromones produced by plasmid‐free cells that induce the production of AS in plasmid‐carrying strains. However, the mechanisms that regulate the in vivo expression of AS for enterococci in which agg is chromosomal remain to be elucidated; the only report belongs to Guzman et al. (1991) which demonstrated that growth in serum induces the production of AS. Regarding AS expression in our study, for RNA isolation bacteria were grown in pure culture and no pheromone‐producing enterococci were in contact with AS plasmid‐carrying cells. Therefore, the quorum‐sensing mechanism was most likely switched off. In fact, the gene coding for AS was the least expressed in the assayed conditions, even though it is worth noting that AS was up‐regulated in several strains after growth in skim milk at 30°C, which may constitute an advantage concerning the persistence of the harbouring enterococci in the cheese‐making environment.

Hew et al. (2007) analysed the expression of virulence‐related genes by Ent. faecalis in response to several settings, including BHI and Luria Bertani broth with 6·5% NaCl, and observed that the expression of agg was down‐regulated by the majority of the conditions. The results obtained in our study are in accordance with the results obtained by Hew et al. (2007), indicating that the assayed environments do not promote a significant up‐regulation of agg and suggesting a quorum‐sensing regulation of this gene in the analysed conditions. However, for some strains (e.g. clinical strain MMH594 and food strain QSE123, both Ent. faecalis), and as reported by Guzman et al. (1991) and Shepard and Gilmore (2002), serum induced the expression of AS, pointing to the importance of this adhesin for enterococcal pathogenic potential. Further studies involving adherence to host epithelial surfaces are still need to address the role of this adhesion protein in vivo.

Looking at the expression results obtained for esp in all the enterococci under analysis, this gene was preferentially up‐regulated by growth in BHI, serum and human body temperature (infection‐related environments) while growth in skim milk at 30 and 37°C with 0%, 2·5%, 5·0% and 6·5% NaCl (media simulating ewe’s milk and cheese) and 2YT pH 7·4 led to reduced expression values.

The genes coding for the adhesin‐like EfaAfs and EfaAfm represent two extremes, the first was the gene least affected by the growth conditions under analysis, while the second was highly affected. EfaAfs expressed independently of the growth medium, pH, temperature or NaCl concentration for all strains with an expression profile similar to the housekeeping genes rrs and rpoA, i.e. RER close to 1. Although mainly unaffected by the growth environment efaAfs gene expression was induced by urine (e.g. food strain LA160) and down‐regulated by skim milk, with and without NaCl, at 30°C and 37°C (e.g. DSMZ 5633T); demonstrating the up‐regulating effect of infection‐related media over environmental‐related media.

Regarding the expression of efaAfm, in both harbouring strains (E300 and LA160), this adhesin was induced by growth in skim milk at 30°C and down‐regulated by 2YT in the pH values and temperatures assayed. The results point towards the importance of this adhesin‐like in environmental settings such as the cheese‐making environment.

As stated before, the regulation of gene expression for the growth conditions under analysis was found to be mainly strain specific and unrelated with origin or species allocation of the isolates. Considering that our analysis included enterococci from distinct origins and species, and to further explore the results obtained, four strains were selected for a more thorough examination.

Analysis of the expression profile obtained for the clinical Ent. faecalis MMH594 revealed that infection‐related environments, pH 6·0 and incubation at human body temperature led to the up‐regulation of the majority of the virulence genes, while media simulating environmental colonization repressed them. This is in agreement with the results previously reported by Shepard and Gilmore (2002) where MMH594 virulence genes were strongly induced by growth in serum and urine when compared to 2YT. Although pointing to the same conclusions some differences were observed between the two studies, especially concerning the adhesin esp; in our analysis the expression of this surface protein was strongly repressed by urine, contrary to the reports of Shepard and Gilmore (2002). Discrepancies may be because of urine composition or difference in the methodologies applied, as mentioned earlier.

Regarding Ent. casseliflavus DSMZ 20680 and LN11, they share the same genotype, cylMBAI+agg+esp+efaAfs+, but the expression profiles obtained were distinct, with major differences being detected for AS. This gene can be encoded by all known enterococcal sex‐pheromone plasmids (Galli and Wirth 1991; Wirth 1994; Franz et al. 2001) or by chromosomal pathogenicity islands (Shankar et al. 2002). For DSMZ 20680T and LN11, the plasmidic or genomic nature of this trait is still to be determined but the dissimilar expression profiles point to divergent locations in these two Ent. casseliflavus, with consequent distinct regulation mechanisms.

Enterococcus faecalis QSE123 has an intriguing expression profile because the cytolysin genes were up‐regulated by infection media, skim milk at 37°C, pH 7·4, 2YT with NaCl at 30 and 37°C, revealing the extremely adjustable nature of this food strain. These results demonstrated that QSE123 is able to adapt and activate virulence gene expression despite the growth condition which, associated with the presence of a high number of virulence determinants in its genome (cylMBAI+agg+efaAfs+), point towards its pathogenic potential.

This study contributes to understanding how changes on the environmental conditions affect gene expression in enterococci to allow a better knowledge regarding the use of these bacteria for food fermentations and in probiotics.

The main conclusion of this study is the demonstration that enterococcal strains are able to express virulence genes in different media regardless of their origin or species. No significant differences were detected when comparing the average expression of clinical and food strains (P > 0·05), suggesting that the expression profile of the analysed strains are independent from their origin. Therefore, further studies are still needed to correctly evaluate the pathogenicity of these strains in vivo and allow the selection of ‘safe’ enterococci to be used in the food industry.

Acknowledgements

Teresa Semedo‐Lemsaddek thanks Fundação para a Ciência e Tecnologia for the pos‐doctoral fellowship BPD/20892/2004. We thank Pascale Serror (Unitè des Bactèries Lactiques et Pathogènes Opportunistes, INRA, Jouy‐en‐Josas, France), Johannes Huebner (Division of Infectious Disease, Children’s Hospital, Harvard Medical School, Boston, MA, USA), Rob Willems (University Medical Center Utrecht, Utrecht, the Netherlands) and Tracy Eaton (Division of Food Safety Sciences, Institute of Food Research, Norwich, UK) for supplying the clinical isolates MMH594, V583 and E300 and the food strain F10, respectively.

      The full text of this article hosted at iucr.org is unavailable due to technical difficulties.